2'-O-Aminooxymethyl ribonucleosides are prepared from their 3',5'-disilylated 2'-O-phthalimidooxymethyl derivatives by treatment with NH(4)F in MeOH. The reaction of these novel ribonucleosides with 1-pyrenecarboxaldehyde results in the efficient formation of stable and yet reversible ribonucleoside 2'-conjugates in yields of 69-82%. Indeed, exposure of these conjugates to 0.5 M tetra-n-butylammonium fluoride (TBAF) in THF results in the cleavage of their iminoether functions to give the native ribonucleosides along with the innocuous nitrile side product. Conversely, the reaction of 5-cholesten-3-one or dansyl chloride with 2'-O-aminooxymethyl uridine provides permanent uridine 2'-conjugates, which are left essentially intact upon treatment with TBAF. Alternatively, 5'-O-aminooxymethyl thymidine is prepared by hydrazinolysis of its 3'-O-levulinyl-5'-O-phthalimidooxymethyl precursor. Pyrenylation of 5'-O-aminooxymethyl thymidine and the sensitivity of the 5'-conjugate to TBAF further exemplify the usefulness of this nucleoside for modifying DNA sequences either permanently or reversibly. Although the versatility and uniqueness of 2'-O-aminooxymethyl ribonucleosides in the preparation of modified RNA sequences is demonstrated by the single or double incorporation of a reversible pyrenylated uridine 2'-conjugate into an RNA sequence, the conjugation of 2'-O-aminooxymethyl ribonucleosides with aldehydes, including those generated from their acetals, provides reversible 2'-O-protected ribonucleosides for potential applications in the solid-phase synthesis of native RNA sequences. The synthesis of a chimeric polyuridylic acid is presented as an exemplary model.
2'-O-Aminooxymethyl ribonucleosides are prepared from their 3',5'-disilylated 2'-O-phthalimidooxymethyl derivatives by treatment with NH(4)F in MeOH. The reaction of these novel ribonucleosides with 1-pyrenecarboxaldehyde results in the efficient formation of stable and yet reversible ribonucleoside 2'-conjugates in yields of 69-82%. Indeed, exposure of these conjugates to 0.5 M tetra-n-butylammonium fluoride (TBAF) in THF results in the cleavage of their iminoether functions to give the native ribonucleosides along with the innocuous nitrile side product. Conversely, the reaction of 5-cholesten-3-one or dansyl chloride with 2'-O-aminooxymethyl uridine provides permanent uridine 2'-conjugates, which are left essentially intact upon treatment with TBAF. Alternatively, 5'-O-aminooxymethyl thymidine is prepared by hydrazinolysis of its 3'-O-levulinyl-5'-O-phthalimidooxymethyl precursor. Pyrenylation of 5'-O-aminooxymethyl thymidine and the sensitivity of the 5'-conjugate to TBAF further exemplify the usefulness of this nucleoside for modifying DNA sequences either permanently or reversibly. Although the versatility and uniqueness of 2'-O-aminooxymethyl ribonucleosides in the preparation of modified RNA sequences is demonstrated by the single or double incorporation of a reversible pyrenylated uridine 2'-conjugate into an RNA sequence, the conjugation of 2'-O-aminooxymethyl ribonucleosides with aldehydes, including those generated from their acetals, provides reversible 2'-O-protected ribonucleosides for potential applications in the solid-phase synthesis of native RNA sequences. The synthesis of a chimeric polyuridylic acid is presented as an exemplary model.
Over the past decade, the 2′-hydroxy function of ribonucleosides has been extensively modified for the purpose of identifying the biophysical and biochemical parameters necessary for effective and lasting RNA interference-mediated gene silencing activities (1–4). Actually, 2′-hydroxy modifications are known to impart high binding affinity to RNA sequences, increased lipophilicity, enhanced chemical stability and resistance to nucleases (1,2,5). The 2′-hydroxyl group of ribonucleosides is also an attractive function for conjugation reactions; there are numerous examples of ribonucleoside 2′-conjugates that have been reported in various structural studies (6,7) as well as in therapeutic and diagnostic applications (8,9). Although 2′-O-alkylation of ribonucleosides with functional groups has often been employed in the synthesis of ribonucleoside 2′-conjugates (8,9), this method is generally lacking the regioselectivity needed for the production of conjugates free of isomeric impurities. An alternate strategy to the preparation of ribonucleosides 2′-conjugates is the use of the oxyamino-aldehyde coupling reaction (10–12), which incidentally has extensively been applied to the derivatization of oligonucleotides (13–20). Although the reversibility of the oxyamino-aldehyde coupling reaction has, to the best of our knowledge, never been demonstrated, we rationalized that the conjugation of 2′-O-aminooxymethyl ribonucleosides with various functional groups may provide a powerful tool for the preparation and incorporation of permanent or reversible ribonucleoside 2′-conjugates into RNA sequences. Furthermore, reversible ribonucleoside 2′-conjugates may especially be useful in identifying novel ribonucleoside 2′-hydroxyl protecting groups, which have historically been shown to be of critical importance in RNA synthesis (21) and may lead to an improved approach to the solid-phase synthesis of native or modified RNA sequences. Given that the preparation of 2′-O-aminooxymethyl ribonucleosides has not been described in the scientific literature, we are now reporting an efficient method for the synthesis of these ribonucleosides (5a–d, Scheme 1) and that of several permanent or reversible 2′-conjugates (Figure 1). With the objective of demonstrating the reversibility of 2′-O-aminooxymethyl ribonucleosideconjugates, the details of an unprecedented fluoride-mediated conversion of conjugates6a–d, 12, 14, 16 and 18 to their native ribonucleosides (Scheme 2 and Figure 2) will be discussed. Furthermore, 5′-O-aminooxymethyl thymidine (25, Scheme 3) has also been prepared for the first time and the addition of its pyrenylated conjugate 26 to the 5′-terminus of a DNA sequence serves as a relevant example for the permanent or reversible functionalization of DNA sequences at their 5′-termini. A single or a double incorporation of the 2′-O-pyrenylated ribonucleoside conjugate 6a into a chemically synthesized oligoribonucleotide (21-mer) is performed to further substantiate the permanent/reversible properties of the modified RNA sequence. Moreover, the phosphoramidite derivative of the reversible uridine 2′-conjugate 29 (Scheme 4) is incorporated into a chimeric polyuridylic sequence (21-mer) in order to provide convincing evidence of the usefulness and versatility of 2′-O-aminooxymethyl ribonucleosideconjugates in the design and implementation of novel 2′-hydroxyl protecting groups for potential applications in the synthesis of modified or native RNA sequences.
Ribonucleoside 2′-conjugates produced from the reaction of 5a or 5b with cholesten-3-one (9) or with aldehydes derived from various acetals (11, 13, 15 and 17).
Scheme 2.
Fluoride-assisted conversion of 2′-O-pyrenylated ribonucleosides (6a–d) to native ribonucleosides. TBAF, tetra-n-butylammonium fluoride; B, uracil-1-yl, cytosin-1-yl, adenin-9-yl, or guanin-9-yl.
Figure 2.
RP-HPLC analysis of the fluoride-assisted conversion of silica gel-purified 2′-O-(pyren-1-ylmethanimine-N-oxymethyl)uridine (6a) to uridine. (A) Chromatogram of the silica gel purified 6a. (B) Chromatogram of the conversion of 6a to uridine by treatment with 0.5 M tetra-n-butylammonium fluoride in THF for 3 h at 55°C. (C) Chromatogram of mixed uridine and pyrene-1-carbonitrile commercial samples. Conditions: RP-HPLC analysis was performed using UV detection (254 nm) and a 5 μm Supelcosil LC-18S column (25 cm × 4.6 mm) according to the following conditions: starting from 0.1 M triethylammonium acetate pH 7.0, a linear gradient of 1% MeCN/min was pumped at a flow rate of 1 ml/min for 40 min; the gradient was then increased to 6% MeCN/min for 10 min at the same flow rate and kept isocratic for an additional 15 min. Peak heights are normalized to the highest peak, which is set to 1 AU.
Scheme 3.
Preparation of the pyrenylated deoxyribonucleoside phosphoramidite 27. (i) DMSO, Ac2O, AcOH, 50°C, 16 h; (ii) silica gel chromatography; (iii) SO2Cl2, CH2Cl2, 25°C, 2 h; (iv) N-hydroxyphthalimide, DBU, CH2Cl2, 25°C, 24 h; (v) 1 M hydrazine hydrate in pyridine:AcOH (3:2 v/v), 25°C, 1 h; (vi) 1-pyrenecarboxaldehyde, MeOH, 55°C, 1 h; (vii) 2-cyanoethyl N,N-diisopropylchlorophosphoramidite, Et3N, CH2Cl2, 25°C, 2 h. Lev, levulinyl; Thy, thymin-1-yl.
Scheme 4.
Preparation of the ribonucleoside phosphoramidite 30. (i) NH4F, MeOH, 25°C, 16 h; (ii) methylthioacetaldehyde, MeOH, 55°C, 1 h; (iii) silica gel chromatography; (iv) 30% H2O2, MeOH, 25°C, 2 h; (v) DMTrCl, pyridine, 25°C, 16 h; (vi) 2-cyanoethyl N,N-diisopropylchlorophosphoramidite, Et3N, CH2Cl2, 25°C, 2 h. Ura, uracil-1-yl.
Ribonucleoside 2′-conjugates produced from the reaction of 5a or 5b with cholesten-3-one (9) or with aldehydes derived from various acetals (11, 13, 15 and 17).RP-HPLC analysis of the fluoride-assisted conversion of silica gel-purified 2′-O-(pyren-1-ylmethanimine-N-oxymethyl)uridine (6a) to uridine. (A) Chromatogram of the silica gel purified 6a. (B) Chromatogram of the conversion of 6a to uridine by treatment with 0.5 M tetra-n-butylammonium fluoride in THF for 3 h at 55°C. (C) Chromatogram of mixed uridine and pyrene-1-carbonitrile commercial samples. Conditions: RP-HPLC analysis was performed using UV detection (254 nm) and a 5 μm Supelcosil LC-18S column (25 cm × 4.6 mm) according to the following conditions: starting from 0.1 M triethylammonium acetate pH 7.0, a linear gradient of 1% MeCN/min was pumped at a flow rate of 1 ml/min for 40 min; the gradient was then increased to 6% MeCN/min for 10 min at the same flow rate and kept isocratic for an additional 15 min. Peak heights are normalized to the highest peak, which is set to 1 AU.Synthesis of 2′-O-pyrenylated ribonucleosides derivatives. (i) DMSO, Ac2O, AcOH, 50°C, 16 h; (ii) silica gel chromatography; (iii) SO2Cl2, CH2Cl2, 25°C, 2 h; (iv) N-hydroxyphthalimide, DBU, CH2Cl2, 25°C, 24 h; (v) NH4F, MeOH, 25°C, 16 h; (vi) concd aq NH3, 55°C, 1 h; (vii) 1-pyrenecarboxaldehyde, MeOH, 55°C, 1 h; (viii) DMTrCl, pyridine, 25°C, 16 h; (ix) 2-cyanoethyl N,N-diisopropylchlorophosphoramidite, Et3N, CH2Cl2, 25°C, 2 h. Abreviations. BP: a, uracil-1-yl; b, N4-acetylcytosin-1-yl; c, N6-isobutyryladenin-9-yl; d, N2-phenoxyacetylguanin-9-yl; B: a, uracil-1-yl; b, cytosin-1-yl; c, adenin-9-yl; d, guanin-9-yl; DMTr, 4,4′-dimethoxytrityl.Fluoride-assisted conversion of 2′-O-pyrenylated ribonucleosides (6a–d) to native ribonucleosides. TBAF, tetra-n-butylammonium fluoride; B, uracil-1-yl, cytosin-1-yl, adenin-9-yl, or guanin-9-yl.Preparation of the pyrenylated deoxyribonucleoside phosphoramidite 27. (i) DMSO, Ac2O, AcOH, 50°C, 16 h; (ii) silica gel chromatography; (iii) SO2Cl2, CH2Cl2, 25°C, 2 h; (iv) N-hydroxyphthalimide, DBU, CH2Cl2, 25°C, 24 h; (v) 1 M hydrazine hydrate in pyridine:AcOH (3:2 v/v), 25°C, 1 h; (vi) 1-pyrenecarboxaldehyde, MeOH, 55°C, 1 h; (vii) 2-cyanoethyl N,N-diisopropylchlorophosphoramidite, Et3N, CH2Cl2, 25°C, 2 h. Lev, levulinyl; Thy, thymin-1-yl.Preparation of the ribonucleoside phosphoramidite 30. (i) NH4F, MeOH, 25°C, 16 h; (ii) methylthioacetaldehyde, MeOH, 55°C, 1 h; (iii) silica gel chromatography; (iv) 30% H2O2, MeOH, 25°C, 2 h; (v) DMTrCl, pyridine, 25°C, 16 h; (vi) 2-cyanoethyl N,N-diisopropylchlorophosphoramidite, Et3N, CH2Cl2, 25°C, 2 h. Ura, uracil-1-yl.
The preparation of 2a was performed with minor modifications of a published procedure (22,23). To a solution of commercial 5′-O-(1,1,3,3-tetraisopropyldisiloxane-1,3-diyl)uridine (1a, 7.3 g, 15 mmol) in DMSO (15 ml) was added glacial AcOH (23 ml) and Ac2O (15 ml). The solution was stirred at 50°C until completion of the reaction (16 h), which was monitored by TLC (CHCl3:MeOH 95:5 v/v). The solution was transferred to a 2 l Erlenmeyer flask to which was added, under vigorous stirring, a solution of K2CO3 (31 g) in water (200 ml). The precipitated material was isolated either by filtration or decantation and was redissolved in a minimum volume of THF (15–20 ml). The resulting solution was then poured into water (250 ml) to give the crude product as a gummy material. Most of the water was decanted; the crude product was carefully dried by consecutive coevaporation with pyridine (30 ml), toluene (3 × 30 ml) and dichloromethane (30 ml). The crude ribonucleoside 2a was purified by chromatography on silica gel using a gradient of MeOH (0 → 3%) in CH2Cl2 as the eluent. Fractions containing pure 2a were collected, evaporated to a foam under low pressure, and dissolved in dry C6H6 (~20 ml); the solution was frozen and then lyophilized under high vacuum affording a white powder (7.00 g, 12.8 mmol, 85%). Characterization data obtained from 1H and 13CNMR analysis of 2a are in agreement with those reported by Semenyuk et al. (23).
To a solution of thoroughly dried 2a (1.1 g, 2.0 mmol) in anhydrous CH2Cl2 (20 ml) was added sulfuryl chloride (176 µl, 2.20 mmol); the solution was stirred at ~25°C for 2 h and was then concentrated under reduced pressure to give the 2′-O-chloromethyluridine derivative 3a as an amorphous solid. N-Hydroxyphthalimide (1.3 g, 8.0 mmol) was placed into a separate reaction vessel to which was added anhydrous CH2Cl2 (10 ml) and DBU (1.04 ml, 7.00 mmol). After 10 min, the red solution was added to unpurified 3a; the reaction mixture was kept stirring at ~25°C for 24 h at which point CH2Cl2 (80 ml) was added. The solution was vigorously mixed with aqueous 1 M acetic acid (20 ml); the aqueous layer was discarded and the organic phase was washed twice with a saturated aqueous solution of NaHCO3 (20 ml). The organic layer was collected, dried over anhydrous Na2SO4, filtered, and evaporated to a foamy solid under reduced pressure. The crude product 4a was purified by chromatography on silica gel using a gradient of MeOH (0 → 3%) in CH2Cl2 as the eluent. Fractions containing 4a were collected and evaporated under vacuum to give a solid (1.24 g, 1.88 mmol) in a yield of 94% based on the molar amount of starting material (2a) that was employed. 1HNMR (300 MHz, DMSO-d6): δ 11.41 (d, J = 2.2 Hz, 1H), 7.88-7.80 (m, 4H), 7.65 (d, J = 8.2 Hz, 1H), 5.62 (dd, J = 8.2, 2.2 Hz, 1H), 5.39 (d, J = 7.2 Hz, 1H), 5.34 (d, J = 7.2 Hz, 1H), 4.87 (d, J = 5.2 Hz, 1H), 4.63 (dd, J = 5.2, 5.2 Hz, 1H), 4.03 (dd, J = 13.0, 3.0 Hz, 1 H), 3.90 (dd, J = 13.0, 3.0 Hz, 1H), 3.79 (dt, J = 9.0, 3.0 Hz, 1H), 1.07–0.95 (m, 28 H). 13CNMR (75 MHz, DMSO-d6): δ 163.2, 163.0, 150.0, 142.6, 134.8, 128.4, 123.3, 101.3, 98.0, 90.6, 80.2, 77.9, 69.8, 60.2, 17.2, 17.1, 17.0, 16.81, 16.77, 16.7, 12.5, 12.3, 12.1, 12.0. +ESI-HRMS: Calcd for C30H43N3O10Si2 [M + H]+ 662.2560, found 662.2560.
2′-O-(Aminooxymethyl)uridine (5a)
Purified 4a (330 mg, 500 μmol) was dissolved in methanol (3 ml), and ammonium fluoride (185 mg, 5.00 mmol) was added. The heterogenous reaction mixture was stirred at ~25°C until desilylation and dephthalimidation were complete (16 h) as indicated by TLC [CHCl3:MeOH (9:1 v/v)]. The reaction product was purified by silica gel chromatography using a gradient of MeOH (0 → 12%) in CH2Cl2 as the eluent. Fractions containing the product were collected and evaporated to dryness under low pressure to provide 5a. 1HNMR (300 MHz, DMSO-d6): δ 11.4 (br s, 1H), 7.93 (d, J = 8.1 Hz, 1H), 6.21 (br s, 2H), 5.87 (d, J = 4.4 Hz, 1H), 5.64 (d, J = 8.1 Hz, 1H), 5.17 (t, J = 4.9 Hz, 1H), 4.74 (s, 2H), 4.11 (m, 2H), 3.88 (m, 1H), 3.65 (ddd, J = 12.0, 5.0, 3.1 Hz, 1H), 3.56 (ddd, J = 12.0, 5.0, 3.1 Hz, 1H), 3.16 (d, J = 5.0 Hz, 1H). 13CNMR (75 MHz, DMSO-d6): δ 163.1, 150.7, 140.4, 101.8, 98.0, 86.7, 84.9, 79.1, 69.0, 60.4. +ESI-HRMS: Calcd for C10H15N3O7 [M + H]+290.0983, found 290.0986.
2′-O-(Aminooxymethyl)uridine (5a) was prepared from 4a at the scale and under conditions identical to those described above. After complete NH4F-mediated desilylation and dephthalimidation, 1-pyrenecarboxaldehyde (460 mg, 2.00 mmol) was added to the reaction mixture, which was then heated at 55°C in a 4-ml screw-cap glass vial until completion of the oximation reaction (1 h) as indicated by TLC [CHCl3:MeOH (9:1 v/v)]. The reaction mixture was transferred to a 20-ml screw-cap glass vial to which was added CH2Cl2 (7 ml) and a saturated aqueous solution of NaHCO3 (2 ml); after vigorous shaking the organic phase was collected and evaporated to dryness under vacuum. The pyrenylated ribonucleoside 6a was purified by chromatography on silica gel employing a gradient of MeOH (0 → 8%) in CH2Cl2 as the eluent. Fractions containing the pure product were collected and evaporated to dryness under reduced pressure affording 6a as a yellowish powder (206 mg, 410 μmol) in a yield of 82% based on the molar amount of starting material (4a) that was used. +ESI-HRMS: Calcd for C27H23N3O7 [M + H]+ 502.1609, found 502.1609.
To a solution of dry 6a (200 mg, 400 μmol) in anhydrous pyridine (1 ml) was added 4,4’-dimethoxytrityl chloride. The solution was allowed to stir for 16 h at ~25°C and was then evaporated to a gum under reduced pressure. The material was dissolved in CHCl3 (10 ml) and was washed with a saturated aqueous solution of NaHCO3 (3 ml). The organic layer was collected, dried over anhydrous Na2SO4, filtered and evaporated to a solid under low pressure. The crude product 7a was purified by chromatography on silica gel using a gradient of MeOH (0 → 2%) in CH2Cl2 containing 0.2% Et3N as the eluent. Fractions containing 7a were collected and evaporated under vacuum to give a solid (293 mg, 364 μmol, 91%).
To a solution of 7a (250 mg, 311 μmol) in anhydrous CH2Cl2 (3 ml) containing Et3N (167 μl, 1.20 mmol) was added 2-cyanoethyl N,N-diisopropylchlorophosphoramidite (140 μl, 622 μmol). The reaction mixture was stirred at ~25°C under argon until complete disappearance of 7a was observed (2 h) by TLC [C6H6:Et3N (9:1 v/v)]. The reaction mixture was then poured into water (3 ml) and was extracted with CH2Cl2 (10 ml). The organic layer was dried over anhydrous Na2SO4 and then filtered. The filtrate was evaporated to dryness under reduced pressure. The crude phosphoramidite product was purified by chromatography on silica gel using C6H6:Et3N (9:1 v/v) as the eluent. Fractions containing the pure product were pooled together and evaporated to dryness under vacuum. The material was dissolved in dry C6H6 (3 ml) and the resulting solution was added to cold (−78°C) stirred hexane (100 ml). The pure ribonucleoside phosphoramidite precipitated immediately as a yellow solid. After careful decantation of hexane, the solid was dissolved in dry C6H6 (3 ml); the solution was frozen and then lyophilized under high vacuum. Et3N-free 8a was isolated as a yellowish powder (275 mg, 0.27 mmol, 88%). 31P NMR (121 MHz, C6D6): δ 151.9, 150.2. +ESI-HRMS: Calcd for C57H58N5O10P (M + Na)+ 1026.3813, found 1026.3796.
The preparation of 2b was performed with minor modifications of a published procedure (22,23). To a solution of commercial N4-acetyl-5′-O-(1,1,3,3-tetraisopropyldisiloxane-1,3-diyl)cytidine (1b, 7.9 g, 15 mmol) in DMSO (15 ml) was added glacial AcOH (15 ml) and Ac2O (10 ml). The solution was stirred at 50°C until completion of the reaction (16 h), which was monitored by TLC [CHCl3:MeOH (95:5 v/v)]. The solution was transferred to a 2 l Erlenmeyer flask to which was added, under vigorous stirring, a solution of K2CO3 (31.2 g) in water (240 ml). The precipitated material was worked-up, purified and processed under conditions identical to those employed in the preparation of 2a. The ribonucleoside 2b was isolated as a white solid (8.30 g, 14.1 mmol, 94%). 1HNMR (300 MHz, DMSO-d6): δ 11.08 (s, 1H), 8.19 (d, J = 7.5 Hz, 1H), 7.35 (d, J = 7.5 Hz, 1H), 5.77 (s, 1H), 5.14 (d, J = 11.2 Hz, 1H), 5.04 (d, J = 11.2 Hz, 1H), 4.44 (d, J = 4.4 Hz, 1H), 4.22 (m, 3H), 3.93 (dd, J = 13.6, 1.9 Hz, 1H), 2.16 (s, 3H), 2.14 (s, 3H), 1.08-0.95 (m, 28H). 13CNMR (75 MHz, DMSO-d6): δ 170.9, 162.6, 154.1, 143.1, 95.0, 88.9, 81.3, 77.0, 73.0, 67.0, 59.2, 24.2, 17.1, 17.0, 16.9, 16.8, 16.7, 16.5, 12.6, 12.4, 12.3, 12.2, 11.8. +ESI-HRMS: Calcd for C25H45N3O7SSi2 [M + H]+ 580.2590, found 580.2597.
The preparation and purification of 4b were performed at a scale andunder conditions identical to those described above for the preparation of 4a. The ribonucleoside 4b was obtained as a solid (1.04 g, 1.48 mmol) in a yield of 74% based on the molar amount of starting material (2b) that was utilized. 1HNMR (300 MHz, DMSO-d6): δ 10.98 (s, 1H), 8.10 (d, J = 7.5 Hz, 1H), 7.87–7.80 (m, 4H), 7.22 (d, J = 7.5 Hz, 1H), 5.76 (s, 1H), 5.52 (d, J = 7.0 Hz, 1H), 5.45 (d, J = 7.0 Hz, 1H), 4.70 (d, J = 4.8 Hz, 1H), 4.41 (dd, J = 4.8, 4.8 Hz, 1H), 4.15 (dd, J = 12.9, 1.2 Hz, 1H), 4.00–3.88 (m, 2H), 2.10 (s, 3H), 1.04–0.89 (m, 28H). 13CNMR (75 MHz, DMSO-d6): δ 171.0, 162.9, 162.7, 154.0, 145.2, 134.7, 134.2, 128.5, 123.2, 122.9, 98.1, 95.0, 90.1, 80.8, 79.3, 68.3, 59.7, 24.3, 17.2, 17.12, 17.09, 17.0, 16.8, 16.7, 16.6, 12.5, 12.3, 12.2, 11.9. +ESI-HRMS: Calcd for C32H46N4O10Si2 [M + H]+ 703.2825, found 703.2825.
2′-O-(Aminooxymethyl)cytidine (5b)
Silica gel-purified 4b (351 mg, 500 μmol) was dissolved in methanol (3 ml), and ammonium fluoride (185 mg, 5.00 mmol) was added. The heterogenous reaction mixture was stirred at ~25°C until desilylation and dephthalimidation were complete (16 h) as indicated by TLC [CHCl3:MeOH (9:1 v/v)]. A stream of air was used to remove MeOH from the reaction mixture and was followed by the addition of commercial concentrated aqueous NH3 (3 ml); the resulting solution was kept at 55°C for 1 h in a tightly closed 4-ml screw-cap glass vial. Excess ammonia was removed under a stream of air; the material left was purified by silica gel chromatography using a gradient of MeOH (0 → 25%) in CH2Cl2 as the eluent. Fractions containing the product were collected and evaporated to dryness under low pressure to give 5b. 1HNMR (300 MHz, DMSO-d6): δ 7.92 (d, J = 7.4 Hz, 1H), 7.26 (m, 2H), 5.83 (d, J = 3.2 Hz, 1H), 5.74 (d, J = 7.4 Hz, 1H), 5.15 (br s, 1H), 4.77 (q, J = 7.2 Hz, 2H), 4.04 (m, 2H), 3.84 (m, 2H), 3.70 (dd, J = 12.2, 2.2 Hz, 1H), 3.70 (dd, J = 12.2, 2.7 Hz, 1H). 13CNMR (75 MHz, DMSO-d6): δ 165.6, 155.3, 140.9, 97.7, 94.0, 88.2, 83.9, 79.3, 68.3, 59.9. +ESI-HRMS: Calcd for C10H16N4O6 [M + H]+ 289.1143, found 289.1145.
2′-O-(Aminooxymethyl)cytidine (5b) was prepared from 4b at a scale and under conditions identical to those described above. After removal of excess ammonia, the material left was suspended in MeOH (3 ml), reacted with 1-pyrenecarboxaldehyde and processed under conditions identical to those employed for the preparation of 6a. The pyrenylated ribonucleoside was purified on silica gel using chromatographic conditions identical to those used for the purification of 6a affording 6b as a yellow powder (188 mg, 375 μmol) in a yield of 75 % based on the molar amount of starting material (4b) that was utilized. +ESI-HRMS: Calcd for C27H24N4O6 [M + H]+ 501.1769, found 501.1769.
The preparation of 2c was performed with minor modifications of a published procedure (22,23). To a solution of commercial N6-isobutyryl-5′-O-(1,1,3,3-tetraisopropyldisiloxane-1,3-diyl)adenosine (1c, 8.7 g, 15 mmol) in DMSO (23 ml) was added glacial AcOH (23 ml) and Ac2O (15 ml). The solution was stirred at 50°C until completion of the reaction (16 h), which was monitored by TLC [CHCl3:MeOH (95:5 v/v)]. The solution was transferred to a 2 l Erlenmeyer flask to which was added, under vigorous stirring, a solution of K2CO3 (46.2 g) in water (230 ml). The precipitated material was worked-up and purified under conditions identical to those employed in the preparation of 2a. The ribonucleoside2c was isolated as a white solid (8.5 g, 13.3 mmol, 89%). 1HNMR (300 MHz, DMSO-d6): δ 10.69 (s, 1H), 8.56 (s, 1H), 8.49 (s, 1H), 6.11 (d, J = 1 Hz, 1H), 5.00 (dd, J = 5.3, 5.2 Hz, 1H), 4.97 (d, J = 11.4 Hz, 1H), 4.91 (d, J = 11.4 Hz, 1H), 4.89 (d, J = 4.8 Hz, 1H), 4.08 (dd, J = 12.9, 2.5 Hz, 1H), 4.02 (dt, J = 9.0, 2.5, Hz, 1H), 3.93 (dd, J = 12.9, 2.3 Hz, 1H), 2.96 (sept, J = 6.7 Hz, 1H), 2.08 (s, 3H), 1.12 (d, J = 6.7 Hz, 6H), 1.09-0.97 (m, 28H). 13CNMR (75 MHz, DMSO-d6): δ 175.2, 151.4, 150.8, 149.9, 142.6, 124.1, 87.6, 80.8, 76.7, 73.7, 69.3, 59.9, 34.2, 19.1, 17.2, 17.1, 17.0, 16.9, 16.8, 16.7, 12.7, 12.6, 12.3, 12.1, 11.9. +ESI-HRMS: Calcd for C28H49N5O6SSi2 [M + H]+ 640.3015, found 640.3016.
The preparation and purification of 4c were performed at a scale and under conditions identical to those described above for the preparation of 4a. The ribonucleoside 4c was obtained as a solid (1.24 g, 1.64 mmol) in a yield of 82% based on the molar amount of the starting material (2c) that was used. 1HNMR (300 MHz, DMSO-d6): δ 10.72 (s, 1H), 8.59 (s, 1H), 8.45 (s, 1H), 7.84-7.74 (m, 4H), 6.06 (d, J = 1.1 Hz, 1H), 5.45 (d, J = 7.5 Hz, 1H), 5.37-5.30 (m, 3H), 4.04–3.89 (m, 3H), 2.97 (sept, J = 6.8 Hz, 1H), 1.15 (d, J = 6.8 Hz, 3H), 1.14 (d, J = 6.8 Hz, 3H), 1.04–0.96 (m, 28H). 13CNMR (75 MHz, DMSO-d6): δ 175.2, 163.0, 151.2, 150.9, 149.9, 144.3, 134.8, 134.2, 128.3, 124.3, 123.2, 122.9, 98.4, 87.7, 80.2, 77.8, 70.3, 59.9, 34.3, 19.2, 19.1, 17.1, 17.0, 16.9, 16.8, 16.7, 12.6, 12.3, 12.1. +ESI-HRMS: Calcd for C35H50N6O9Si2 [M + H]+ 755.3251, found 755.3250.
2′-O-(Aminooxymethyl)adenosine (5c)
The preparation of 5c from 4c was performed at a scale and under conditions identical to those used for the preparation of 5b. After removal of excess ammonia under a stream of air, 2′-O-(aminooxymethyl)adenosine was purified by silica gel chromatography employing a gradient of MeOH (0 → 10%) in CH2Cl2 as the eluent. Fractions containing the product were collected and evaporated to dryness under low pressure affording 5c. 1HNMR (300 MHz, DMSO-d6): δ 8.38 (s, 1H), 8.13 (s, 1H), 7.37 (br s, 2H), 6.21 (br s, 2H), 6.06 (d, J = 6.0 Hz, 1H), 5.43 (m, 2H), 4.68 (q, J = 7.3 Hz, 2H), 4.67 (m, 1H), 4.33 (br s, 1H), 3.99 (q, J = 3.4 Hz, 1H), 3.68 (m, 1H), 3.57 (m, 1H). 13CNMR (75 MHz, DMSO-d6): δ 156.1, 152.4, 148.9, 139.7, 119.2, 98.2, 86.3, 86.1, 79.3, 69.8, 61.4. +ESI-HRMS: Calcd for C11H16N6O5 [M + H]+ 313.1255, found 313.1256.
The preparation of 5c from 4c was performed at a scale and under conditions identical to those described above. After removal of excess ammonia, the material left was suspended in MeOH (3 ml), reacted with 1-pyrenecarboxaldehyde and processed under conditions identical to those employed for the preparation of 6a. The pyrenylated ribonucleoside was purified on silica gel using chromatographic conditions identical to those used for the purification of 6a affording 6c in a yield of 77% (200 mg, 385 μmol) based on the molar amount of starting material (4c) that was employed. +ESI-HRMS: Calcd for C28H24N6O5 [M + H]+ 525.1881, found 525.1882.
The preparation of 2d was performed with minor modifications of a published procedure (22,23). To a solution of commercial N2-phenoxyacetyl-5′-O-(1,1,3,3-tetraisopropyldisiloxane-1,3-diyl)guanosine (1d, 9.9 g, 15 mmol) in DMSO (22.5 ml) was added glacial AcOH (22.5 ml) and Ac2O (15.0 ml). The solution was stirred at 50°C until completion of the reaction (~16 h), which was monitored by TLC [CHCl3:MeOH (95:5 v/v)]. The solution was transferred to a 2 l Erlenmeyer flask to which was added, under vigorous stirring, a solution of K2CO3 (51.0 g) in water (270 ml). The precipitated material was worked-up and purified under conditions identical to those employed in the preparation of 2a. The ribonucleoside 2d was isolated as a white solid (9.3 g, 13 mmol, 87 %). 1HNMR (300 MHz, DMSO-d6): δ 11.84 (br s, 1H), 11.83 (br s, 1H), 8.05 (s, 1H), 7.32 (d, J = 7.6 Hz, 1H), 7.30 (d, J = 8.4 Hz, 1H), 6.98 (m, 3H), 5.91 (d, J = 1.1 Hz, 1H), 4.95 (s, 2H), 4.84 (s, 2H), 4.52 (m, 2H), 4.16 (dd, J = 12.9, 2.5 Hz, 1H), 4.06 (dt, J = 8.2, 2.5 Hz, 1H), 3.95 (dd, J = 12.9, 2.5 Hz, 1H), 2.08 (s, 3H), 1.06–0.95 (m, 28H). 13CNMR (75 MHz, DMSO-d6): δ 170.7, 157.5, 154.8, 147.6, 147.3, 136.1, 129.4, 121.3, 120.5, 114.5, 86.5, 81.3, 77.8, 73.8, 68.8, 66.2, 60.0, 17.2, 17.16, 17.13, 17.1, 17.05, 17.03, 16.8, 16.74, 16.70, 12.8, 12.7, 12.6, 12.3, 12.2, 11.9. +ESI-HRMS: Calcd for C32H49N5O8SSi2 [M + H]+ 720.2913, found 720.2918.
The preparation and purification of 4d were performed at a scale andunder conditions identical to those described above for the preparation of 4a. The ribonucleoside 4d was obtained as a solid (1.10 g, 1.32 mmol) in a yield of 66% based on the molar amount of starting material (2d) that was employed. 1HNMR (300 MHz, DMSO-d6): δ 11.81 (br s, 1H), 11.55 (br s, 1H), 8.15 (s, 1H), 7.85–7.70 (m, 4H), 7.34–7.28 (m, 3H), 6.99–6.94 (m, 3H), 5.94 (d, J = 1.3 Hz, 1H), 5.48 (d, J = 7.0 Hz, 1H), 5.39 (d, J = 7.0 Hz, 1H), 5.48 (dd, J = 5.2, 1.2 Hz, 1H), 4.75 (m, 2H), 4.64 (m, 1H), 4.07–3.89 (m, 3H), 1.07–0.95 (m, 28H). 13CNMR (75 MHz, DMSO-d6): δ 170.5, 162.9, 157.5, 154.9, 148.1, 147.2, 137.2, 134.8, 129.5, 128.3, 123.2, 121.3, 114.5, 98.4, 86.0, 80.7, 78.6, 70.2, 66.2, 60.1, 17.2, 17.1, 16.9, 16.8, 12.8, 12.6, 12.3, 12.05, 12.02. +ESI-HRMS: Calcd for C39H50N6O11Si2 [M + H]+ 835.3149, found 835.3148.
2′-O-(Aminooxymethyl)guanosine (5d)
The preparation of 5d from 4d was performed under conditions identical to those used for the preparation of 5b. After removal of excess ammonia under a stream of air, 2′-O-(aminooxymethyl)guanosine was purified by silica gel chromatography using a gradient of MeOH (0 → 25%) in CH2Cl2 as the eluent. Fractions containing the product were collected and evaporated to dryness under reduced pressure providing 5d. 1HNMR (300 MHz, DMSO-d6): δ 10.77 (br s, 1H), 7.96 (s, 1H), 6.59 (br s, 2H), 5.85 (d, J = 6.0 Hz, 1H), 5.12 (t, J = 5.2 Hz, 1H), 4.72 (m, 2H), 4.46 (dd, J = 6.0, 5.7 Hz, 1H), 4.26 (dd, J = 4.8, 4.8 Hz, 1H), 3.91 (q, J = 3.8 Hz, 1H), 3.61 (dt, J = 11.8, 4.4 Hz, 1H), 3.52 (dt, J = 11.8, 4.4 Hz, 1H). 13CNMR (75 MHz, DMSO-d6): δ 156.6, 153.8, 151.1, 135.3, 116.5, 98.0, 85.6, 84.8, 79.6, 69.6, 61.1. +ESI-HRMS: Calcd for C11H16N6O6 [M + H]+ 329.1204, found 329.1211.
The preparation of 5d from 4d was performed at a scale andunder conditions identical to those described above. After removal of excess ammonia, the material left was suspended in MeOH (3 ml), reacted with 1-pyrenecarboxaldehyde and processed under conditions identical to those employed for the preparation of 6a. The pyrenylated ribonucleoside was purified on silica gel using chromatographic conditions identical to those used for the purification of 6a affording 6d in a yield of 69% (187 mg, 345 μmol) based on the molar amount of starting material (4d) that was utilized. +ESI-HRMS: Calcd for C28H24N6O6 [M + H]+ 541.1830, found 541.1829.
2′-O-(Aminooxymethyl)uridine (5a) was prepared as described above from silica gel-purified 4a (132 mg, 200 µmol). After complete NH4F-mediated desilylation and dephthalimidation of 4a, 5-cholesten-3-one (9, 154 mg, 400 µmol) was added to the reaction mixture, which was then processed under conditions identical to those described in the preparation of 6a. The reaction product was purified by chromatography on silica gel using a gradient of MeOH (0 → 4%) in CH2Cl2 as the eluent. Fractions containing the pure product were collected and evaporated to dryness under reduced pressure giving 10 as a white powder (90 mg, 0.14 mmol) in a yield of 69% based on the molar amount of starting material (4a) that was used. +ESI-HRMS: Calcd for C37H57N3O7 [M + H]+ 656.4269, found 656.4269. The normal phase HPLC profile of 10 is shown in Supplementary Figure S1.
N-(2,2-Dimethoxyethyl)biotinamide (11)
To a suspension of D-(+)-biotin 2-nitrophenyl ester (365 mg, 1.00 mmol) in MeCN (20 ml) was added aminoacetaldehyde dimethyl acetal (130 μl, 1.20 mmol) and Et3N (170 μl, 1.20 mmol). The suspension was gently heated until a solution was obtained; the solution was then stirred for 16 h at ~25°C. The reaction mixture was evaporated to dryness under reduced pressure and the material left was purified by silica gel chromatography using a gradient of MeOH (0 → 10%) in CH2Cl2 as the eluent. Fractions containing the product were collected and evaporated to dryness under low pressure affording 11 as a solid (300 mg, 910 μmol, 91%). 1HNMR (300 MHz, DMSO-d6): δ 7.87 (t, J = 5.8 Hz, 1H), 6.43 (s, 1H), 6.37 (s, 1H), 4.32 (t, J = 5.5 Hz, 1H), 4.28 (d, J = 5.5 Hz, 1H), 4.12 (ddd, J = 7.6, 4.4, 1.8 Hz, 1H), 3.25 (s, 6H), 3.13 (t, J = 5.7 Hz, 2H), 2.82 (dd, J = 12.3, 12.3 Hz, 1H), 2.56 (d, J = 12.3 Hz, 1H), 2.07 (t, J = 7.4 Hz, 2H), 1.66-1.22 (m, 7H). 13CNMR (75 MHz, DMSO-d6): δ 172.2, 162.6, 102.0, 61.0, 59.1, 55.4, 53.1, 40.2, 39.8, 34.9, 28.1, 28.0, 25.2. +ESI-HRMS: Calcd for C14H25N3O4S [M + H]+ 332.1639, found 332.1641.
N-(2-Oxoethyl)biotinamide
The acetal 11 (280 mg, 850 μmol) was dissolved in MeOH (2 ml) and commercial concentrated HCl (0.5 ml) was added to the solution, which was allowed to stir for 1 h at ~25°C. The reaction mixture was evaporated to dryness under reduced pressure to yield the aldehyde, the total amount of which was used without further purification in the preparation of 12.
Preparation of the biotinylated uridine conjugate 12
2′-O-(Aminooxymethyl)uridine (5a) was prepared from silica gel-purified 4a at a scale and under conditions identical to those described for the preparation of 10. After complete NH4F-mediated desilylation and dephthalimidation, all of the N-(2-oxoethyl)biotinamide produced above was dissolved in MeOH (2 ml) and added to the reaction mixture, which was heated at 55°C in a 4-ml screw-cap glass vial until completion of the oximation reaction (1 h) as indicated by TLC [CHCl3:MeOH (9:1 v/v)]. The reaction mixture was purified by chromatography on silica gel employing a gradient of MeOH (0 → 20%) in CH2Cl2 as the eluent. Fractions containing the pure product were collected and evaporated to dryness under reduced pressure providing 12 as a white powder (74 mg, 0.13 mmol) in a yield of 66% based on the molar amount of starting material (4a) that was utilized. +ESI-HRMS: Calcd for C22H32N6O9S [M + H]+ 557.2024, found 557.2024. The RP-HPLC profile of 12 is shown in Supplementary Figure S2A.
The acetal 13 (287 mg, 850 µmol) was dissolved in MeOH (1 ml) and concentrated HCl (0.5 ml) was added to the solution, which was stirred for 1 h at ~25°C. The reaction mixture was then evaporated to dryness under reduced pressure; the material left was dissolved in CH2Cl2 (10 ml) and the solution was washed with NaHCO3 (2 ml of a saturated aqueous solution). The organic layer was collected and was evaporated under low pressure to give the aldehyde as a pale green foam, the total amount of which was used without further purification in the preparation of 14.
Preparation of the dansylated uridine conjugate 14
2′-O-(Aminooxymethyl)uridine (5a) was prepared from silica gel-purified 4a at a scale and under conditions identical to those described for the preparation of 10. After complete NH4F-mediated desilylation and dephthalimidation, all of the N-(2-oxoethyl)-5-(dimethylamino) naphthalene-1-sulfonamide generated above was dissolved in MeOH (1 ml) and added to the reaction mixture, which was heated at 55°C in a 4-ml screw-cap glass vial until completion of the oximation reaction (1 h) as indicated by TLC [CHCl3:MeOH (9:1 v/v)]. The reaction mixture was then worked-up and processed exactly as described in the preparation of 10. The product was purified by chromatography on silica gel employing a gradient of MeOH (0 → 6%) in CH2Cl2 as the eluent. Fractions containing the pure product were collected and evaporated to dryness under reduced pressure to give 14 as a pale green powder (82 mg, 0.14 mmol) in a yield of 70 % based on the molar amount of starting material (4a) that was employed. +ESI-HRMS: Calcd for C24H29N5O9S [M + H]+ 564.1759, found 564.1759. The RP-HPLC profile of 14 is shown in Supplementary Figure S3A.
This aldehyde was prepared from acetal 15 at a scale and under conditions identical to those employed for the preparation N-(2-oxoethyl)-5-(dimethylamino)naphthalene-1-sulfonamide from acetal 13. N-(4-Oxobutyl)-5-(dimethylamino)naphthalene-1-sulfonamide was obtained as a pale green foam, the total amount of which was used without further purification in the preparation of 16.
Preparation of the dansylated uridine conjugate 16
This conjugate was prepared and purified exactly as reported for the preparation and purification of the dansylated uridine conjugate 14. The dansylated uridine conjugate 16 was isolated as a light green powder (96 mg, 0.16 mmol) in a yield of 81 % based on the molar amount of starting material (4a) that was used. +ESI-HRMS: Calcd for C26H33N5O9S [M + H]+ 592.2072, found 592.2071. The RP-HPLC profile of 16 is shown in Supplementary Figure S4A.
To a solution of 4-(dimethylamino)azobenzene-4′-sulfonyl chloride (324 mg, 1.00 mmol) in CH2Cl2 (5 ml) was added aminoacetaldehyde dimethyl acetal (130 μl, 1.20 mmol) and Et3N (179 μl, 1.20 mmol). The solution was allowed to stir for 16 h at ~25°C. The reaction mixture was evaporated to dryness under reduced pressure and the material left was purified by silica gel chromatography using a gradient of MeOH (0 → 2%) in CH2Cl2 as the eluent. Fractions containing the product were collected and evaporated to dryness under reduced pressure affording 17 as a solid (373 mg, 950 µmol, 95%). 1HNMR (300 MHz, DMSO-d6): δ 7.82 (d, J = 9.3 Hz, 2H), 7.19 (m, 4H), 6.85 (d, J = 9.3 Hz, 2H), 4.29 (t, J = 5.4 Hz, 1H), 3.19 (s, 6H), 3.08 (s, 6H), 2.89 (t, J = 5.6 Hz, 2H). 13CNMR (75 MHz, DMSO-d6): δ 154.4, 153.0, 142.5, 140.5, 127.7, 125.3, 122.1, 111.5, 102.3, 53.3, 44.1, 39.8. +ESI-HRMS: Calcd for C18H24N4O4S [M + H]+ 393·1591, found 393.1596.
The acetal 17 (287 mg, 850 µmol) was dissolved in a solution of 10% (w/v) I2 in acetone (10 ml) (24). The resulting solution was stirred at ~25°C for 16 h and was then evaporated to dryness under reduced pressure. The material left was dissolved in CH2Cl2 (10 ml) and washed with an aqueous solution of 5% (w/v) sodium bisulfite (5 ml) followed by a saturated aqueous solution of NaHCO3 (5 ml). The organic layer was collected and was evaporated to dryness under vacuum. The total amount of the orange product was used in the preparation of 18.
The dabsylated cytidine conjugate 18
2′-O-(Aminooxymethyl)cytidine (5b) was prepared from silica gel-purified 4b (140 mg, 0.2 mmol) as described above. After removal of excess ammonia, the material left was suspended in MeOH (3 ml) and all of the N-(2-oxoethyl)-4-(dimethylamino)azobenzene-4′-sulfonamide produced above was suspended in MeOH (1 ml) and added to the reaction mixture, which was heated at 55°C in a 4-ml screw-cap glass vial until completion of the oximation reaction (1 h) as indicated by TLC [CHCl3:MeOH (9:1 v/v)]. The reaction mixture was then worked-up and processed exactly as described in the preparation of 10. The product was purified by chromatography on silica gel employing a gradient of MeOH (0 → 8%) in CH2Cl2 as the eluent. Fractions containing the pure product were collected and evaporated to dryness under reduced pressure providing 18 as an orange powder (74 mg, 0.12 mmol) in a yield of 61% based on the molar amount of starting material (4b) that was employed. +ESI-HRMS: Calcd for C26H32N8O8S [M + H]+ 617.2137, found 617.2134. The RP-HPLC profile of 18 is shown in Supplementary Figure S5A.
4-Aminobutyronitrile was prepared from the reaction of 4-chlorobutyronitrile (207 mg, 2.00 mmol) with potassium phthalimide (407 mg, 2.20 mmol) under the conditions described by McKay et al. (25) with the following modification: the crude 4-aminobutyronitrile, instead of purified 4-aminobutyronitrile hydrochloride, was reacted with a stirred solution of dansyl chloride (135 mg, 500 µmol) in CH2Cl2 (1 ml) for 10 min at ~25°C. The reaction product was analyzed by TLC [CHCl3:MeOH (95:5 v/v)] and was purified by chromatography on silica gel using a gradient of MeOH (0 → 3%) in CH2Cl2 as the eluent. Fractions containing 20 were collected and evaporated under vacuum affording the pure product (123 mg, 390 µmol) in a yield of 78% based on the molar amount of dansyl chloride used in the reaction. 1HNMR (300 MHz, DMSO-d6): δ 8.47 (dt, J = 8.5, 1.1 Hz, 1H), 8.28 (dt, J = 8.5, 1.1 Hz, 1H), 8.11 (dd, J = 7.2, 1.2 Hz, 1H), 8.02 (t, J = 5.8 Hz, 1H), 7.63 (t, J = 7.5 Hz, 1H), 7.60 (t, J = 7.5 Hz, 1H), 7.26 (dd, J = 7.5, 0.7 Hz, 1H), 2.85 (m, 2H), 2.82 (s, 6H), 2.39 (t, J = 7.0 Hz, 2H), 1.60 (quint, J = 7.0 Hz, 2H). 13CNMR (75 MHz, DMSO-d6): δ 151.3, 135.5, 129.5, 129.0, 128.9, 128.3, 127.8, 123.5, 119.9, 118.8, 115.1, 44.9, 40.9, 25.2, 13.4. +ESI-HRMS: Calcd for C16H19N3O2S [M + H]+ 318.1271, found 318.1271.
Silica gel-purified 2′-O-(aminooxymethyl)uridine (5a, 87 mg, 0.30 mmol) was dissolved in pyridine (2 ml) and dansyl chloride (135 mg, 500 µmol) was added. The solution was stirred at ~25°C for 2 h and was then evaporated to dryness under vacuum. The crude product 22 was purified by silica gel chromatography using a gradient of MeOH (0 → 8%) in CH2Cl2 as the eluent. Fractions containing 22 were collected and evaporated under vacuum giving a yellow solid (130 mg, 250 µmol, 83%). +ESI-HRMS: Calcd for C22H26N4O9S [M + H]+ 523.1493, found 523.1493. The RP-HPLC profile of 22 is shown in Supplementary Figure S6A.
To a solution of commercial 3′-O-(levulinyl)-2′-deoxythymidine (3.0 g, 8.8 mmol) in DMSO (9 ml) was added glacial AcOH (13 ml) and Ac2O (9 ml). The solution was stirred at ~50°C until completion of the reaction (16 h), which was monitored by TLC [CHCl3:MeOH (95:5 v/v)]. AcOH and Ac2O were evaporated under vacuum and the remaining material was mixed with 15 g of silica gel. Residual DMSO was allowed to evaporate from the silica gel over a period of 16 h at room temperature. The silica gel mix was layered on the top of a glass column packed with silica gel. The product was eluted using a gradient of MeOH (0 → 3%) in CH2Cl2 as the eluent. Fractions containing pure 23 were collected, evaporated to a foam under low pressure, and dissolved in dry C6H6 (~20 ml); the solution was frozen and then lyophilized under high vacuum affording a white powder (2.8 g, 7.0 mmol, 80%). 1HNMR (300 MHz, DMSO-d6): δ. 11.33 (s, 1H), 7.55 (s, 1H), 6.19 (t, J = 6.2 Hz, 1H), 5.18 (d, J = 5.6 Hz, 1H), 4.74 (s, 2H), 4.11 (s, 1H), 3.69 (s, 2H), 3.31 (s, 1H), 2.74 (t, J = 6.2 Hz, 2H), 2.50 (t, J = 6.2 Hz, 2H), 2.27 (m, 3H), 2.11 (s, 3H), 2.10 (s, 3H), 1.79 (s, 3H). 13CNMR (75 MHz, DMSO-d6): δ 206.7, 171.9, 163.5, 150.3, 135.4, 109.8, 83.7, 82.2, 74.8, 74.7, 67.6, 37.3, 35.9, 29.4, 27.6, 13.4, 12.6. +ESI-HRMS: Calcd for C17H24N2O7S [M + H]+ 401.1377, found 401.1379.
To a solution of thoroughly dried 23 (2.8 g, 7.0 mmol) in anhydrous CH2Cl2 (70 ml) was added neat sulfuryl chloride (626 µl, 7.73 mmol); the solution was stirred at ~25°C for 2 h and was then concentrated under reduced pressure to give 5′-O-chloromethyl-3′-O-levulinyl-2′-O-deoxythymidine as an amorphous solid. N-Hydroxyphthalimide (4.58 g, 28.1 mmol) was placed into a separate reaction vessel to which was added anhydrous CH2Cl2 (35 ml) and DBU (3.60 ml, 24.6 mmol). After 10 min, the red solution was added to unpurified 5′-O-chloromethyl-3′-O-levulinyl-2′-O-deoxythymidine; the reaction mixture was kept stirring at ~25°C for 24 h at which point CH2Cl2 (150 ml) was added. The solution was extracted twice with aqueous 1 M acetic acid (30 ml); the organic phase was collected, washed with a saturated aqueous solution of NaHCO3 (3 × 100 ml), dried over anhydrous Na2SO4, filtered, and evaporated to a foamy solid under reduced pressure. The crude product was purified by chromatography on silica gel using a gradient of MeOH (0 →3%) in CH2Cl2 as the eluent. Fractions containing 24 were collected and evaporated under vacuum to give a solid (2.1 g, 4.1 mmol, 58%). 1HNMR (300 MHz, DMSO-d6): δ 11.31 (s, 1H), 7.87 (s, 4H), 7.48 (s, 1H), 6.17 (dd, J = 6.0, 2.5 Hz, 1H), 5.24 (m, 3H), 4.13 (m, 3H), 2.75 (t, J = 6.2 Hz, 2H), 2.50 (m, 2H), 2.25 (m, 2H), 2.12 (s, 3H), 1.64 (s, 3H). 13CNMR (75 MHz, DMSO-d6): δ 206.7, 171.8, 163.4, 163.1, 150.3, 135.6, 134.8, 128.4, 123.2, 109.6, 100.0, 83.7, 81.8, 74.3, 69.3, 37.3, 35.6, 29.4, 27.6, 11.9. +ESI-HRMS: Calcd for C24H25N3O10 [M + H]+ 516.1613, found 516.1618.
5′-O-(Aminooxymethyl)-2′-deoxythymidine (25)
Under an inert atmosphere, 1 M hydrazine hydrate in pyridine:acetic acid (3:2 v/v, 7.3 ml) was added to a solution of 24 (1.2 g, 2.3 mmol) in anhydrous pyridine (11 ml). The reaction mixture was stirred for 1 h at 25°C and was then concentrated under vacuum to a volume of ~3 ml. The crude product was purified by chromatography on silica gel using a gradient of MeOH (0 →3%) in CH2Cl2 as the eluent. Fractions containing 25 were collected and evaporated under vacuum to give a solid (318 mg, 1.11 mmol, 48%). 1HNMR (300 MHz, DMSO-d6): δ 11.27 (br s, 1H), 7.61 (s, 1H), 6.19 (dd, J = 6.5, 2.5 Hz, 1H), 5.30 (br s, 2H), 4.70 (s, 2H), 4.26 (br s, 1H), 3.90 (br s, 1H), 3.71 (m, 3H), 2.12 (m, 2H), 1.78 (s, 3H). 13CNMR (75 MHz, DMSO-d6): δ 163.6, 150.3, 135.9, 109.4, 98.5, 85.2, 83.8, 70.6, 67.7, 39.0, 12.1. +ESI-HRMS: Calcd for C11H17N3O6 [M + H]+ 288.1190, found 288.1196.
A solution of 25 (300 mg, 1.05 mmol) and1-pyrenecarboxaldehyde (1.1 g, 5.0 mmol) in MeOH (2 ml) was heated at 55°C in a 4-ml screw-cap glass vial until completion of the oximation reaction (1 h) as indicated by TLC [CHCl3:MeOH (9:1 v/v)]. The reaction mixture was transferred to a 20-ml screw-cap glass vial to which was added CH2Cl2 (7 ml) and a saturated aqueous solution of NaHCO3 (2 ml); after vigorous shaking the organic phase was collected and evaporated to dryness under vacuum. The pyrenylated product was purified by chromatography on silica gel employing a gradient of MeOH (0 → 5%) in CH2Cl2 as the eluent. Fractions containing the pure product were collected and evaporated to dryness under reduced pressure affording 26 as a yellowish powder (400 mg, 800 μmol, 80%). +ESI-HRMS: Calcd for C28H25N3O6 [M + Na]+ 522.1636, found 522.1642.
To a solution of 5′-O-(pyren-1-ylmethanimine-N-oxymethyl)-2′-deoxythymidine (26, 350 mg, 700 μmol) in anhydrous CH2Cl2 (5 ml), containing Et3N (0.39 ml, 2.8 mmol), was added 2-cyanoethyl N,N-diisopropylchlorophosphoramidite (0.31 ml, 1.4 mmol). The reaction mixture was stirred at ~25°C under argon until complete disappearance of 26 (2 h) was confirmed by TLC [C6H6:Et3N (9:1 v/v)]. The reaction mixture was then poured into water (5 ml) and was extracted with CH2Cl2 (15 ml). The organic layer was dried over anhydrous Na2SO4, filtered and evaporated to dryness under reduced pressure. The crude phosphoramidite product was purified by chromatography on silica gel using C6H6:Et3N (9:1 v/v) as the eluent. Fractions containing the pure product were pooled together and evaporated to dryness under vacuum. The material was dissolved in dry C6H6 (4 ml) and the resulting solution was added to cold (−78°C) stirred hexane (100 ml). The pure deoxyribonucleoside phosphoramidite precipitated immediately as a yellowish solid. After careful decantation of hexane, the solid was dissolved in dry C6H6 (4 ml); the solution was frozen and then lyophilized under high vacuum. Et3N-free 27 was isolated as a yellowish powder (451 mg, 640 μmol, 92%). 31P NMR (121 MHz, C6D6): δ 148.1, 147.7. +ESI-HRMS: Calcd for C37H42N5O7P (M + H)+ 700.2895, found 700.2904.
Commercial 2-methylthioacetaldehydedimethylacetal was converted in situ to methylthiomethylacetaldehyde under conditions identical to those employed for the preparation of N-(2-oxoethyl)biotinamide with the exception of the reaction scale, which was 10-fold larger. The acidic solution of methylthioacetaldehyde in aqueous methanol was used without workup in the preparation of 28. 2′-O (Aminooxymethyl)uridine (5a) was prepared from silica gel-purified 4a at a scale of 2 mmol under conditions identical to those described for the preparation of 6a. After complete NH4F-mediated desilylation and dephthalimidation, all of the acidic methylthioacetaldehyde solution prepared above was added to the reaction mixture, which was heated at 55°C in a 4-ml screw-cap glass vial until completion of the oximation reaction (1 h) as indicated by TLC [CHCl3:MeOH (9:1 v/v)]. The reaction mixture was purified by chromatography on silica gel employing a gradient of MeOH (0 → 5%) in CH2Cl2 as the eluent. Fractions containing the pure product were collected and evaporated to dryness under reduced pressure providing 28 as a white powder (557 mg, 1.54 mmol) in a yield of 77% based on the molar amount of starting material (4a) that was utilized. 1HNMR (300 MHz, DMSO-d6): δ 11.31 (br s, 1H), 7.87 (d, J = 8.1 Hz, 0.25H), 7.85 (d, J = 8.1 Hz, 0.75H), 7.34 (t, J = 6.7 Hz, 0.75H), 6.89 (t, J = 6.0 Hz, 0.25H), 5.90 (d, J = 5.9 Hz, 0.75H), 5.88 (d, J = 5.9 Hz, 0.25H)), 5.66 (d, J = 8.1 Hz, 0.75H), 5.65 (d, J = 8.1 Hz, 0.25H), 5.22-5.11 (m, 3H), 5.05 (d, J = 7.8 Hz, 1H), 4.25 (dt J = 5.5, 5.3 Hz, 1H), 4.13 (m, 1H), 3.87 (dt, J = 3.3, 3.1 Hz, 1H), 3.65-3.51 (m, 2H), 3.28 (ddd, J = 6.4, 5.9, 5.7 Hz, 1H), 3.11 (ddd, J = 6.9, 6.6, 6.5 Hz, 1H), 2.01 (s, 0.75H), 1.96 (s, 2.25H). 13CNMR (75 MHz, DMSO-d6): δ 162.9, 150.4, 149.5, 149.0, 140.5, 101.9, 101.8, 95.7, 95.6, 85.9, 85.7, 85.3, 85.2, 78.7, 78.5, 68.7, 68.6, 60.8, 60.7, 30.9, 26.4, 14.6, 13.8.
To a solution of 28 (500 mg, 1.38 mmol) in methanol (20 ml) was added 30% H2O2 (5 ml). The solution was allowed to stir at ~25°C until completion of the reaction (2 h) as monitored by TLC [(CHCl3:MeOH (9:1 v/v)]. The reaction mixture was evaporated to dryness under reduced pressure and the residue was purified by chromatography on silica gel using a gradient of CH3OH (0→7%) in CH2Cl2. Fractions containing the pure product were collected and evaporated to a foam under low pressure. The oxidized material was dried by co-evaporation with anhydrous pyridine (3 × 5 ml) under reduced pressure. Dry pyridine (10 ml) was added and was followed by 4,4′-dimethoxytrityl chloride (474 mg, 1.40 mmol). TLC analysis [(CHCl3:MeOH (95:5 v/v)] of the reaction showed a complete reaction within 16 h at ~25°C. The reaction mixture was then poured into a saturated solution of NaHCO3 (200 ml) and was extracted with CH2Cl2 (3 × 150 ml). The combined organic layers were dried over anhydrous Na2SO4. Following filtration, the filtrate was evaporated under reduced pressure and the material left was purified by chromatography on silica gel using a gradient of CH3OH (0→2%) in CH2Cl2 containing 0.2% Et3N as the eluent. Fractions containing pure 29 were collected and evaporated to a foam under low pressure. The purified product was dissolved in dry C6H6 (10 ml); the resulting solution was frozen and was then lyophilized under high vacuum to provide 29 as a powder (830 mg, 1.22 mmol, 89%). The stereochemical complexity of 29 precluded its facile characterization by NMR spectroscopy. The ribonucleoside 29 was characterized as its 3′-phosphoramidite derivative 30.
This compound was prepared from 29, purified and processed under conditions similar to those described for the preparation of the phosphoramidite 8a. The phosphoramidite 30 was isolated as a white powder (801 mg, 0.91 mmol, 83%). 31P NMR (121 MHz, C6D6): δ 151.7, 151.6, 150.5, 150.1, 150.0. +ESI-HRMS: Calcd for C43H54N5O11PS (M + Na)+ 902.3170, found 902.3187.
General procedure for the removal of functional groups from the ribonucleoside conjugates 6a–d, 12, 14, 16 and 18
Purified 6a (5.0 mg, 10 µmol) was placed in a 4-ml screw-cap glass vial and 0.5 M TBAF in THF (100 µl) was added. The tightly closed vial was heated at 55°C; progress of the reaction was monitored by RP-HPLC. Excess solvent was removed under a stream of air; the material left was dissolved in HPLC buffer A (0.1 M triethylammonium acetate, pH 7.0, 500 µl). An aliquot (2 µl) was analyzed by RP-HPLC according to the following conditions: starting from 0.1 M triethylammonium acetate pH 7.0, a linear gradient of 1% MeCN/min was pumped at a flow rate of 1 ml/min for 40 min; the gradient was then increased to 6% MeCN/min for 10 min at the same flow rate and was kept isocratic for an additional 15 min. Peak heights were normalized to the highest peak, which was set to 1 AU.
Solid-phase synthesis of modified chimeric RNA sequences
The solid phase syntheses of 5′-r(U*AUCCGUAGCUAACGUCAUG)dT (31) and 5′-r(U*AUCCGUAGCU*AACGUCAUG)dT (32) [U* and dT correspond to 2′-O-(pyren-1-ylmethanimine-N-oxymethyl)uridine and 2′-deoxythymidine residues, respectively] and 5′-r(UAUCCGUAGCUAACGUCAUG)dT (33) were conducted on a scale of 0.2 µmole in the ‘trityl-off’ mode using a succinyl long chain alkylamine controlled-pore glass (CPG) support functionalized with 2′-deoxythymidine as the leader nucleoside. The syntheses were carried out using a DNA/RNA synthesizer and commercial 2′-O-(tert-butyldimethylsilyl) APac, GPac, CAc and U phosphoramidite monomers (Pac and Ac correspond to phenoxyacetyl and acetyl, respectively), which were dissolved in dry MeCN to give 0.15 M solutions. The pyrenylated ribonucleoside phosphoramidite 8a was also used as a 0.15 M solution in dry MeCN. 5-Benzylthio-1H-tetrazole (0.25 M in MeCN) and all other ancillary reagents necessary for oligonucleotide synthesis were obtained from commercial sources. The reaction time for each phosphoramidite coupling step was set to 5 min. The dedimethoxytritylation, capping and oxidation steps of any synthesis cycle were each performed over a period of 60 s.
Solid-phase synthesis of modified DNA sequences
The solid-phase syntheses of 5′-d(T*ATCCGTAGCTAACGTCATGT) [T* corresponds to 5′-O-(pyren-1-ylmethanimine-N-oxymethyl)-2′-deoxythymidine] (34) and 5′-d(TATCCGTAGCTAACGTCATGT) (35) were carried out using the 5′-pyrenylated deoxyribonucleoside phosphoramidite 27 and commercial dAPac, dGPac, dCAc and dTphosphoramidite monomers, as 0.1 M solutions in dry MeCN, under conditions identical to those employed in the syntheses of 31–33 with the following exceptions: (i) 1 H-tetrazole (0.45 M in MeCN) was used for phosphoramiditeactivation; (ii) the reaction time for each phosphoramidite coupling step was set to 3 min and; (iii) the dedimethoxytritylation, capping and oxidation steps of any synthesis cycle were each performed over a period of 60 s, 30 s and 30 s, respectively.
Solid-phase synthesis of r(U20)dT (37) from the phosphoramidite derivative of a reversible uridine 2′-conjugate
The solid phase syntheses of r(U+20)dT (36) [U+ and dT correspond to 2′-O-[2-(methylsulfinyl)ethanimine-N-oxymethyl]uridine and 2′-deoxythymidine residues, respectively] and the corresponding control sequence r(U20)dT (37) were conducted using the 2′-O-[2-(methylsulfinyl)ethanimine-N-oxymethyl]uridinephosphoramidite 30 and commercial 2′-O-(tert-butyldimethylsilyl)uridinephosphoramidite monomers, respectively, as 0.2 M solutions in dry MeCN, under conditions identical to those employed in the syntheses of 31–33 with the exception of the coupling reaction time for phosphoramidite 30, which was set to 3 min.
Deprotection and characterization of the chimeric RNA sequences
The solid-phase-linked 5′-dedimethoxytritylated RNA oligonucleotide (31, 32 or 33) was placed into a 4 ml screw-capped glass vial to which was added concentrated aqueous NH3 (1 ml). The suspension was shaken occasionally over a period of 30 min at ~25°C. The ammoniacal solution was then transferred to another 4 ml glass screw-capped and was left standing at ~25°C for 16 h. A sample of the ammoniacal solution (5 OD260) was evaporated to dryness using a stream of air. The oligonucleotide was then dissolved in DMSO (50 µl) and Et3N•3HF (65 µl) was added to the solution, which was heated to for 2.5 h at 65 °C. The solution was then concentrated under a stream of air, diluted in 0.1 M triethylammonium acetate pH 7.0 and purified by RP-HPLC using a 5 μm Supelcosil LC-18S column (25 cm × 4.6 mm) under the following conditions: starting from 0.1 M triethylammonium acetate pH 7.0, a linear gradient of 1% MeCN/min was pumped at a flow rate of 1 ml/min for 40 min and was then held, isocratically, for 20 min. Fractions containing the pyrenylated (31 or 32) or unmodified oligonucleotide (33) were pooled together, concentrated to a volume of ~250 µl and loaded onto a PD-10 (Sephadex G-25M) column. The oligonucleotide was eluted from the column using DEPC-treated H2O as the eluent. Fractions of 1 ml were collected and those containing the RNA oligomer (A260) were pooled together for analysis by RP-HPLC and characterization by mass spectrometry. –MALDI-TOF MS (31): Calcd for C217H239N75O147P20 [M − H]+ 6868, found 6868. –MALDI-TOF MS (32): Calcd for C235H250N76O148P20 [M − H]+ 7125, found 7126. –MALDI-TOF MS (33): Calcd for C199H228N74O146P20 [M − H]+ 6611, found 6611. Samples (1 OD260) of the purified and desalted oligoribonucleotides 31 and 32 were evaporated to dryness using a stream of air and were treated with 0.5 M TBAF in DMSO (0.1 ml) for 2 h at 55°C. Each solution was diluted using 0.1 M triethylammonium acetate pH 7.0 (1 ml) and desalted as described above through a PD-10 column prior to RP-HPLC analysis and characterization by mass spectrometry. –MALDI-TOF MS (31→33): Calcd for C199H228N74O146P20 [M − H]+ 6611, found 6613. –MALDI-TOF MS (32→33): Calcd for C199H228N74O146P20 [M − H]+ 6611, found 6611.Structures of compounds 20, 21 and 22.RP-HPLC analysis of purified and desalted 5′-r(U*AUCCGUAGCUAACGUCAUG)dT (31) [U* and dT represent 2′-O-(pyren-1-ylmethanimine-N-oxymethyl)uridine and 2′-deoxythymidine residues, respectively] and its conversion to 5′-r(UAUCCGUAGCUAACGUCAUG)dT (33). (A) Chromatogram of 31 that was prepared from the 2′-O-pyrenylated ribonucleoside phosphoramidite 8a and commercial 2′-O-(tert-butyldimethylsilyl) APac, GPac, CAc and U phosphoramidite monomers, deprotected, RP-HPLC purified and desalted as delineated in the ‘Materials and Methods’ section. (B) Chromatogram of 33 that was prepared from commercial 2′-O-(tert-butyldimethylsilyl) APac, GPac, CAc and U phosphoramidite monomers, and processed as described in (A). (C) Chromatogram of RP-HPLC purified and desalted 31 that was treated with 0.5 M TBAF in DMSO for 2 h at 55°C and then desalted. RP-HPLC analysis was performed using UV detection (254 nm) and a 5 μm Supelcosil LC-18S column (25 cm × 4.6 mm) according to the following conditions: starting from 0.1 M triethylammonium acetate pH 7.0, a linear gradient of 1% MeCN/min was pumped at a flow rate of 1 ml/min for 40 min and was then held, isocratically, for 20 min. Peak heights are normalized to the highest peak, which is set to 1 AU.
Deprotection and characterization of DNA sequences
The solid-phase-linked 5′-dedimethoxytritylated 5′-pyrenylated oligodeoxyribonucleotide 34 or DNA oligonucleotide 35 was placed into a 4 ml screw-capped glass vial to which was added concentrated aqueous NH3 (1 ml). The suspension was shaken occasionally over a period of 30 min at ~25°C. The ammoniacal solution was then transferred to another 4 ml glass screw-capped and was left standing at ~25°C for 16 h. A sample of the ammoniacal solution (1 OD260) was evaporated to dryness using a stream of air, redissolved in 0.1 M triethylammonium acetate pH 7.0 and purified by RP-HPLC under conditions identical to those used for the purification of 31–33. The purified DNA sequences were desalted under conditions identical to those used for the RNA sequences and were analyzed by RP-HPLC (Supplementary Figure S7) and characterized by mass spectrometry. –MALDI-TOF MS (34): Calcd for C223H251N75O127P20 [M − H]+ 6632, found 6633. –MALDI-TOF MS (35): Calcd for C205H240N74O126P20 [M − H]+ 6375, found 6372. A sample (1 OD260) of the purified and desalted oligodeoxyribonucleotide 34 was evaporated to dryness using a stream of air and was treated with 0.5 M TBAF in DMSO (0.1 ml) for 1 h at 55°C. After diluting the solution with 0.1 M triethylammonium acetate pH 7.0 (1 ml), the solution was desalted as described above through a PD-10 column prior to RP-HPLC analysis (Supplementary Figure S7) and characterization by mass spectrometry. –MALDI-TOF MS (34→35): Calcd for C205H240N74O126P20 [M − H]+ 6375, found 6378.
Deprotection of r(U+20)dT (36) and characterization of its conversion to r(U20)dT (37)
The solid-phase-linked 5′-dedimethoxytritylated RNA oligonucleotide 36 or 37 was placed into a 4 ml screw-capped glass vial to which was added concentrated aqueous NH3 (1 ml). The suspension was shaken occasionally over a period of 30 min at ~25°C. The ammoniacal solution was then transferred to another 4 ml glass screw-capped and was evaporated to dryness using a stream of air. The oligonucleotide was then dissolved with 0.5 M TBAF in DMSO (0.1 ml) and was heated for 16 h at 55°C. After diluting the solution with 0.1 M triethylammonium acetate pH 7.0 (1 ml), the solution was desalted, as described above, through a PD-10 column prior to RP-HPLC analysis (Figure 6) and characterization by mass spectrometry. –MALDI-TOF MS (36→37): Calcd for C190H214N42O165P20 [M − H]+ 6344, found 6349. –MALDI-TOF MS (37): Calcd for C190H214N42O165P20 [M − H]+ 6344, found 6350.
Figure 6.
RP-HPLC analysis of the conversion of unpurified and desalted 5′-r(U+20)dT) [U+ represents 2′-O-[2-(methylsulfinyl)ethanimine-N-oxymethyl]uridine] (36) to 5′-r(U20)dT (37). (A) Chromatogram of r(U20)dT 37 that was prepared from commercial 2′-O-(tert-butyldimethylsilyl)uridine phosphoramidite, deprotected, and desalted as delineated in the ‘Materials and Methods’ section. (B) Chromatogram of 36 that was prepared from the ribonucleoside phosphoramidite monomer 30 and processed as described in (A). RP-HPLC analysis was performed as described in the caption of Figure 4.
RP-HPLC analysis of purified and desalted 5′-r(U*AUCCGUAGCU*AACGUCAUG)dT (32) [U* and dT represent 2′-O-(pyren-1-ylmethanimine-N-oxymethyl)uridine and 2′-deoxythymidine residues, respectively] and its conversion to 5′-r(UAUCCGUAGCUAACGUCAUG)dT (33). (A) Chromatogram of 32 that was prepared from the 2′-O-pyrenylated ribonucleoside phosphoramidite 8a and commercial 2′-O-(tert-butyldimethylsilyl) APac, GPac, CAc and U phosphoramidite monomers, deprotected, RP-HPLC purified and desalted as delineated in the ‘Materials and Methods’ section. (B) Chromatogram of 33 that was prepared from commercial 2′-O-(tert-butyldimethylsilyl) APac, GPac, CAc and U phosphoramidite monomers, and processed as described in (A). (C) Chromatogram of RP-HPLC purified and desalted 32 that was treated with 0.5 M TBAF in DMSO for 2 h at 55°C and then desalted. RP-HPLC analysis was performed as described in the caption of Figure 4.
Figure 4.
RP-HPLC analysis of purified and desalted 5′-r(U*AUCCGUAGCUAACGUCAUG)dT (31) [U* and dT represent 2′-O-(pyren-1-ylmethanimine-N-oxymethyl)uridine and 2′-deoxythymidine residues, respectively] and its conversion to 5′-r(UAUCCGUAGCUAACGUCAUG)dT (33). (A) Chromatogram of 31 that was prepared from the 2′-O-pyrenylated ribonucleoside phosphoramidite 8a and commercial 2′-O-(tert-butyldimethylsilyl) APac, GPac, CAc and U phosphoramidite monomers, deprotected, RP-HPLC purified and desalted as delineated in the ‘Materials and Methods’ section. (B) Chromatogram of 33 that was prepared from commercial 2′-O-(tert-butyldimethylsilyl) APac, GPac, CAc and U phosphoramidite monomers, and processed as described in (A). (C) Chromatogram of RP-HPLC purified and desalted 31 that was treated with 0.5 M TBAF in DMSO for 2 h at 55°C and then desalted. RP-HPLC analysis was performed using UV detection (254 nm) and a 5 μm Supelcosil LC-18S column (25 cm × 4.6 mm) according to the following conditions: starting from 0.1 M triethylammonium acetate pH 7.0, a linear gradient of 1% MeCN/min was pumped at a flow rate of 1 ml/min for 40 min and was then held, isocratically, for 20 min. Peak heights are normalized to the highest peak, which is set to 1 AU.
RESULTS AND DISCUSSION
Synthesis and oximation of 2′-O-aminooxymethyl ribonucleosides
The preparation of the pyrenylated ribonucleosides6a–d from commercially available ribonucleosides (1a–d) is outlined in Scheme 1. The reaction of 1a–d with DMSO, acetic anhydride and acetic acid produced the ribonucleoside 2′-thioacetals 2a–d in yields of 85–94%; these acetals were efficiently converted to their chloromethyl ether derivatives (3a–d) by treatment with sulfuryl chloride (26,27) in CH2Cl2 and were isolated, without purification, as amorphous materials. The addition of a pre-mixed solution of N-hydroxyphthalimide and a limiting amount of DBU (~0.9 molar equiv) in CH2Cl2 to 3a-d gave the 2’-O-phthalimidooxymethyl ribonucleosides 4a–d in yields of 66–94% relative to the molar amounts of 2a–d that were used as starting materials. Desilylation and, unexpectedly, dephthalimidation of 4a–d occurred when treated with a suspension of NH4F in MeOH (23), thereby affording the novel 2′-O-aminooxymethyl ribonucleosides5a–d after N-deacylation of the nucleobases upon exposure to concentrated aqueous NH3. For characterization purposes, analytical samples of 5a–d were purified by silica gel chromatography and were analyzed by 1H and 13CNMR spectroscopies and high resolution mass spectrometry (HRMS). Otherwise, unpurified 5a–d was reacted with 1-pyrenecarboxaldehyde in MeOH and afforded the pyrenylated ribonucleosideconjugates6a–d in post-purification yields of 69–82%; the identities of 6a–d were confirmed by HRMS analysis. It should be noted that partial deacylation of the nucleobases occurred during the desilylation and dephthalimidation of 4b–d. However, if required, N-acylation of the nucleobases can be easily achieved by transient protection of the hydroxyl functions of 6b–d by treatment with chlorotrimethylsilane in dry pyridine followed by reaction with the desired acylating reagent as described by Ti et al. (28). It is also worth noting that when the desilylation of 4a was effected by treatment with 0.5 M TBAF in THF, uridine was the only nucleosidic product detected by RP-HPLC analysis of the deprotection reaction. Similarly, when 4a was successively treated with hydrazine hydrate to release the aminooxymethyl function and with NH4F in methanol to desilylate the 5′-and 3′-hydroxy groups, RP-HPLC analysis of the reaction revealed only uridine as the nucleosidic product. Further investigations are necessary to fully assess the mechanistic implications of these findings, which convincingly underscore the uniqueness of the concomitant desilylation and dephtalimidation of 4a–d by NH4F in MeOH.With the intent of further substantiating the versatility of 4a–d in the preparation of ribonucleoside 2′-conjugates, the ribonucleoside 4a was converted to 2′-O-aminooxymethyl uridine (5a), as described above, by treatment with NH4F/MeOH, and was reacted with either cholesten-3-one (9) or with aldehydes derived from N-(2,2-dimethoxyethyl)biotinamide (11), N-(2,2-dimethoxyethyl)-5-(dimethylamino)-naphthalene-1-sulfonamide (13) and N-(4,4-diethoxybutyl)-5-(dimethylamino)naphthalene-1-sulfonamide (15) to give the uridine 2′-conjugates 10, 12, 14 and 16, respectively (Figure 1). The reaction of 2′-O-aminooxymethyl cytidine (5b) with the aldehyde derived from N-(2,2-dimethoxyethyl)-4-(dimethylamino)-azobenzene-4′-sulfonamide (17) afforded the cytidine 2′-conjugate 18 (Figure 1). The acetals 11, 13, 15 and 17 were conveniently prepared from the reaction of aminoacetaldehyde dimethyl acetal or 4-aminobutyraldehydediethyl acetal with D-(+)-biotin 2-nitrophenyl ester, dansyl chloride and dabsyl chloride in the presence of triethylamine. These acetals were isolated in yields of 91–95%. The equilibrium between acetals 11, 13, 15 and their corresponding aldehydes upon exposure to concentrated HCl in MeOH led to efficient conjugation with 5a to provide the conjugates 12, 14 and 16 in isolated yields of 66–81%. The acetal 17 did not significantly convert to the aldehyde under acidic conditions presumably because protonation of the acetal's azo function might have considerably decreased its solubility in MeOH. This shortcoming was avoided by the reaction of 17 with a solution of 10% iodine in acetone as described in the literature (24); under these conditions, the crude N-(2-oxoethyl)-4-(dimethylamino)azobenzene-4′-sulfonamide was obtained and, without further purification, was reacted with the 2′-O-aminooxymethyl ribonucleoside 5b. The cytidine 2′-conjugate 18 was obtained in a yield exceeding 60%.
Reversibility of ribonucleoside 2′-conjugates to their ribonucleoside precursors
Ribonucleoside 2′-conjugates6a–d, 12, 14, 16 and 18 are stable conjugates, which can be conveniently and efficiently converted to their native ribonucleoside precursors upon treatment with 0.5 M TBAF in THF. A proposed mechanism for these transformations is shown in Scheme 2 and is supported by representative RP-HPLC profiles illustrating the conversion of 6a, 12 and 14 to uridine (Figure 2, Supplementary Figures S2 and S3, respectively). The RP-HPLC chromatograms demonstrate the formation of pyrene-1-carbonitrile (19) and N-(4-cyanobut-1-yl)-5-(dimethylamino)naphthalene-1-sulfonamide (20, Figure 3) as side products from the fluoride-assisted cleavage of the 2′-iminooxymethyl ether function from 6a and 16, respectively (Figure 2 and Supplementary Figure S4). The identities of 19 and 20 were confirmed by their RP-HPLC retention times (tR = 61.5 and 48.2 min, respectively), which were found identical to those of authentic commercial (19) or chemically synthesized (20) samples (see Figures 2 and 3, respectively). Although it had been reported that the oxime phosphate ester 21 (Figure 3) underwent base-catalyzed decomposition to produce diphenyl phosphate and 4-nitrobenzonitrile (29), the fluoride-mediated cleavage of ribonucleoside 2′-O-aryl or -alkyliminooxymethyl ethers has not, to the best of our knowledge, been reported in the literature.
Figure 3.
Structures of compounds 20, 21 and 22.
RP-HPLC analysis of the conversion of unpurified and desalted 5′-r(U+20)dT) [U+ represents 2′-O-[2-(methylsulfinyl)ethanimine-N-oxymethyl]uridine] (36) to 5′-r(U20)dT (37). (A) Chromatogram of r(U20)dT 37 that was prepared from commercial 2′-O-(tert-butyldimethylsilyl)uridinephosphoramidite, deprotected, and desalted as delineated in the ‘Materials and Methods’ section. (B) Chromatogram of 36 that was prepared from the ribonucleoside phosphoramidite monomer 30 and processed as described in (A). RP-HPLC analysis was performed as described in the caption of Figure 4.It should be noted that the synthesis of 2′-O-phthalimidooxyethyl ribonucleosides had been reported earlier by Kawasaki et al. (30) with the purpose of preparing 2′-O-aminooxyethyl-modified antisense oligonucleotides for potential therapeutic applications. Although 2′-O-aminooxyethyl ribonucleosides can be amenable to conjugation with various functional groups, these permanent conjugates cannot be easily converted back to unmodified ribonucleosides.In this regard, the reaction of the 2′-O-aminooxymethyl ribonucleoside5a with cholesten-3-one (9) and dansyl chloride also gave, as expected, the permanent uridine 2′-conjugates 10 (Figure 1) and 22 (Figure 3), respectively. These conjugates were both found stable to TBAF/THF under the conditions used for the conversion of 6a-d, 12, 14, 16 and 18 to their corresponding ribonucleosides. Indeed, treatment of 22 with 0.5 M TBAF in THF for 72 h at 55°C produced uridine to the extent of <1%, as determined by RP-HPLC analysis of the reaction products (data shown in Supplementary Figure S6).The conjugates6a–d, 12, 14, 16 and 18 exist as a mixture of E- and Z-geometrical isomers; one of these isomers appears to undergo fluoride-assisted cleavage of the 2′-iminooxymethyl ether function at a faster rate than the other geometrical isomer, as judged by RP-HPLC analysis of the cleavage reactions. Our findings are consistent with those reported earlier by others (31) indicating that both syn- and anti-piperonaldoxime acetates produced a nitrile via β-elimination under basic conditions; the trans-β-elimination from the anti-acetate proceeding faster than the cis-β-elimination. It is also worth noting that the proximity of an electron-donating group to the 2′-iminooxymethyl ether function clearly affects the rates of the fluoride-assisted cleavage reaction. As shown in Figure 2, the fluoride-mediated conversion of 6a to uridine was complete within 4 h at 55°C while the conversion of 12 to uridine took 6 h under identical conditions (Supplementary Figure S2). One might argue that in the presence of fluoride ion, which is a strong base in aprotic solvent, the amide function of 12 (pKa ~25) may become negatively charged to some extent and decrease the acidity of the nearby oximic proton as a consequence of the electron-donating properties of the partially ionizedamide function. The reduced acidity of the oximic proton would then result in a slower fluoride-mediated β-elimination reaction. This argument is further supported by the considerably slower fluoride-assisted conversion of 14 to uridine, which was only 15% complete after 24 h at 55°C (Supplementary Figure S3). The relatively acidic sulfonamide function of 14 (pKa ~10) is presumably ionized to a larger extent than that of an amide function by the strongly basic fluoride ion, thereby decreasing further the acidity of the oximic proton, which led to slower β-elimination rates relative to those of 6a–d and 12 under identical conditions. Also consistent with this argument is that when the sulfonamide function is increasingly distal to the oximic proton, the electron-donating properties of the ionizedsulfonamide have a lesser effect on the acidity of the oximic proton and result in relatively faster β-elimination rates. Typically, the fluoride-assisted conversion of 16 to uridine was complete within 48 h at 55°C (Supplementary Figure S4); this β-elimination rate is comparatively faster than that of 14 but still significantly slower than those of 6a–d and 12. Given the structural similarity of 18 and 14 in terms of proximity of the sulfonamide function to the oximic proton, the conversion of 18 to cytidine by treatment with 0.5 M TBAF in THF was comparable to that of 14 to uridine, as it was only 25% complete after 24 h at 55°C (Supplementary Figure S5).
Single or double incorporation of a reversible ribonucleoside 2’-conjugate into chimeric RNA sequences: synthesis, deprotection and characterization
With the objective of demonstrating the ability of 2′-O-aminooxymethyl ribonucleosideconjugates to modify RNA sequences, the pyrenylated ribonucleoside conjugate 6a was reacted with 4,4′-dimethoxytrityl chloride in pyridine to provide 7a, which after purification, was reacted with 2-cyanoethyl N,N-diisopropylchlorophosphoramidite and triethylamine to give the pyrenylated ribonucleoside phosphoramidite 8a (Scheme 1). The RNA sequences 5′-r(U*AUCCGUAGCUAACGUCAUG)dT (31), 5′-r(U*AUCCGUAGCU*AACGUCAUG)dT (32) [U* and dT correspond to 2′-O-(pyren-1-ylmethanimine-N-oxymethyl)uridine and 2’-deoxythymidine residues, respectively] and 5’-r(UAUCCGUAGCUAACGUCAUG)dT (33) were prepared using solid-phase techniques (32) to show that the single or double incorporation of pyrenylated ribonucleoside phosphoramidite 8a into RNA sequences constructed from commercial 2′-O-(tert-butyldimethylsilyl)ribonucleoside phosphoramidites (Supplementary ‘Materials and Methods’ section) proceeded without compromising the overall yields of the RNA sequences on the basis of the stepwise colorimetric determination of the dimethoxytrityl cation concentration after the first and last coupling steps of each oligonucleotide assembly. Treatment of the solid-phase-linked oligonucleotides with concentrated aqueous NH3 at ambient temperature (~25°C) resulted in the cleavage of all nucleobase and phosphate protecting groups with the release of the 2′-O-protected oligonucleotides from the CPG support. Exposure of 2′-O-protected oligonucleotides to Et3N•3HF (33,34) in DMSO at 65°C resulted in the exclusive cleavage of the 2′-O-TBDMS protecting groups. Although the 2′-O-pyrenylated ribonucleosideconjugates6a–d are cleaved by TBAF, these conjugates are totally stable to Et3N•3HF under the conditions used for complete cleavage of the 2′-O-TBDMS groups. The RP-HPLC retention times of the purified oligonucleotides 31, 32 and 33 (tR = 29.0, 31.0 and 17.6 min, respectively) were compared and found consistent with the composition of each oligonucleotide under identical chromatographic conditions (Figures 4 and 5). MALDI-TOF analyses of 31, 32 and 33 corroborated their expected molecular weights. The reversibility of the 2′-O-pyrenylated oligonucleotides 31 and 32 to 33 was demonstrated by the reaction of 31 and 32 with 0.5 M TBAF in DMSO at 55°C. Under these conditions, 31 and 32 were completely converted to 33, as shown by RP-HPLC (Figures 4 and 5) and mass spectrometry analyses of the fully deprotected oligonucleotides.
Figure 5.
RP-HPLC analysis of purified and desalted 5′-r(U*AUCCGUAGCU*AACGUCAUG)dT (32) [U* and dT represent 2′-O-(pyren-1-ylmethanimine-N-oxymethyl)uridine and 2′-deoxythymidine residues, respectively] and its conversion to 5′-r(UAUCCGUAGCUAACGUCAUG)dT (33). (A) Chromatogram of 32 that was prepared from the 2′-O-pyrenylated ribonucleoside phosphoramidite 8a and commercial 2′-O-(tert-butyldimethylsilyl) APac, GPac, CAc and U phosphoramidite monomers, deprotected, RP-HPLC purified and desalted as delineated in the ‘Materials and Methods’ section. (B) Chromatogram of 33 that was prepared from commercial 2′-O-(tert-butyldimethylsilyl) APac, GPac, CAc and U phosphoramidite monomers, and processed as described in (A). (C) Chromatogram of RP-HPLC purified and desalted 32 that was treated with 0.5 M TBAF in DMSO for 2 h at 55°C and then desalted. RP-HPLC analysis was performed as described in the caption of Figure 4.
Functionalization of the 5′-terminus of a DNA sequence with a reversible conjugate: synthesis, deprotection and characterization
It was also our intent to show that 5′-O-aminooxymethyl deoxyribonucleosides are similar to 2′-O-aminooxymethyl ribonucleosides in their abilities to produce conjugates for the functionalization of DNA sequences at their 5′-termini; 5′-O-aminooxymethyl thymidine (25) served as an appropriate model for this purpose. The synthesis of 25 (Scheme 3) began with the thioacetalization of commercial 3′-O-levulinyl thymidine under conditions similar to those used for the 2′-O-thioacetalization of 1a–d. The 5′-O-thioacetal 23 was then treated with sulfuryl chloride to yield the 5′-chloromethylated deoxyribonucleoside intermediate, which was reacted with N-hydroxyphthalimide in the presence of DBU to provide 24. Hydrazinolysis of 24 resulted in the cleavage of the phthalimido and levulinyl groups affording 5′-O-aminooxylmethyl thymidine (25). Oximation of 25 with pyrenecarboxaldehyde in MeOH at 55°C led to the 5′-pyrenylated thymidine derivative 26, which was purified and phosphitylated using 2-cyanoethyl N,N-diisopropylchlorophosphoramidite and triethylamine under anhydrous conditions to give the 5′-pyrenylated thymidine phosphoramidite 27. The DNA sequences 5′-d(T*ATCCGTAGCTAACGTCATGT) (34) [T* corresponds to 5′-O-(pyren-1-ylmethanimine-N-oxymethyl)-2′-deoxythymidine] and 5′-d(TATCCGTAGCTAACGTCATGT) (35) were synthesized, using the phosphoramidite 27 and commercial dAPac, dGPac, dCAc and dTphosphoramidite monomers under the conditions described in the experimental section. Post-synthesis oligonucleotide deprotection was carried out by treatment with concentrated aqueous NH3 at ~25°C. The coupling efficiency of 27 was found comparable to that of commercial deoxyribonucleoside phosphoramidites given the similar recovery of both 34 and 35, as judged by UV spectroscopy at 260 nm. The 5′-pyrenylated DNA sequence 34 exhibited, as expected, a retention time (tR = 33.4 min) considerably larger than that of the control DNA sequence 35 (tR = 18.2 min) as a consequence of the notorious hydrophobicity of the pyrenyl function. (Supplementary Figure S7). The identity of both 34 and 35 was confirmed by mass spectrometry. The reversibility of the 5′-pyrenylated DNA sequence 34 was also verified by its reaction with 0.5 M TBAF in DMSO at 55°C. Under these conditions 34 was completely converted to 35 on the basis of RP-HPLC (Supplementary Figure S7) and mass spectrometry analyses.
Reversible ribonucleoside 2′-conjugate in the synthesis of native RNA sequences: synthesis and characterization of the chimeric polyuridylic acid model r(U20)dT
Given the pressing need for RNA sequences in RNA interference research (21), the versatility of reversible 2′-O-aminooxymethyl ribonucleosideconjugates in the design of novel 2′-hydroxyl protecting groups for the synthesis of native or modified RNA sequences is clearly an asset. The reaction of aldehydes or aldehydes derived from acetals with 2′-O-aminooxymethyl ribonucleosides was performed with the purpose of assessing the stability of the resulting 2′-conjugates to the conditions prevailing during the synthesis and deprotection of RNA sequences, and evaluating the reversibility kinetics of these conjugates when exposed to TBAF in DMSO. In preliminary experiments, the 2′-O-aminooxymethyl ribonucleoside intermediate 5a was reacted with either acetaldehyde or methythioacetaldehyde, the latter of which was produced in situ from its commercial dimethyl acetal under acidic conditions, to generate the expected oximeconjugates (Scheme 4). Both ribonucleoside 2′-conjugates were found stable to the reagents and conditions used for routine solid-phase RNA synthesis and to the mild basic conditions that are required for N-deacylation of the nucleobases, cleavage of the 2-cyanoethyl phosphate protecting groups and release of the 2′-O-protected RNA sequence from the CPG support. The conversion of 2′-O-[2-(methylthio)ethanimine-N-oxymethyl]uridine (28) to uridine upon exposure to 0.5 M TBAF in DMSO was complete within 30 min at 55°C and was the fastest of the two 2′-O-aminooxymethyl ribonucleosideconjugates investigated. In order to further improve the fluoride-assisted conversion of 28 to uridine, we rationalized that by increasing the acidity of the oximic proton, the reversibility of 28 to uridine should be enhanced. Indeed, reaction of the sulfoxide derivative of 28 with 0.5 M TBAF in DMSO led to its complete transformation to uridine within 5 min at 25°C. These encouraging results prompted us to prepare the ribonucleoside phosphoramidite 30, which was obtained from the 5′-dimethoxytritylation of the sulfoxide derivative of 28 to 29 and its subsequent 3′-phosphitylation by 2-cyanoethyl N,N-diisopropylchlorophosphoramidite under the conditions described in the caption of Scheme 4. The ribonucleoside phosphoramidite 30 was successfully used in the solid-phase synthesis of r(U+20)dT bearing the 2-(methylsulfinyl)ethanimine-N-oxymethyl group for 2′-hydroxyl protection. The iterative coupling efficiency of 30 exceeded 99% and the yield of r(U+20)dT was 80 ± 5% as determined by the colorimetric trityl assay. Upon phosphate deprotection and release of r(U+20)dT from the CPG support effected by aqueous NH3, the fluoride-mediated cleavage of the 2′-O-[2-(methylsulfinyl)ethanimine-N-oxymethyl] groups was subsequently performed under anhydrous conditions by treatment with 0.5 M TBAF in DMSO over a period of 16 h at 55°C. Unpurified r(U20)dT (37) was desalted, analyzed by RP-HPLC and successfully characterized by MALDI-TOF mass spectrometry. The RP-HPLC profile of the chimeric polyuridylic acid was compared with the profile of r(U20)dT that was prepared from commercial 2′-O-(tert-butyldimethylsilyl)uridinephosphoramidite monomers and deprotected under standard conditions (32). Figure 6 shows the high similarity of these chromatographic profiles and strongly suggests that reversible 2′-O-aminooxymethyl ribonucleosideconjugates may lead to the development of novel 2′-hydroxyl protecting groups for the optimal preparation of native or modified RNA sequences.
CONCLUSIONS
The synthesis of novel 2′-O-aminooxymethyl ribonucleosides (5a–d) provides facile access to reversible or permanent ribonucleoside 2′-conjugates through an efficient and chemoselective oximation reaction with aldehydes or ketones. The synthetic process, whereby 2′-O-phthalimidooxymethyl ribonucleoside derivatives (4a–d) have generally been prepared from commercial ribonucleoside precursors (1a–d) in relatively high yields is remarkable in terms of simplicity; a unique feature of this process is the one-step removal of the silyl and phthalimido groups from 4a–d by treatment with methanolic ammonium fluoride. The reaction of 5a–d with 1-pyrenecarboxaldehyde or 5a with aldehydes, generated from acetals (11, 13 and 15) under acidic conditions, gave stable but reversible ribonucleoside 2′-conjugates, whereas the reaction of 5a with the cholestenone 9 or dansyl chloride afforded permanent ribonucleosideconjugates. The conjugation of cholesterol derivatives to antisense oligonucleotides has been reported to enhance the cellular uptake and antisense efficacy of these biomolecules in cell-based systems (35). In this context, it has become apparent that 2′-O-aminooxymethyl ribonucleosides (5a–d) are capable of forming conjugates with a variety of functional groups. Conversion of these ribonucleosideconjugates, after 5′-O- and nucleobase protection, to 3′-phosphoramidite derivatives should permit their incorporation into oligonucleotides. These oligonucleotideconjugates may particularly be useful in the development of innovative approaches to improving the cellular uptake of nucleic acid-based drugs through specific pathways. Cellular uptake and localization of therapeutic oligonucleotides are still the most challenging problems to overcome in order to better control gene expression. In addition, one of the important findings of this work is the facile reversibility of ribonucleoside 2′-conjugates to native ribonucleosides upon treatment with 0.5 M TBAF in DMSO. As discussed above, TBAF induced the β-elimination of 2′-iminooxymethyl ether functions through the formation of innocuous nitriles and thus provides new opportunities for the discovery and implementation of novel 2′-hydroxy protecting groups, which are of crucial importance in the synthesis of native and/or modified RNA sequences for RNA interference applications (21). Furthermore, the reversibility of DNA/RNA oligonucleotides conjugated to specific ligands is particularly useful in the affinity purification of synthetic DNA/RNA from which intact DNA/RNA oligonucleotides can be recovered from the ligand-affinity binding system (36). This approach may find application in the large-scale synthesis and purification of therapeutic DNA/RNA sequences. The reversibility of DNA/RNA oligonucleotides conjugated to affinity ligands may have a much broader appeal when the reversible DNA/RNA conjugate serves as an aptamer for capturing proteins from cell lysates. This strategy may permit the identification and characterization of biomedically relevant DNA/RNA protein complex(es) upon release from the ligand-affinity binding system.
SUPPLEMENTARY DATA
Supplementary Data are available at NAR Online: Supplementary Materials and Methods, and Supplementary Figures S1–S7.
FUNDING
Funding for open access charge: Intramural research funding.Conflict of interest statement. None declared.
Authors: D Gasparutto; T Livache; H Bazin; A M Duplaa; A Guy; A Khorlin; D Molko; A Roget; R Téoule Journal: Nucleic Acids Res Date: 1992-10-11 Impact factor: 16.971
Authors: Olga A Krasheninina; Veniamin S Fishman; Alexander A Lomzov; Alexey V Ustinov; Alya G Venyaminova Journal: Int J Mol Sci Date: 2020-07-20 Impact factor: 5.923