Literature DB >> 22025804

Zymoseptoria gen. nov.: a new genus to accommodate Septoria-like species occurring on graminicolous hosts.

W Quaedvlieg1, G H J Kema, J Z Groenewald, G J M Verkley, S Seifbarghi, M Razavi, A Mirzadi Gohari, R Mehrabi, P W Crous.   

Abstract

The Mycosphaerella complex is both poly- and paraphyletic, containing several different families and genera. The genus Mycosphaerella is restricted to species with Ramularia anamorphs, while Septoria is restricted to taxa that cluster with the type species of Septoria, S. cytisi, being closely related to Cercospora in the Mycosphaerellaceae. Species that occur on graminicolous hosts represent an as yet undescribed genus, for which the name Zymoseptoria is proposed. Based on the 28S nrDNA phylogeny derived in this study, Zymoseptoria is shown to cluster apart from Septoria. Morphologically species of Zymoseptoria can also be distinguished by their yeast-like growth in culture, and the formation of different conidial types that are absent in Septoria s.str. Other than the well-known pathogens such as Z. tritici, the causal agent of septoria tritici blotch on wheat, and Z. passerinii, the causal agent of septoria speckled leaf blotch of barley, both for which epitypes are designated, two leaf blotch pathogens are also described on graminicolous hosts from Iran. Zymoseptoria brevis sp. nov. is described from Phalaris minor, and Z. halophila comb. nov. from leaves of Hordeum glaucum. Further collections are now required to elucidate the relative importance, host range and distribution of these species.

Entities:  

Keywords:  Hordeum vulgare; ITS; LSU; Mycosphaerella; Septoria; Triticum aestivum; multilocus sequence typing; systematics

Year:  2011        PMID: 22025804      PMCID: PMC3160802          DOI: 10.3767/003158511X571841

Source DB:  PubMed          Journal:  Persoonia        ISSN: 0031-5850            Impact factor:   11.051


INTRODUCTION

More than 10 000 names have been described in the genus Mycosphaerella (Capnodiales, Dothideomycetes) and its associated anamorph genera (Cercospora, Pseudocercospora, Septoria, Ramularia, etc.) (Crous et al. 2009a), making it one of the largest genera of plant pathogenic Ascomycetes known to date (Crous 2009). However, in contrast to earlier phylogenetic studies based on the ITS region (Stewart et al. 1999, Crous et al. 1999, 2000, 2001, Goodwin et al. 2001), more robust multi-gene phylogenies have revealed Mycosphaerella to be polyphyletic (Crous et al. 2007, 2009b, Schoch et al. 2009a, b), suggesting that Mycosphaerella s.l. should be subdivided to reflect natural groups (genera) as defined by their anamorphs. The genus Mycosphaerella is typified by M. punctiformis, which has a Ramularia anamorph, R. endophylla (Verkley et al. 2004a). Ever since it was established, the name Mycosphaerella has been used to describe related and unrelated, small loculoascomycetes (in some cases even asexual coelomycetes) (Aptroot 2006), prompting Crous et al. (2009b), to suggest that the older generic name Ramularia (1833), rather than the confused name Mycosphaerella (1884) should be used for this well-defined morphologic (Braun 1998) and phylogenetic clade of fungi (Crous et al. 2009b, Kirschner 2009). The genus Septoria Sacc. (1884) currently contains almost 3 000 species (Verkley & Priest 2000, Verkley et al. 2004b), several of which have Mycosphaerella-like teleomorphs. The type species is Septoria cytisi (Fig. 1), a pathogen of Cytisus laburnum (= Laburnum anagyroides). Septoria represents a polyphyletic assembly of anamorph genera that cluster mostly in the Mycosphaerellaceae (a family incorporating many plant pathogenic coelomycetes), although Septoria-like anamorphs have also evolved outside this family (Crous et al. 2009b). In this regard some Septoria species on graminicolous hosts (e.g. S. passerinii and S. tritici) have a distinct dimorphic lifestyle. Besides their mycelial state, they can exhibit a yeast-like growth in culture via microcyclic conidiation, distinguishing them from Septoria s.str. Furthermore, phylogenetically the Septoria-like species occurring on graminicolous hosts have also been found to cluster apart from Septoria species occurring on other hosts (Crous et al. 2001, Verkley et al. 2004b). This clear phylogenetic separation, together with the unique yeast-like growth for S. tritici and S. passerinii, led to the hypothesis that the S. tritici clade did not belong to Septoria s.str., but should be classified as a separate genus. In order to prove this hypothesis, the phylogenetic relationship of the type species of the genus Septoria (S. cytisi) needs to be determined. However these data are not currently available, as other than herbarium material, we have not been able to recollect or locate any living strains of S. cytisi.
Fig. 1

Septoria cytisi (BPI 378994). a. Leaf with leaf spots; b. lesion with pycnidia oozing conidial cirrhi; c. conidiogenous cells showing sympodial and percurrent proliferation; d. conidia. — Scale bars = 10 μm.

The aims of this study were thus to isolate and sequence part of the nuclear ribosomal DNA operon from S. cytisi herbarium material, and to test the hypothesis whether the S. tritici clade can represent a new genus of fungi. A further aim was to resolve the identity of Septoria-like species occurring on graminicolous hosts. To this end partial gene sequences of five loci viz. actin (ACT), calmodulin (CAL), β-tubulin (TUB), RNA polymerase II second largest subunit (RPB2) and 28S nuclear ribosomal RNA gene (LSU) were generated and analysed.

MATERIALS AND METHODS

Isolates

Symptomatic leaves were collected from several localities (Table 1), and leaves with visible asexual fruiting bodies were immediately subjected to direct fungal isolation, or alternatively were first incubated in moist chambers to stimulate sporulation. Single-conidial isolates were established on malt extract agar (MEA; 20 g/L Biolab malt extract, 15 g/L Biolab agar) using the previously described procedure (Crous et al. 2009c). Cultures were later plated on fresh MEA, 2 % tap water agar supplemented with green, sterile barley leaves (WAB), 2 % potato-dextrose agar (PDA), and oatmeal agar (OA) (Crous et al. 2009c), and subsequently incubated at 25 °C under near-ultraviolet light to promote sporulation. Reference strains are maintained in the culture collection of the CBS-KNAW Fungal Biodiversity Centre, Utrecht, the Netherlands, the Plant Research Institute, Wageningen, the Netherlands, and the Iranian Research Institute of Plant Protection, Tehran, Iran (Table 1), and supplemented with other relevant isolates present in the CBS collection. Descriptions, nomenclature, and illustrations were deposited in MycoBank (www.mycobank.org, Crous et al. 2004).
Table 1

Details of cultures subjected to DNA sequencing.

SpeciesIsolate no 1 HostLocationCollected byGenBank Accession no 2
ACTCALITSTUBRPB2LSU
Cercospora apiiCBS 118712–FijiP. Tyler–––––GQ852583
C. ariminensisCBS 137.56Hedysarum coronariumItalyM. Ribaldi–––––JF700933
C. beticolaCBS 124.31Beta vulgarisRomania––––––JF700934
Cladosporium bruhneiCBS 188.54––––––––JF700935
CBS 115683Douglas-fir poleUSA––––––JF700936
Dissoconium australiensisCBS 120729Eucalyptus platyphyllaAustraliaP.W. Crous–––––GQ852588
D. communeCPC 12397Eucalyptus globulusAustraliaI.W. Smith–––––GQ852591
D. dekkeriCPC 13479Eucalyptus camaldulensisThailandW. Himaman–––––GQ852595
Dothistroma piniCBS 116484Pinus nigraUSAG. Adams–––––JF700937
D. septosporumCPC 16799Pinus mugo uncinataThe NetherlandsW. Quaedvlieg–––––JF700938
CPC 3779 (= 112498)Pinus radiataEcuador––––––JF700939
Lecanosticta acicolaCBS 871.95Pinus radiataFranceM. Morelet–––––GU214663
CPC 17940Pinus sp.MexicoM. de Jesus Yanez Morales–––––JF700940
IMI 281598Pinus oocarpaGuatemalaH.C. Evans–––––JF700941
Mycosphaerella ellipsoideaCBS 111167Eucalyptus cladocalyxSouth AfricaA.R. Wood–––––GU214450
M. elongataCBS 120735Eucalyptus camaldulensisVenezuelaM.J. Wingfield–––––JF700942
M. marksiiCBS 110981Eucalyptus sp.TanzaniaM.J. Wingfield–––––JF700943
Mycosphaerella sp.CBS 110843Eucalyptus cladocalyxSouth AfricaP.W. Crous–––––GQ852602
M. vietnamensisCBS 119974Eucalyptus grandisVietnamT.I. Burgess–––––JF700944
Passalora eucalyptiCBS 111318Eucalyptus salignaBrazilP.W. Crous–––––GU214458
Phaeophleospora eugeniaeCPC 15143Eugenia unifloraBrazilA.C. Alfenas–––––FJ493206
P. eugeniicolaCPC 2557Eugenia sp.BrazilA.C. Alfenas–––––JF700945
Pseudocercospora gracilisCPC 11144Eucalyptus sp.IndonesiaM.J. Wingfield–––––JF700946
P. heimiiCPC 11716–BrazilA.C. Alfenas–––––JF700947
P. heimioidesCBS 111190Eucalyptus sp.IndonesiaM.J. Wingfield–––––GU214439
P. irregulariramosaCBS 111211Eucalyptus salignaSouth AfricaM.J. Wingfield–––––GQ852609
P. pseudoeucalyptorumCPC 13769Eucalyptus punctataSouth AfricaP.W. Crous–––––GQ852642
P. robustaCBS 111175Eucalyptus roburMalaysiaM.J. Wingfield–––––JF700948
P. stromatosaCBS 101953Protea sp.South AfricaS. Denman–––––EU167598
Ramularia endophyllaCBS 113265Quercus roburThe NetherlandsG. Verkley–––––DQ470968
R. eucalyptiCBS 120726Corymbia grandifoliaItalyW. Gams–––––JF700949
R. lamiiCPC 11312Leonurus sibiricusKoreaH.D. Shin–––––JF700950
Ramulispora sorghiCBS 110578Sorghum sp.South AfricaD. Nowell–––––JF700951
CBS 110579Sorghum sp.South AfricaD. Nowell–––––GQ852654
Septoria azaleaeCBS 352.49Rhododendron sp.BelgiumJ. van Holder–––––JF700952
S. betulaeCBS 116724Betula pubescensScotlandS. Green–––––JF700953
S. cytisiUSO 378994 (Herbarium specimen)Laburnum anagyroides‘Czechoslovakia’J. A. Baumler––JF700932––JF700954
S. gerberaeCBS 410.61Gerbera jamesoniiItalyW. Gerlach–––––JF700955
S. menthaeCBS 404.34–JapanT. Hemmi–––––JF700956
S. rosaeCBS 355.58Rosa sp.–––––––JF700957
S. rubiCBS 102327Rubus sp.The NetherlandsG. Verkley–––––JF700958
S. verbenaeCBS 113481Septoria sp.New ZealandG. Verkley–––––JF700959
Teratosphaeria fibrillosaCBS 121707Protea sp.South AfricaP.W. Crous & L. Mostert–––––GU323213
T. mollerianaCBS 117926Eucalyptus globulusAustralia––––––JF700960
T. nubilosaCPC 12830Eucalyptus globulusPortugalA. Philips–––––GQ852697
T. pseudocrypticaCPC 11264Eucalyptus sp.New ZealandJ. Stalpers–––––JF700961
T. secundariaCBS 115608Eucalyptus grandisBrazilA.C. Alfenas–––––JF700962
T. suberosaCPC 13090Eucalyptus agglomerataAustraliaA.J. Cargenie–––––JF700963
Verrucisporota daviesiaeCBS 116002Daviesia latifoliaAustraliaV. beilhartz–––––GQ852730
V. proteacearumCBS 116003Grevillea sp.AustraliaJ.L. Alcorn–––––GQ852731
Zasmidium anthuriicolaCBS 118742Anthurium sp.ThailandC.F. Hill–––––GQ852732
Z. citri-griseaCPC 13467Eucalyptus sp.ThailandW. Himaman–––––GQ852733
Z. nabiacenseCBS 125010Eucalyptus sp.AustraliaA.J. Cargenie–––––JF700964
Z. pseudoparkiiCBS 110999Eucalyptus grandisColombiaM.J. Wingfield–––––JF700965
Z. xenoparkiiCBS 111185Eucalyptus sp.IndonesiaM.J. Wingfield–––––JF700966
Zymoseptoria brevisIRAN1485C (= CPC 18102)Phalaris paradoxaIran–JF701035JF701103JF700866JF700967JF700798–
CPC 18106 (= 8S) = CBS 128853Phalaris minorIran–JF701036JF701104JF700867JF700968JF700799–
IRAN1486C (= CPC 18107)Phalaris minorIran–JF701037JF701105JF700868JF700969JF700800–
CPC 18109 (= 81)Phalaris paradoxaIran–JF701038JF701106JF700869JF700970JF700801–
CPC 18110 (= 83)Phalaris paradoxaIran–JF701039JF701107JF700870JF700971JF700802–
CPC 18111 (= 84)Phalaris paradoxaIran–JF701040JF701108JF700871JF700972JF700803–
CPC 18112 (= 85)Phalaris paradoxaIran–JF701041JF701109JF700872JF700973JF700804–
CPC 18113 (= 86)Phalaris paradoxaIran–JF701042JF701110JF700873JF700974JF700805–
CPC 18114 (= 87)Phalaris paradoxaIran–JF701043JF701111JF700874JF700975JF700806–
CPC 18115 (= 88)Phalaris paradoxaIran–JF701044JF701112JF700875JF700976JF700807–
Zymoseptoria halophilaIRAN1483C (= CPC 18105) = CBS 128854Hordeum glaucumIran–JF701045JF701113JF700876JF700977JF700808–
CBS 120382Hordeum vulgareUSAS. GoodwinJF701046JF701114JF700877JF700978JF700809–
Z. passeriniiCBS 120384Hordeum vulgareP71 × P83A, USAS. WareJF701047JF701115JF700878JF700979JF700810–
CBS 120385Hordeum vulgareP71 × P83B, USAS. WareJF701048JF701116JF700879JF700980JF700811–
IRAN1489C (= CPC 18099)Aegilops tauschiiIran–JF701049JF701117JF700880JF700981JF700812–
CPC 18100Aegilops tauschiiIran–JF701050JF701118JF700881JF700982JF700813–
CPC 18101Aegilops tauschiiIran–JF701051JF701119JF700882JF700983JF700814–
IRAN1484C (= CPC 18103)Calamagrostis sp.Iran–JF701052JF701120JF700883JF700984JF700815–
CPC 18116Avena sp.Iran–JF701053JF701121JF700884JF700985JF700816–
CPC 18117Avena sp.Iran–JF701054JF701122JF700885JF700986JF700817–
Z. triticiCBS 392.59Triticum aestivum–E. BeckerJF701055JF701123AY152603JF700987JF700818–
CBS 398.52Triticum aestivumSwitzerlandE. MullerJF701056JF701124JF700886JF700988JF700819–
IPO 01001Triticum aestivumNew Zeeland–JF701057JF701125JF700887JF700989JF700820–
IPO 02158Triticum aestivumIran–JF701058JF701126JF700888JF700990JF700821–
IPO 03008Triticum aestivumGermany–JF701059JF701127JF700889JF700991JF700822–
IPO 320Triticum aestivumRomania–JF701060JF701128JF700890JF700992JF700823–
IPO 323Triticum aestivumThe Netherlands–JF701061JF701129AF181692JF700993JF700824–
IPO 86013Triticum aestivumTurkey–JF701062JF701130JF700891JF700994JF700825–
IPO 86015Triticum aestivumMorocco–JF701063JF701131JF700892JF700995JF700826–
IPO 86036Triticum aestivumIsrael–JF701064JF701132JF700893JF700996JF700827–
IPO 87016Triticum aestivumUruguay–JF701065JF701133JF700894JF700997JF700828–
IPO 88004Triticum aestivumEthiopia–JF701066JF701134JF700895JF700998JF700829–
IPO 90012Triticum aestivumMexico–JF701067JF701135JF700896JF700999JF700830–
IPO 90015Triticum aestivumPeru–JF701068JF701136JF700897JF701000JF700831–
IPO 91009Triticum durumTunisia–JF701069JF701137JF700898JF701001JF700832–
IPO 91010Triticum aestivumTunisia–JF701070JF701138JF700899JF701002JF700833–
IPO 91012Triticum durumTunisia–JF701071JF701139JF700900JF701003JF700834–
IPO 91014Triticum durumTunisia–JF701072JF701140JF700901JF701004JF700835–
IPO 91016Triticum durumTunisia–JF701073JF701141JF700902JF701005JF700836–
IPO 91020Triticum durumMorocco–JF701074JF701142JF700903JF701006JF700837–
IPO 92002Triticum aestivumPortugal–JF701075JF701143JF700904JF701007JF700838–
IPO 92003Triticum aestivumPortugal–JF701076JF701144JF700905JF701008JF700839–
IPO 92005Triticale sp.Portugal–JF701077JF701145JF700906JF701009JF700840–
IPO 92032Triticum aestivumAlgeria–JF701078JF701146JF700907JF701010JF700841–
IPO 92050Triticum aestivumKenya–JF701079JF701147JF700908JF701011JF700842–
IPO 94231Triticum aestivumUSA–JF701080JF701148JF700909JF701012JF700843–
IPO 94236Triticum aestivumUSA–JF701081JF701149JF700910JF701013JF700844–
IPO 95001Triticum aestivumSwitzerland–JF701082JF701150JF700911JF701014JF700845–
IPO 95006Triticum durumSyria–JF701083JF701151JF700912JF701015JF700846–
IPO 95013Triticum aestivumSyria–JF701084JF701152JF700913JF701016JF700847–
IPO 95025Triticum durumSyria–JF701085JF701153JF700914JF701017JF700848–
IPO 95026Triticum durumSyria–JF701086JF701154JF700915JF701018JF700849–
IPO 95027Triticum durumSyria–JF701087JF701155JF700916JF701019JF700850–
IPO 95028Triticum aestivumSyria–JF701088JF701156JF700917JF701020JF700851–
IPO 95031Triticum durumSyria–JF701089JF701157JF700918JF701021JF700852–
IPO 95046Triticum durumSyria–JF701090JF701158JF700919JF701022JF700853–
IPO 95047Triticum aestivumAlgeria–JF701091JF701159JF700920JF701023JF700854–
IPO 95050Triticum aestivumAlgeria–JF701092JF701160JF700921JF701024JF700855–
IPO 95052Triticum aestivumAlgeria–JF701093JF701161JF700922JF701025JF700856–
IPO 95054Triticum aestivumAlgeria–JF701094JF701162JF700923JF701026JF700857–
IPO 95062Triticum aestivumAlgeria–JF701095JF701163JF700924JF701027JF700858–
IPO 95071Triticum aestivumAlgeria–JF701096JF701164JF700925JF701028JF700859–
IPO 95072Triticum aestivumAlgeria–JF701097JF701165JF700926JF701029JF700860–
IPO 95073Triticum aestivumAlgeria–JF701098JF701166JF700927JF701030JF700861–
IPO 95074Triticum aestivumAlgeria–JF701099JF701167JF700928JF701031JF700862–
IPO 97016Triticum aestivumItaly–JF701100JF701168JF700929JF701032JF700863–
IPO 98115Triticum aestivumHungary–JF701101JF701169JF700930JF701033JF700864–
IPO 99048Triticum aestivumFrance–JF701102JF701170JF700931JF701034JF700865–

1 CBS: Centraalbureau voor Schimmelcultures, Utrecht, The Netherlands; CPC: Pedro Crous working collection housed at CBS; IMI: International Mycological Institute; USO: United States Department of Agriculture, National Fungus Collections (BPI); IPO: Research Institute for Plant Protection, Wageningen (IRAN); Iranian Fungal Culture Collection, Iranian Research Institute of Plant Protection.

2 ACT = Actin, TUB = β-tubulin, CAL = Calmodulin, LSU = 28S large subunit of the nrRNA gene, RPB2= RNA polymerase II second largest subunit.

DNA extraction, amplification and sequencing

Herbarium specimens

Ten S. cytisi herbarium specimens occurring on Cytisus laburnum (= Laburnum anagyroides), were obtained from the U.S. National Fungus Collections (BPI) in Beltsville, Maryland, USA (Table 2). After microscopic inspection, the five specimens with the least amount of surface contamination (yeast and saprobes) where selected for DNA extraction (Table 2). Using a stereo microscope, ± 25 pycnidia, including their dried conidial cirrhi, where excised from each respective herbarium specimen, and suspended in tubes with 20 μL STL buffer from an E.Z.N.A. ® Forensic DNA Kit (Omegabiotek, Norcross). Special care was taken to keep the amount of contaminant leaf material, excised together with the fungal tissue, as low as possible. The fungal material was kept in STL buffer to rehydrate for 24 h at 4 °C, after which the fungal cell walls were degraded by two cycles of freezing with liquid nitrogen and immediate re-heating to 99 °C. The genomic DNA extraction was performed using the ‘Isolation of DNA from dried blood’ protocol available in the E.Z.N.A. ® Forensic DNA Kit with one modification: in order to increase the final DNA concentration, only 50 μL of preheated (70 °C) elution buffer was used to elude the DNA from the column.
Table 2

Herbarium specimens of Laburnum anagyroides infected with Septoria cytisi, obtained from the U.S. National Fungus Collections (BPI), Maryland, USA. Specimens marked with an asterisk were selected for DNA extraction.

BPI accession numberHostYear collectedLocation
0378986Laburnum anagyroides1913France
0378987Laburnum anagyroides1933Romania
0378988Laburnum anagyroides1893Italy
0378989*Laburnum anagyroides1929‘Czechoslovakia’
0378990*Laburnum anagyroides1874Italy
0378991*Laburnum anagyroides1885‘Czechoslovakia’
0378992Laburnum anagyroides1903Italy
0378993*Laburnum anagyroides1929Austria
0378994*Laburnum anagyroides1884‘Czechoslovakia’
0378995Laburnum anagyroides1876Italy
Genus-specific primers had to be designed because the use of generic fungal ITS and LSU primers only generated sequences of contaminants (mostly yeasts). For the amplification reactions concerning the herbarium specimens, the Verbatim High Fidelity DNA Polymerase Kit (Thermo Scientific) was used in combination with the Septoria-specific S18S-2 forward primer (annealing to the nuclear rDNA operon at the 3′-end of the 18S nrRNA gene (SSU); Table 2), together with the Septoria-specific SITS2_Fd reverse primer (annealing to the nuclear rDNA operon at the 5′-end of the 28S nrRNA gene (LSU); Table 2), in order to amplify a region spanning the 5.8S nrRNA gene and the first and second internal transcribed spacer regions (Fig. 2). This amplification reaction was set up in a volume of 12.5 μL using 5× High Fidelity buffer (with MgCl2), 0.8 μM of each primer, 2 μL of gDNA, 150 μM dNTP mix and 0.1 unit of Verbatim polymerase using a MyCycler thermal cycler (Bio-Rad). PCR amplification conditions were set as follows: an initial denaturation temperature at 98 °C for 2 min, followed by 50 cycles of denaturation temperature at 98 °C for 30 s, primer annealing at 52 °C for 30 s, primer extension at 72 °C for 30 s and final extension at 72 °C for 2 min. The resulting PCR products were then size-fractionated on a 3 % (w/v) agarose gel stained with ethidium bromide, excised from the gel and subsequently sequenced as described by Cheewangkoon et al. (2008).
Fig. 2

A diagrammatic representation of part of the nrDNA operon indicating the positions of the Septoria-specific primers used to generate ITS and LSU sequences of S. cytisi.

Degradation and shearing of the S. cytisi herbarium gDNA made it impossible to directly amplify and sequence the approximate 1 300 bp needed to cover both the ITS and D1–D3 domains of the 28S nrDNA in a single reaction. Therefore, specific primers were developed from the obtained S. cytisi ITS1 sequence, spaced about 300 bp apart (Table 2, Fig. 2), which made it possible to sequentially amplify and sequence the entire regions of both the ITS, and the D1–D3 domains of the LSU of S. cytisi sequentially, and later to sequence it as described by Cheewangkoon et al. (2008).

Fungal cultures

Genomic DNA was extracted from mycelium growing on MEA (Table 1), using the UltraClean® Microbial DNA Isolation Kit (Mo Bio Laboratories, Inc., Solana Beach, CA, USA). These strains were screened for five loci, namely ITS, Actin (ACT), calmodulin (CAL), RNA polymerase II second largest subunit (RPB2) and β-tubulin (TUB) (Table 3). DNA amplification and sequencing reactions were performed as described by Cheewangkoon et al. (2008).
Table 3

Primer combinations used during this study for generic amplification and sequencing.

LocusPrimerPrimer sequence 5′ to 3′OrientationReference
ActinACT-512FATGTGCAAGGCCGGTTTCGCForwardCarbone & Kohn (1999)
ActinACT2RdARRTCRCGDCCRGCCATGTCReverseGroenewald, unpubl. data
CalmodulinCAL-228FGAGTTCAAGGAGGCCTTCTCCCForwardCarbone & Kohn (1999)
CalmodulinCAL2RdTGRTCNGCCTCDCGGATCATCTCReverseGroenewald, unpubl. data
β-tubulinTUB2FdGTBCACCTYCARACCGGYCARTGForwardAveskamp et al. (2009)
β-tubulinTUB4RdCCRGAYTGRCCRAARACRAAGTTGTCReverseAveskamp et al. (2009)
RPB2fRPB2-5FGAYGAYMGWGATCAYTTYGGForwardLiu et al. (1999)
RPB2fRPB2-5F+414RACMANNCCCCARTGNGWRTTRTGReversePresent study
LSULSU1FdGRATCAGGTAGGRATACCCGForwardCrous et al. (2009a)
LSULR5TCCTGAGGGAAACTTCGReverseVilgalys & Hester (1990)

Phylogenetic analysis

To determine whether the multi-locus DNA sequence datasets were congruent, a partition homogeneity test (Farris et al. 1994) of all possible combinations was performed in PAUP v4.0b10 (Swofford 2003) with 1 000 replications. Parallel to this, a 70 % Neighbour-Joining (NJ) reciprocal bootstrap method with Maximum Likelihood distance (Mason-Gamer & Kellogg 1996, Lombard et al. 2010) was also employed to check congruency. The models of evolution for the NJ tree were estimated with Modeltest v3.7 (Posada & Crandall 1998) and bootstrap analyses (10 000 replicates) were performed in PAUP. Resulting NJ tree topologies were visually compared for conflicts between the individual gene regions. Maximum-parsimony genealogies for individual datasets and the combined dataset were estimated in PAUP using heuristic searches based on 1 000 random taxon addition sequences and the best trees were saved. All characters were weighted equally and alignment gaps were treated as missing data. Branches of zero length were collapsed and all multiple, equally most parsimonious trees were saved. Tree length (TL), consistency index (CI), retention index (RI) and the rescaled consistency index (RC) were calculated in PAUP for the equally most parsimonious trees and the resulting trees were printed with TreeView (Page 1996) and the alignments and phylogenetic trees were lodged in TreeBASE (www.treebase.org). All novel sequences derived from this study were deposited in GenBank (Table 1). Trees were either rooted to Cladosporium bruhnei for the LSU tree, or to Mycosphaerella punctiformis for the multigene tree.

Morphology

Descriptions were based on fungal cultures sporulating in vitro on WAB, incubated under continuous near-ultraviolet light for 2–4 wk. Wherever possible, 30 measurements (×1 000 magnification) were made of structures mounted in lactic acid, with the extremes of spore measurements given in parentheses. Colony colours (surface and reverse) were assessed after 1 mo on MEA, PDA and OA at 25 °C in the dark, using the colour charts of Rayner (1970).

RESULTS

ITS and LSU amplification and sequencing of S. cytisi

The gDNA extractions from the S. cytisi herbarium samples were performed on the herbarium specimens indicated in Table 2, and both the ITS and a partial LSU regions where targeted for these isolates using Septoria-specific primers (Table 4). An ITS amplicon length of 486 bp was achieved from herbarium sample US0378993 while the other samples yielded only partial ITS amplicons varying in length from 440 bp in sample US0378994 to ± 200 bp in sample US0378990; amplicons of sample US0378991 only yielded contamination sequences with general primers and did not amplify with either Septoria- or S. cytisi-specific primers.
Table 4

Septoria cytisi-specific ITS and LSU primers used for amplification and sequencing. Nucleotide positions were determined relative to the ITS/LSU sequence of Zymoseptoria tritici (GenBank accession FN428877).

Primer namePrimer sequence 5′ to 3′OrientationRelative position
S18S-2CGTAGGTGAACYTGCGRAGGGATCATTACYGAGTGAForward7
5.8S1FdCTCTTGGTTCBVGCATCGForward240
SITS2_FwdCCGCCCGCACTCCGAAGCGATTAATGAAATCForward459
SITS2_RevGATTTCATTAATCGCTTCGGAGTGCGGGCGGReverse459
LSU_Sep_230_FwdTATGTGACCGGCCCGCACCCTTTACForward710
LSU_Sep_230_RevGTAAAGGGTGCGGGCCGGTCACATAReverse710
LSU_Sep_530_FwdAAGACCTTAGGAATGTAGCTCACCTForward999
LSU_Sep_530_RevAGGTGAGCTACATTCCTAAGGTCTTReverse999
LSU_Sep_575_FwdCTTGGGCGAGGTCCGCGCTForward1059
LSU_Sep_575_RevAGCGCGGACCTCGCCCAAGReverse1059
LSU_Sep_785_RevAGGACATCAGGATCGGTCGATReverse1225

Annotation: ITS1 = 1–172 bp, 5.8S = 173–330 bp, ITS2 = 331–525 bp, LSU D1 & D2 domain = 525–1110 bp.

A comparison between the full-length S. cytisi ITS sequence and 287 other Septoria ITS sequences that were generated as part of a larger unpublished study, broadly linked S. cytisi to a distinct ITS clade containing S. astralagi and S. hippocastani, basal to a clade consisting of the majority of sequenced Septoria species (data not shown). Interspecific variation in the S. cytisi ITS sequences were present; however, it was limited to a few nucleotides per isolate sequenced (Table 5).
Table 5

Polymorphisms found in the ITS and LSU sequence between the S. cytisi herbarium specimens. Data marked with – are not available.

BPI specimenCollection yearITS position (bp)
LSU position (bp)
93219411176377446536561563
USO 3789891929A––TTGTTC
USO 3789931929ACCCCCAG–
USO 3789941884CGTCCGAGG
USO 3789901874AGC––––––
Amplification of the D1–D3 domains of the LSU region was attempted on the same S. cytisi gDNA extracts as mentioned before. A full-length sequence read of the S. cytisi D1–D3 domains (the first ± 900 bp of the 28S nrRNA gene) was only obtained from a single sample (US0378994). The four remaining herbarium specimens only yielded LSU sequences varying in length from 500–800 bp. Interspecific variation in the LSU nucleotide sequences was limited to a few nucleotides per sequenced isolate (Table 5).

Phylogenetic analyses

LSU dataset

During phylogenetic analyses, the S. cytisi LSU sequence was aligned with LSU sequence data of 64 Capnodiales taxa, including 19 representative Septoria taxa, in order to determine which of these Septoria isolates belonged to Septoria s.str. (i.e. high association with S. cytisi) and to establish how this clade is related to other well-established genera within the Capnodiales. For the LSU tree, ± 759 characters were determined for 64 Capnodiales taxa, including 19 Septoria taxa as well as the two Cladosporium bruhnei isolates that were used as outgroups (CPC 5101 and CBS 188.54). The phylogenetic analysis showed that 164 characters were parsimony-informative, 38 were variable and parsimony-uninformative and 557 were constant. Thirty-two equally most parsimonious trees were obtained from the heuristic search, the first of which is shown in Fig. 3 (TL = 574, CI = 0.495, RI = 0.848, RC = 0.419). The phylogenetic analysis of the Capnodiales LSU dataset, including S. cytisi, showed this species clustering in a well-defined clade incorporating the majority of the Septoria spp. used in this analysis, clearly delineating this clade as Septoria s.str. These results also show a distinct monophyletic clade that are referred to as Zymoseptoria gen. nov. below, which contains S. tritici and S. passerinii together with two other species in this genus.
Fig. 3

The first of 32 equally most parsimonious trees obtained from a heuristic search with 1 000 random taxon additions of the LSU alignment containing representative species that currently form well-supported clades within the Capnodiales. The scale bar indicates 10 changes and bootstrap support values from 1 000 replicates are indicated at the nodes. Thickened lines indicate conserved branches present in the strict consensus tree.

Multi-locus dataset

For the multi-locus phylogenetic analyses of the graminicolous isolates, ± 220 nucleotides where determined for ACT, 345 for CAL, 513 for ITS, 350 for TUB, and 305 for RPB2 (see Table 3 for detailed primer description). The adjusted sequence alignment for each locus consisted of 69 ingroup taxa with Ramularia endophylla (Mycosphaerella punctiformis; strain CBS 113265) as outgroup. The strict consensus tree (Fig. 4) based on the multi-locus maximum-parsimony analysis had an identical topology to those of the strict consensus trees obtained for the individual loci. The partition homogeneity tests for all of the possible combinations of the five gene regions consistently yielded a P-value of 0.001, and were therefore incongruent. However, the 70 % reciprocal bootstrap trees of the individual gene regions showed no conflicting tree topologies between the separate datasets. Based on the result of the 70 % reciprocal bootstrap trees (Mason-Gamer & Kellogg 1996, Cunningham 1997), the DNA sequences of the five gene regions (ACT, CAL, RPB2, TUB and ITS) were concatenated for the phylogenetic analyses.
Fig. 4

The first of 810 equally most parsimonious trees obtained from a heuristic search with 1 000 random taxon additions of the combined ACT, CAL, TUB, RPB2 and ITS sequence alignment of Zymoseptoria spp. The scale bar indicates 10 changes and bootstrap support values from 1 000 replicates are indicated at the nodes. Thickened lines indicate conserved branches present in the strict consensus tree.

The concatenated and manually aligned multi-locus alignment contained 70 taxa (including the outgroup sequence) and, out of the 1 723 characters used in the phylogenetic analysis, 233 were parsimony-informative, 291 were variable and parsimony-uninformative and 1 199 were constant. 810 equally parsimonious trees were obtained from the heuristic search, the first of which is shown in Fig. 4 (TL = 768, CI = 0.815, RI = 0.922, RC = 0.751). Phylogenetic results showed two well-supported new species emerging besides the conserved S. tritici and S. passerinii clades, with a significant amount of genetic variation within the S. tritici clade as previously found by Goodwin et al. (2007). This intraspecific variation is most likely the cause of the partition homogeneity test failure. The overall genetic diversity of S. tritici, examined over five loci, was found to be quite significant within the 54 global isolates of S. tritici used for this study. Most of the existing phylogenetic variation observed between the S. tritici isolates used in the combined tree (Fig. 4) was caused by single insertion and deletion events of triplets within tandem repeats inside the ACT and RPB2 intron sequences of these isolates. The most significant impact of these indel events can be seen in the phylogenetic cluster containing CPC 18099–18101 (on Aegilops tauschii, Iran), that arises in the S. tritici clade of the combined tree (Fig. 4). This small clade has a bootstrap support value of 94 %, suggesting that it could represent a cryptic or ancestral lineage of what is currently considered to be S. tritici. Further study using more isolates would be required to address this issue.

Taxonomy

Based on the LSU dataset (Fig. 3), S. cytisi was shown to cluster within the major Septoria clade, while the taxa occurring on graminicolous hosts clustered in a separate clade, distinct from Septoria (S. cytisi) and Mycosphaerella (M. punctiformis, represented by R. endophylla), suggesting that they represented a distinct genus in the Mycosphaerellaceae. Morphologically these phylogenetic differences were supported by the distinct yeast-like growth exhibited in culture by the graminicolous species, as well as their mode of conidiogenesis, e.g. phialidic, with periclinal thickening and occasional inconspicuous percurrent proliferation(s), but lacking blastic sympodial proliferation which occurs in many species of Septoria s.str. Based on these differences in culture, morphology and phylogeny, a new genus is hereby introduced for the taxa occurring on graminicolous hosts. Quaedvlieg & Crous, gen. nov. — MycoBank MB517922 Septoriae similis, sed adaucto fermentoide, sine formatione blastica-sympodiali conidiorum, in cultura typis conidiorum usque ad 3. Type species. Zymoseptoria tritici (Desm.) Quaedvlieg & Crous. Etymology. Zymo = yeast-like growth; Septoria = Septoria-like in morphology. Conidiomata pycnidial, semi-immersed to erumpent, dark brown to black, subglobose, with central ostiole; wall of 3–4 layers of brown textura angularis. Conidiophores hyaline, smooth, 1–2-septate, or reduced to conidiogenous cells, lining the inner cavity. Conidiogenous cells tightly aggregated, ampulliform to doliiform or subcylindrical, phialidic with periclinal thickening, or with 2–3 inconspicuous, percurrent proliferations at apex. Type I conidia solitary, hyaline, smooth, guttulate, narrowly cylindrical to subulate, tapering towards acutely rounded apex, with bluntly rounded to truncate base, transversely euseptate; hila not thickened nor darkened. On OA and PDA aerial hyphae disarticulate into phragmospores (Type II conidia), that again give rise to Type I conidia via microcyclic conidiation; yeast-like growth and microcyclic conidiation (Type III conidia) common on agar media. M. Razavi, Quaedvlieg & Crous, sp. nov. — MycoBank MB517923; Fig. 5
Fig. 5

Zymoseptoria brevis (CPC 18106) a. Pycnidium forming on barley leaves in vitro; b. colony sporulation on potato-dextrose agar; c. conidiogenous cells; d. colony on synthetic nutrient-poor agar, showing yeast-like growth; e. conidium undergoing microcyclic conidiation (arrows; Type III); f–h. pycnidiospores (Type I). — Scale bars = 10 μm.

Zymoseptoriae passerinii similis, sed conidiis minoribus, (12–)13–16(–17) × 2(–2.5) μm. Etymology. Named after its conidia, which are shorter (brevis) than those of the other species. On sterile barley leaves on WA: Conidiomata pycnidial, substomatal, immersed to erumpent, globose, dark brown, up to 200 μm diam, with central ostiole, 5–10 μm diam; wall of 3–4 layers of brown textura angularis. Conidiophores reduced to conidiogenous cells, or with one supporting cell, lining the inner cavity. Conidiogenous cells hyaline, smooth, tightly aggregated, subcylindrical to ampulliform, straight to curved, 7–15 × 2–4 μm, with 1–2 inconspicuous, percurrent proliferations at apex, 1–1.5 μm diam. Type I conidia solitary, hyaline, smooth, guttulate, subcylindrical to subulate, tapering towards bluntly rounded apex, with truncate base, 0–1-septate, (12–)13–16(–17) × 2(–2.5) μm; on PDA, 9–21 × 2–3.5 μm; hila not thickened nor darkened, 1–2 μm. On OA and PDA yeast-like growth and microcyclic conidiation (Type III conidia) common, also forming on aerial hyphae via solitary conidiogenous loci. Culture characteristics — Colonies on PDA flat, spreading, with moderate aerial mycelium and feathery, lobate margins; surface olivaceous-grey, outer region dirty white, reverse iron-grey; on MEA more erumpent, with less aerial mycelium; surface iron-grey with patches of white, reverse greenish black; on OA somewhat fluffy with dirty white to pale olivaceous aerial mycelium, and submerged, olivaceous-grey margin; reaching 15 mm diam after 1 mo at 25 °C; fertile. Specimen examined. Iran, Ilam province, Dehloran, on living leaves of Phalaris minor, M. Razavi, holotype CBS H-20542, cultures ex-type No 8S = CPC 18106 = CBS 128853. Notes — Zymoseptoria brevis can easily be distinguished from the other taxa presently known within the genus based on its shorter conidia. (Speg.) M. Razavi, Quaedvlieg & Crous, comb. nov. — MycoBank MB517924; Fig. 6
Fig. 6

Zymoseptoria halophila (CPC 18105). a. Pycnidia forming on barley leaves in vitro, with oozing conidia cirrhus; b–e. conidiogenous cells formed in pycnidia; f. conidia (Type I); g. colony with yeast-like growth on synthetic nutrient-poor agar; h, j–l. conidia formed as phragmospores in aerial hyphae (Type II); i, m. conidia formed via microcyclic conidiation (Type III). — Scale bars = 10 μm.

Basionym: Septoria halophila Speg., Anales Mus. Nac. Hist. Nat. Buenos Aires, Ser. 3, 13: 382. 1910. Initial symptoms of the disease were dark-brown lesions which soon became pale buff in the centre. The leaves were heavily mottled later, and the solitary, sometimes aggregated pycnidia formed on the lesions. The disease was more severe on the lower leaves. Pycnidia were observed on adaxial surface of the infected leaves, and were dark-brown, globose, measuring 90–150 μm, with an ostiole ± 10 μm diam. On sterile barley leaves on WA: Conidiomata pycnidial, semi-immersed to erumpent, dark brown to black, subglobose, up to 300 μm diam, with central ostiole, up to 30 μm diam; wall of 3–4 layers of brown textura angularis. Conidiophores reduced to conidiogenous cells, lining the inner cavity. Conidiogenous cells hyaline, smooth, tightly aggregated, ampulliform to doliiform, 10–15 × 4–7 μm, with 2–3 inconspicuous, percurrent proliferations at apex, 1–2 μm diam. Type I conidia solitary, hyaline, smooth, guttulate, narrowly cylindrical to subulate, tapering towards acutely rounded apex, with bluntly rounded to truncate base; basal cell long obconically truncate, 1(–3)-septate, (30–)33–38(–50) × 2(–3) μm; conidia in vivo 1–2-septate, 36–45 × 1.5–2 μm; hila not thickened nor darkened, 1–2 μm. On OA and PDA conidia can be up to 62 μm long, and aerial hyphae disarticulate into phragmospores (Type II conidia), that again give rise to type I conidia via microcyclic conidiation; yeast-like growth and microcyclic conidiation (Type III conidia) common on agar media. Culture characteristics — Colonies on PDA flat, spreading, with sparse aerial mycelium and feathery, lobate margins; centre olivaceous-grey, outer region iron-grey; reverse iron-grey; on MEA surface and reverse greenish black; on OA iron-grey, reaching 20 mm diam after 1 mo at 25 °C; fertile. Specimen examined. Iran, Ilam province, Dehloran, on living leaves of Hordeum glaucum, 25 Apr. 2007, M. Razavi, specimens IRAN12892F, CBS H-20543, cultures ex-type GLS1 = IRAN1483C = CPC 18105 = CBS 128854. Notes — The present collection of Z. halophila was initially reported from Iran as S. halophila by Seifbarghi et al. (2009) (GenBank HM100267, HM100266), based on the description of S. halophila provided by Priest (2006). Zymoseptoria halophila was originally described from Hordeum halophilum collected in Argentina, with conidia being (0–)1(–2)-septate, 36–58 × 1.5(–2) μm, and conidiogenous cells being 8–10 × 2.5–3.5 μm. It is likely that the various collections on Hordeum and Poa spp. from Australia listed by Priest (2006) could represent different species, but this can only be resolved once additional collections and cultures have been obtained to facilitate further molecular comparisons. Zymoseptoria halophila is closely related to Z. passerinii, which is also reflected in its conidial size, which overlaps in length, but can only be distinguished based on their difference in width. It is possible that some published records of Z. passerinii could in fact represent Z. halophila, but more collections would be required to resolve its host range and geographic distribution. (Sacc.) Quaedvlieg & Crous, comb. nov. — MycoBank MB517925; Fig. 7
Fig. 7

Zymoseptoria passerinii (CBS 120382). a. Colony sporulating on potato-dextrose agar; b. colony sporulating on synthetic nutrient-poor agar; c. conidiogenous cells formed inside pycnidia; e, f. conidia from pycnidia (Type I). — Scale bars = 10 μm.

Basionym: Septoria passerinii Sacc., Syll. Fung. (Abellini) 3: 560. 1884. Specimens examined. Italy, Vigheffio, near Parma, on Hordeum murinum, June 1879 (F. von Thümen, Mycotheca Univ. No. 1997, isotype in MEL, see Priest 2006, f. 107). – USA, North Dakota, Foster county, on Hordeum vulgare, coll. S. Goodwin, isol. D. Long, epitype designated here CBS H-20544, culture ex-epitype P83 = CBS 120382. Notes — Priest (2006) reported Z. passerinii from several Hordeum species collected in Western Australia and deposited them at IMI (now in Kew), and found them to be identical to type material examined, suggesting that this pathogen is widely distributed along with its host. Ware et al. (2007) reported a Mycosphaerella-like teleomorph from a heterothallic mating of isolates of Z. passerinii. Single ascospore isolates have been deposited as CBS 120384 (P71 × P83A) and CBS 120385 (P71 × P83B). Isolate P63, which is genetically similar to P83 on the loci sequenced in this study, has been used for whole genome analysis of Z. passerinii (E.H. Stukenbrock, pers. comm.). (Desm.) Quaedvlieg & Crous, comb. nov. — MycoBank MB517926; Fig. 8
Fig. 8

Zymoseptoria tritici (CBS 115943). a. Conidiogenous cells formed inside pycnidia; b. conidia from pycnidia (Type I); colony sporulating on synthetic nutrient-poor agar, showing yeast-like growth; d, e. conidia formed via microcyclic conidiation (Type III). — Scale bars = 10 μm.

Basionym: Septoria tritici Desm., Ann. Sci. Nat., Bot., sér. 2, 17: 107 (1842). Teleomorph: ‘Mycosphaerella’ graminicola (Fuckel) J. Schröt., in Cohn, Krypt.-Fl. Schlesien 3, 2: 340. 1894 (‘1893’). Basionym: Sphaeria graminicola Fuckel, Fungi Rhenani Exsicc.: no. 1578. 1865. ≡ Sphaerella graminicola (Fuckel) Fuckel, Jahrb. Nassauischen Vereins Naturk. 23–24: 101. 1870. Specimens examined. France, on Triticum sp. (holotype of Septoria tritici; PC). – Germany, Oestrich, on Triticum repens, Fuckel, Fungi Rhenani Exsiccati no. 1578 (L, isotype of Mycosphaerella graminicola). – Netherlands, Brabant West, on Triticum aestivum, coll. R. Daamen, 6 May 1981, isol. as single conidium, W. Veenbaas, 810507/1, 7 May 1981, epitype designated here CBS H-20545, including teleomorph material on Triticum leaf of heterothallic mating IPO 323 (MAT 1-1) × IPO 94269 (MAT 1-2), culture ex-epitype IPO 323 = CBS 115943. Notes — The isolate designated here as ex-epitype (IPO 323 = CBS 115943) is also the strain used in the whole genome amplification and sequencing of this species (http://genome.jgi-psf.org/Mycgr3/Mycgr3.download.html).

DISCUSSION

For many years the genus Mycosphaerella has been treated as a wide general concept to accommodate a range of related and unrelated species and genera that have small ascomata, and hyaline, 1-septate ascospores, without pseudoparaphyses (Aptroot 2006). The observation that Mycosphaerella-like teleomorphs were linked to more than 40 different anamorphs (Crous 2009) was thus seen as rather odd, though acceptable within this wider concept used to accommodate these thousands of mostly phytopathogenic fungi. It was only in recent years when the higher order phylogenetic relationships of Mycosphaerella was addressed as part of the Assembling the Fungal Tree of Life initiative (Schoch et al. 2006), that Mycosphaerella was shown to be polyphyletic (Crous et al. 2007), even containing different families within the Dothideomycetes (Crous et al. 2009a, b, Schoch et al. 2009a, b). The fact that Septoria also contains significant morphological variation was commented on by Sutton (1980), who stated that the genus is heterogeneous, and should be revised, containing conidiomata that ranged from acervuli to pycnidia, and conidiogenesis that ranged from blastic sympodial to annellidic (percurrent proliferation) or phialidic (with periclinal thickening). As can be seen with the taxa treated to date, however, these characters alone are also insufficient to delineate all natural genera, as several modes of conidiogenesis or conidiomatal types occur within the same genus in the Septoria-like complex. Part of the reason for the confusion surrounding the genus Septoria is based on the fact that until now no DNA sequence data were available for the type species, S. cytisi. Due to the lack of cultures of this species, DNA was subsequently extracted from several herbarium specimens. Using this technique, however, some intraspecific variation was observed in both the LSU and ITS sequences of S. cytisi. This could possibly be explained by geographical and temporal spread in the sampling sites, spanning 54 years from a region encompassing South and Central Europe, making some sequence variation within these specimens probable. Even if one or two nucleotides might actually be scored wrong in the US0378994-derived LSU sequence for S. cytisi, this would not have any impact on the phylogenetic position of S. cytisi within the Septoria s.str. clade, its nearest sister genus being Cercospora in the Mycosphaerellaceae (Groenewald et al. 2006). As shown in the present study (Fig. 2), the genus Mycosphaerella is unavailable to accommodate the taxa occurring on graminicolous hosts, as Mycosphaerella is restricted to species with Ramularia anamorphs (Verkley et al. 2004a, Crous et al. 2009b). Furthermore, Septoria s.str. also clusters apart from the species on cereals (Fig. 3), making the name Septoria unavailable for these pathogens. In the present study we introduce a novel genus Zymoseptoria to accommodate the Septoria-like species occurring on graminicolous hosts. Although species of Zymoseptoria tend to have phialides with apical periclinal thickening, this mode of conidiogenesis has also evolved in Septoria s.str. (e.g. S. apiicola), and is not restricted to Zymoseptoria. More importantly, species of Zymoseptoria exhibit a yeast-like growth in culture, and have up to three different conidial types that can be observed, namely Type I (pycnidial conidia), Type II (phragmospores on aerial hyphae), and Type III (yeast-like growth proliferating via microcyclic conidiation). Introducing a novel genus for this group of important plant pathogens was not taken lightly, as Z. passerinii causes septoria speckled leaf blotch (SSLB) on barley (Hordeum vulgare), and has been reported around the globe on this crop (Mathre 1997, Cunfer & Ueng 1999, Goodwin & Zismann 2001, Ware et al. 2007). Septoria tritici blotch (STB) is caused by Z. tritici (teleomorph ‘Mycosphaerella’ graminicola), and is currently present in all major wheat growing areas. This disease is consistently ranked amongst the most damaging wheat diseases in Australia, Europe, North and South America, and in Europe more than 70 % of all the fungicides applied to wheat are to control STB (Eyal et al. 1987). Wheat, together with maize and rice directly contribute 47 % to global human consumption (Tweeten & Thompson 2009). Since 1961, wheat production has increased globally with almost 300 % on a virtually stable cultivation area of 200 M ha. This progress was largely achieved by increased average yields (FAO 2010). However, the annual growth rate of global wheat production cannot meet the global market requirements in the coming four decades (Fischer et al. 2009, Fischer & Edmeades 2010). Although Z. passerinii and Z. tritici share many similarities (Goodwin et al. 2001) (Fig. 3, 4), both pathogens having a dimorphic lifestyle (Mehrabi et al. 2006); one major difference between them is that Z. tritici has a year-round and very active sexual cycle (Shaw & Royle 1993, Kema et al. 1996, Zhan et al. 2003), whereas there have been no reports of a sexual cycle for S. passerinii observed in nature, despite isolates of S. passerinii having opposite mating types being commonly found in natural populations, even on the same leaf (Goodwin et al. 2003), suggesting cryptic sex does exist for Z. passerinii (Ware et al. 2007). With respect to the two additional species treated in the present study, Z. brevis and Z. halophila, almost nothing is known about their relative importance, geographical distribution, host range or sexual behaviour. Given the importance of their known host crops, however, this complex is in dire need of further study.
  26 in total

1.  Phylogenetic relationships among ascomycetes: evidence from an RNA polymerse II subunit.

Authors:  Y J Liu; S Whelen; B D Hall
Journal:  Mol Biol Evol       Date:  1999-12       Impact factor: 16.240

2.  TAXONOMY AND IDENTIFICATION OF SEPTORIA AND STAGONOSPORA SPECIES ON SMALL-GRAIN CEREALS.

Authors:  Barry M Cunfer; Peter P Ueng
Journal:  Annu Rev Phytopathol       Date:  1999       Impact factor: 13.078

3.  Successful crosses and molecular tetrad and progeny analyses demonstrate heterothallism in Mycosphaerella graminicola.

Authors:  G H Kema; E C Verstappen; M Todorova; C Waalwijk
Journal:  Curr Genet       Date:  1996-08       Impact factor: 3.886

4.  Cloning and analysis of the mating-type idiomorphs from the barley pathogen Septoria passerinii.

Authors:  S B Goodwin; C Waalwijk; G H J Kema; J R Cavaletto; G Zhang
Journal:  Mol Genet Genomics       Date:  2003-03-11       Impact factor: 3.291

5.  Identification and genetic mapping of highly polymorphic microsatellite loci from an EST database of the septoria tritici blotch pathogen Mycosphaerella graminicola.

Authors:  Stephen B Goodwin; Theo A J van der Lee; Jessica R Cavaletto; Bas Te Lintel Hekkert; Charles F Crane; Gert H J Kema
Journal:  Fungal Genet Biol       Date:  2006-10-30       Impact factor: 3.495

6.  Unravelling Mycosphaerella: do you believe in genera?

Authors:  P W Crous; B A Summerell; A J Carnegie; M J Wingfield; G C Hunter; T I Burgess; V Andjic; P A Barber; J Z Groenewald
Journal:  Persoonia       Date:  2009-10-29       Impact factor: 11.051

7.  Multigene phylogeny and mating tests reveal three cryptic species related to Calonectria pauciramosa.

Authors:  L Lombard; P W Crous; B D Wingfield; M J Wingfield
Journal:  Stud Mycol       Date:  2010       Impact factor: 16.097

8.  Species of Mycosphaerella and related anamorphs on Eucalyptus leaves from Thailand.

Authors:  R Cheewangkoon; P W Crous; K D Hyde; J Z Groenewald; C To-Anan
Journal:  Persoonia       Date:  2008-09-24       Impact factor: 11.051

9.  Rapid genetic identification and mapping of enzymatically amplified ribosomal DNA from several Cryptococcus species.

Authors:  R Vilgalys; M Hester
Journal:  J Bacteriol       Date:  1990-08       Impact factor: 3.490

10.  Mycosphaerella is polyphyletic.

Authors:  P W Crous; U Braun; J Z Groenewald
Journal:  Stud Mycol       Date:  2007       Impact factor: 16.097

View more
  50 in total

Review 1.  One fungus, one name promotes progressive plant pathology.

Authors:  Michael J Wingfield; Z Wilhelm De Beer; Bernard Slippers; Brenda D Wingfield; Johannes Z Groenewald; Lorenzo Lombard; Pedro W Crous
Journal:  Mol Plant Pathol       Date:  2011-12-06       Impact factor: 5.663

2.  Fungal Planet description sheets: 716-784.

Authors:  P W Crous; M J Wingfield; T I Burgess; G E St J Hardy; J Gené; J Guarro; I G Baseia; D García; L F P Gusmão; C M Souza-Motta; R Thangavel; S Adamčík; A Barili; C W Barnes; J D P Bezerra; J J Bordallo; J F Cano-Lira; R J V de Oliveira; E Ercole; V Hubka; I Iturrieta-González; A Kubátová; M P Martín; P-A Moreau; A Morte; M E Ordoñez; A Rodríguez; A M Stchigel; A Vizzini; J Abdollahzadeh; V P Abreu; K Adamčíková; G M R Albuquerque; A V Alexandrova; E Álvarez Duarte; C Armstrong-Cho; S Banniza; R N Barbosa; J-M Bellanger; J L Bezerra; T S Cabral; M Caboň; E Caicedo; T Cantillo; A J Carnegie; L T Carmo; R F Castañeda-Ruiz; C R Clement; A Čmoková; L B Conceição; R H S F Cruz; U Damm; B D B da Silva; G A da Silva; R M F da Silva; A L C M de A Santiago; L F de Oliveira; C A F de Souza; F Déniel; B Dima; G Dong; J Edwards; C R Félix; J Fournier; T B Gibertoni; K Hosaka; T Iturriaga; M Jadan; J-L Jany; Ž Jurjević; M Kolařík; I Kušan; M F Landell; T R Leite Cordeiro; D X Lima; M Loizides; S Luo; A R Machado; H Madrid; O M C Magalhães; P Marinho; N Matočec; A Mešić; A N Miller; O V Morozova; R P Neves; K Nonaka; A Nováková; N H Oberlies; J R C Oliveira-Filho; T G L Oliveira; V Papp; O L Pereira; G Perrone; S W Peterson; T H G Pham; H A Raja; D B Raudabaugh; J Řehulka; E Rodríguez-Andrade; M Saba; A Schauflerová; R G Shivas; G Simonini; J P Z Siqueira; J O Sousa; V Stajsic; T Svetasheva; Y P Tan; Z Tkalčec; S Ullah; P Valente; N Valenzuela-Lopez; M Abrinbana; D A Viana Marques; P T W Wong; V Xavier de Lima; J Z Groenewald
Journal:  Persoonia       Date:  2018-07-13       Impact factor: 11.051

3.  Seasonal Changes Drive Short-Term Selection for Fitness Traits in the Wheat Pathogen Zymoseptoria tritici.

Authors:  Frédéric Suffert; Virginie Ravigné; Ivan Sache
Journal:  Appl Environ Microbiol       Date:  2015-07-06       Impact factor: 4.792

4.  Diaporthe: a genus of endophytic, saprobic and plant pathogenic fungi.

Authors:  R R Gomes; C Glienke; S I R Videira; L Lombard; J Z Groenewald; P W Crous
Journal:  Persoonia       Date:  2013-03-28       Impact factor: 11.051

5.  Introducing the Consolidated Species Concept to resolve species in the Teratosphaeriaceae.

Authors:  W Quaedvlieg; M Binder; J Z Groenewald; B A Summerell; A J Carnegie; T I Burgess; P W Crous
Journal:  Persoonia       Date:  2014-05-15       Impact factor: 11.051

Review 6.  Global food and fibre security threatened by current inefficiencies in fungal identification.

Authors:  Pedro W Crous; Johannes Z Groenewald; Bernard Slippers; Michael J Wingfield
Journal:  Philos Trans R Soc Lond B Biol Sci       Date:  2016-12-05       Impact factor: 6.237

7.  All that glitters is not Ramularia.

Authors:  S I R Videira; J Z Groenewald; U Braun; H D Shin; P W Crous
Journal:  Stud Mycol       Date:  2016-06-29       Impact factor: 16.097

8.  Mycosphaerellaceae - Chaos or clarity?

Authors:  S I R Videira; J Z Groenewald; C Nakashima; U Braun; R W Barreto; P J G M de Wit; P W Crous
Journal:  Stud Mycol       Date:  2017-09-28       Impact factor: 16.097

9.  Genera of phytopathogenic fungi: GOPHY 3.

Authors:  Y Marin-Felix; M Hernández-Restrepo; I Iturrieta-González; D García; J Gené; J Z Groenewald; L Cai; Q Chen; W Quaedvlieg; R K Schumacher; P W J Taylor; C Ambers; G Bonthond; J Edwards; S A Krueger-Hadfield; J J Luangsa-Ard; L Morton; A Moslemi; M Sandoval-Denis; Y P Tan; R Thangavel; N Vaghefi; R Cheewangkoon; P W Crous
Journal:  Stud Mycol       Date:  2019-06-13       Impact factor: 16.097

10.  Fungal Planet description sheets: 128-153.

Authors:  P W Crous; R G Shivas; M J Wingfield; B A Summerell; A Y Rossman; J L Alves; G C Adams; R W Barreto; A Bell; M L Coutinho; S L Flory; G Gates; K R Grice; G E St J Hardy; N M Kleczewski; L Lombard; C M O Longa; G Louis-Seize; F Macedo; D P Mahoney; G Maresi; P M Martin-Sanchez; L Marvanová; A M Minnis; L N Morgado; M E Noordeloos; A J L Phillips; W Quaedvlieg; P G Ryan; C Saiz-Jimenez; K A Seifert; W J Swart; Y P Tan; J B Tanney; P Q Thu; S I R Videira; D M Walker; J Z Groenewald
Journal:  Persoonia       Date:  2012-12-20       Impact factor: 11.051

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.