Literature DB >> 22016762

Paraholcoglossum and Tsiorchis, two new orchid genera established by molecular and morphological analyses of the Holcoglossum alliance.

Zhong-Jian Liu1, Li-Jun Chen, Sing-Chi Chen, Jing Cai, Wen-Chieh Tsai, Yu-Yun Hsiao, Wen-Hui Rao, Xue-Yong Ma, Guo-Qiang Zhang.   

Abstract

BACKGROUND: Holcoglossum is a small orchid genus of 12 species ranging from SW China to Thailand and NE India. Although molecular and morphological analyses have been performed to establish the phylogenetic relationships within this genus, the interspecific relations and its relations with allied genera, such as Rhynchostylis, Aerides and Vanda, remain unclear. METHODOLOGY/PRINCIPAL
FINDINGS: In addition to morphological analysis, maximum parsimony, maximum likelihood, and Bayesian inference analyses were performed based on fragments of the nuclear ITS and chloroplast trnL-F and matK genes of 31 taxa (15 Holcoglossum, 14 Aeridinae, 2 outgroups) representing all major clades of the Holcoglossum alliance. The results suggest that Holcoglossum is triphyletic, comprising three clades: the Holcoglossum clade, its sister clade, and a distant clade more closely related to Rhynchostylis, Aerides, and Vanda than to the Holcoglossum clade. The Holcoglossum clade is further divided into three subclades; the genetic distances between these three subclades also support this delimitation. The molecular conclusion is consistent with their distinct morphological characters.
CONCLUSIONS: We propose that the latter two clades comprise two new genera, Paraholcoglossum and Tsiorchis, and Holcoglossum clade divides into three sections. In addition, a new section, Holcoglossum sect. Nujiangensia, and a new species, Holcoglossum linearifolium, are proposed. Some new combinations are made, and a new scheme is provided for the classification of all species of Holcoglossum, Paraholcoglossum, and Tsiorchis.

Entities:  

Mesh:

Substances:

Year:  2011        PMID: 22016762      PMCID: PMC3189912          DOI: 10.1371/journal.pone.0024864

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Holcoglossum is a small genus of Orchidaceae (Aeridinae, Vandeae) comprising about 12 species ranging from China to Vietnam, Laos, Thailand, Myanmar, and NE India [1]. After it was established by Schlechter [2], Holcoglossum remained monotypic for over 50 years until Garay [3] delimited the genus and transferred Vanda kimballiana Rchb. f. and Vanda rupestris Hand.-Mazz. to it. In 1982, Tsi [4] added two species, Holcoglossum flavescens (Schltr.) Z. H. Tsi and H. junceum Tsi, though the latter was reduced to a synonym of Ascocentrum himalaicum (Deb, Sengupta & Malick) Christenson by Christenson in 1987 [5]. After an examination of the “Vanda-Aerides alliance”, Christenson [5] assigned Vanda subulifolia Rchb. f. and Vanda amesiana Rchb. f. to Holcoglossum, and further divided Holcoglossum into two sections, H. sect. Kimballianum and H. sect. Holcoglossum, based on plant habit and flower number per inflorescence. Seidenfaden [6], [7] disagreed with Christenson's treatment, however, and suggested that a new genus is necessary for Vanda amesiana and V. subulifolia. For the latter 2 species, Jin [8] proposed a new subgenus of Holcoglossum, H. subgen. Brachycentron. This subgenus is characterized by its lip shallowly saccate at the base, with a ridged callus on the front margin of the sac mouth, and an oblong or linear stipe with its base as broad as its apex. In the typical subgenus H. subgen. Holcoglossum, the lip has a conspicuous spur at the base and a crested or fleshy callus on the mid-lobe. The stipe is tapered, with one end broader than the other. Jin [8] further divided the latter subgenus into two sections: H. sect. Holcoglossum and H. sect. Sorotylos. Based on nuclear ITS and chloroplast trnL-F and matK analyses, Fan et. al. [9] suggested that Holcoglossum is a monophyletic genus consisting of three major subclades, albeit including two debatable species, H. amesianum and H. subulifolium. They even treated H. kimballianum and H. wangii as being closely related to the two debatable species, and grouped them together into the same clade (tropical clade). Morphologically, however, H. kimballianum and H. wangii are quite different from H. amesianum and H. subulifolium, and they were once regarded as belonging to two different sections [5], [10] or even two different subgenera [8]. In fact, according to the molecular evidence provided by Fan et al. [9], the systematic positions of H. kimballianum and H. wangii are still not clear. This treatment is problematic, however, and clarification requires further molecular analysis or repeated tests for further generic delimitation and infrageneric classification. In this study, phylogenetic relationships between Holcoglossum, allied genera, and infrageneric taxa were assessed using longer gene sequences for nuclear ITS, chloroplast trnL-F, and matK than employed previously [9], in combination with morphological analyses.

Results

The DNA sequences of 31 taxa were obtained and analyzed. The DNA sequences of 15 species (14 species of Holcoglossum and 1 species of Papilionanthe) were newly obtained except for the matK fragments from three species. Most of the sequences we obtained are longer than those used in previous research [9]. Detailed sequence information is listed in supplementary Table S2, and can also be accessed from GenBank. The aligned length, the indels' information, the numbers of variable sites and parsimony informative sites, tree statistics for the maximum parsimony (MP) analysis, and the best-fit model selected by Modeltest are given in Tables 1 and 2. Genetic distances between species and between sections of Holcoglossum are given in Table 3.
Table 1

Statistics from the analyses of the various datasets.

InformationITS trnL-F matK Combined
No. of taxa31313131
Aligned length688159017574035
No. variable characters196337411944
No. informative characters(%)114(16.6)159(10.0)156(8.9)429(10.6)
Tree length3474425521455
Consistency index0.68010.83480.83330.7331
Retention index0.75110.86850.78700.7216
Rescaled consistency index0.51080.72500.65590.5290
Indels836852
Table 2

Best-fit model and parameter for each dataset.

RegionAIC select modelBase frequenciessubstitution model(rate matrix)IG
ACGTA–CA–GA–TC–GC–TG–T
ITSTrN+I+G0.19510.30450.33010.17041.00004.11841.00001.00006.26801.00000.42160.9399
trnL-F TVM+I+G0.36610.13290.12250.37850.89270.95290.72900.12520.95291.00000.33690.7421
matK K81uf+I+G0.31100.16510.14710.37691.00001.22070.40740.40741.22071.00000.32900.8743
CombinedK81uf+I+G0.30980.17760.16800.34461.00001.62690.64500.64501.62691.00000.43920.7241
Table 3

Interspecific genetic distances of Holcoglossum clade based on combined datasets of ITS, trnL-F, and matK.

12345678910
1 H. rupestre -
2 H. flavescens 0.0050-
3 H. sinicum 0.00500.0067-
4 H. weixiense 0.00470.00630.0037-
5 H. quasipinifolium 0.01510.01790.01240.0148-
6 H. tsii 0.00530.00840.00700.00600.0131-
7 H. lingulatum 0.00970.01280.00800.00970.01410.0063-
8 H. omeiense 0.00970.01280.00800.00970.01410.00630.0000-
9 H. linearifolium 0.02370.02610.02400.02370.03130.02200.02780.0278-
10 H. nujiangense 0.01580.01750.01550.01510.02570.01550.02130.02130.0090-

ITS analysis

This analysis strongly supports Holcoglossum auriculatum as a sister to Papilionanthe teres and P. biswasiana, the posterior probabilities (PP) is 100%. Holcoglossum can be divided into three major clades. The first clade includes H. amesianum, H. subulifolium, H. kimballianum, and H. wangii and is a sister to the genus Papilionanthe (PP100%). Clade one consists of two groups, one including H. amesianum and H. subulifolium, and the other H. wangii and H. kimballianum. Division of the other species into the other two clades are well supported by Bayesian inference (BI) analysis (PP100%), with one clade including H. flavescens, H. rupestre, H. tsii, H. linearifolium (new species), and H. nujiangense, and the other including H. weixiense, H. quasipinifolium, H. omeiense, H. lingulatum, and H. sinicum. The relations of other closely related genera are well resolved except for the genus Aerides, and the relative species form several clades (see Supplementary Figs. S1, S2, S3).

Chloroplast trnL-F and matK data analyses

The consensus trees of trnL-F (see Supplementary Figs. S4, S5, S6) demonstrate that H. kimballianum and H. wangii are weakly supported as a sister to the genus Rhynchostylis (PP77%), and they are not included in the main clade of Holcoglossum. The main clade of Holcoglossum is divided into four subclades. The first subclade includes H. amesianum, H. subulifolium, and H. auriculatum; the second subclade includes H. omeiense and H. lingulatum; the third subclade includes H. tsii, H. weixiense, H. flavescens, and H. rupestre, and the fourth subclade consists of H. quasipinifolium, H. sinicum, H. linearifolium, and H. nujiangense. The BI and maximum likelihood (ML) trees yield the same topological structures, but H. tsii in the MP tree is included in the fourth subclade. The relations of other closely related genera are also well resolved except for Aerides, and the relative species formed several clades. The consensus trees of matK are less clear, but H. kimballianum and H. wangii are more closely related to Vanda than to any other species of Holcoglossum, and H. linearifolium and H. nujiangense are well supported as sisters to the genus Papilionanthe. (see Supplementary Figs. S7, S8, S9).

Morphological analyses

The morphological character matrix phylogenetic tree of Holcoglossum supports the division of Holcoglossum into three clades: the first clade consisting of H. kimballianum and H. wangii, the second consisting of H. amesianum, H. subulifolium and H. auriculatum, and the third including the remaining species of Holcoglossum.

Combined dataset analysis

In the present study, we also combined ITS, trnL-F, and matK into a single dataset. The strict consensus trees strongly support the division of Holcoglossum into three clades (PP100%). The first clade, consisting of H. kimballianum and H. wangii, is strongly supported as a sister to the genera Rhynchostylis and Vanda (PP100%). The second clade, consisting of H. amesianum, H. subulifolium, and H. auriculatum, is strongly supported as a sister to the first clade (PP100%). These two clades are not included in main clade of Holcoglossum. The last clade includes the remaining species of Holcoglossum (PP100%) and is further divided into three subclades or sections. The first subclade, Holcoglossum sect. Holcoglossum, consists of four species: H. tsii, H. quasipinifolium, H. omeiense, and H. lingulatum. The second subclade, H. sect. Sorotylos, also contains four species, H. rupestre, H. sinicum, H. flavescens, and H. weixiense, while the third, H. sect. Nujiangensia, consists of H. nujiangense and H. linearifolium. The latter subclade is well supported as a sister to the genus Papilionanthe (Fig. 1; Supplementary Figs. S10, S11).
Figure 1

Bayesian consensus trees based on the last 30,001 maximum likelihood trees for the combined datasets of ITS, trnL-F, and matK.

The Bayesian posterior probability (×100) is given below the branches.

Bayesian consensus trees based on the last 30,001 maximum likelihood trees for the combined datasets of ITS, trnL-F, and matK.

The Bayesian posterior probability (×100) is given below the branches. In the present study, we also combined molecular data and morphological characters in a single dataset. The BI consensus tree of this dataset has similar topology to that constructed from the combined data set from ITS, trnL-F, and matK analysis, but most of the clades and subclades are better delimited and more strongly supported (Fig. 2).
Figure 2

One phylogenetic tree of Bayesian inference consensus trees based on the last 30,001 maximum likelihood trees for the combined datasets of ITS, trnL-F, matK, and morphological characters matrix.

The Bayesian posterior probability (×100) is given near the node.

One phylogenetic tree of Bayesian inference consensus trees based on the last 30,001 maximum likelihood trees for the combined datasets of ITS, trnL-F, matK, and morphological characters matrix.

The Bayesian posterior probability (×100) is given near the node. Among the 14 analyzed species in six genera (Aeridinae), the species of five genera cluster together in the cladogram forming several related clades with the exception of one genus, Ascocentrum (A. ampullaceum), and two species, Aerides flabellata and Aerides odorata, which all cluster with Vanda forming the Vanda clade.

Genetic distance analyses

In general, the genetic distances (GD) between species within a genus are lower than those between intergeneric species. The mean genetic distance between all the species is 0.0311 when outgroups are included, and the value is 0.0245 when outgroups are excluded. Within Holcoglossum, most of the genetic distances between species are lower than 0.0200 (see Supplementary Table S1). The average genetic distance of all the species of Holcoglossum is 0.0154. In the Holcoglossum clade, the GD values between species are given in Table 3 (the mean genetic distance is 0.0137). The genetic distances between H. linearifolium and the other species are generally higher than distances between other species pairs, which strongly supports the treatment of H. linearifolium as a new species distinct from all known species.

Discussion

Data of ITS, trnL-F and matK analyses

In the present study, ITS, trnL-F, and matK were used to resolve the phylogenetic relationships within the genus Holcoglossum. We developed five sets of primers to sequence some difficult fragments, but there were still only partial fragments of the matK for three species (H. weixiense, H. rupestre, H. sinicum) (see Supplementary Table S2), and the fragments of the trnL-F for H. kimballianum and H. subulifolium have some differences from those reported in a previous study [9]. In the present study, the trnL-F of H. subulifolium lost 291 bp compared to the sequence described previously [9], so we used the previous sequence. We also used the new sequence in our analysis, however, and results in the combined dataset analysis were the same (see Supplementary Figs. S12, S13, S14). The fragments of H. kimballianum in the previous study [9] had one more insert (19 bp) than in our study, so both of them were used for the present analysis. Therefore, these five fragments were accessed from GenBank (see Supplementary Table S2). In total, the fragments we obtained were almost the same as those of Fan et al. [9], but longer (see Supplementary Table S2). In this study, we found that it was better to utilize ITS and trnL-F than matK to resolve interspecific relationships within the genus Holcoglossum, consistent with the previous study [9]. The ITS and trnL-F produced approximately equivalent tree topologies (see Fig. 1 and Supplementary Figs. S1, S2, S3, S4, S4, S6) that agreed with the main clades established by morphological characterization (see Supplementary Fig. S10). The consensus tree of matK showed inexact results (see Supplementary Figs. S7, S8, S9), which may be due to insufficient variations in the sequence of matK. Many studies had shown that at lower taxonomic levels (tribes and below), non-coding plastid markers (often the trnL intron and the trnL-F intergenic spacer) and ITS (ITS1-5.8S-ITS2) nuclear ribosomal DNA spacer [11] may yield better results than protein-coding genes such as rbcL [12], [13], matK [14], psaB [15], or ycf1 [16]. Conversely, at the family level, plastid protein-coding genes have been the primary focus, including as rbcL [12], [13], matK [14], psaB [15], and ycf1 [16]. Obviously this study focused on lower taxonomic levels (tribes and below), so it was reasonable that the consensus trees of matK showed inexact results. When a combined ITS, trnL-F, and matK dataset was used to analyze these relationships, however, the best tree topology was obtained, and was consistent with the delimitation based on their morphological characters. Using this combined dataset, most of the clades and subclades were better delimited and more strongly supported. From the present study, the matK fragments were still useful in helping to resolve the relationships below the generic rank when combined with ITS and trnL-F. In this study, phylogenetic analyses were performed under maximum likelihood (ML), maximum parsimony (MP), and Bayesian inference (BI) for each dataset. The BI, MP, and ML trees of each dataset had similar topological structures, meaning that the analysis had very good repeatability and that the experimental data were reliable. The differences between the BI, MP, and ML trees were the values of bootstrap percentages (BP) or posterior probabilities (PP) in each node; in general, the values in the BI tree were higher than that in MP and ML trees. In this paper, we will use the BI trees to demonstrate phylogenetic relationships between Holcoglossum and its allied genera. The MP and ML trees are presented in the Supplementary Information (see Supplementary Figs. S1, S2, S3, S4, S5, S6, S7, S8, S9, S10, S11, S12, S13, S14).

Phylogeny of Holcoglossum

In total, 15 Holcoglossum species, including a new one, were analyzed. Analysis of combined chloroplast and nuclear data strongly supported (PP100%) the tripartite division of Holcoglossum into the Holcoglossum clade, its sister clade, and a distant clade (Fig. 1 and Supplementary Figs. S10, S11, S12, S13, S14). Similar results were obtained by combining molecular data and morphological characters in a single dataset (Fig. 2). On these grounds, the trees of ITS (Supplementary Figs. S1, S2, S3), trnL-F (Supplementary Figs. S4, S5, S6) and the combinational dataset produced highly similar tree topologies. The main clades established were supported by these datasets. The phylogenetic relationships between Holcoglossum and allied genera were well resolved, and all data sets supported the division of Holcoglossum into three clades. Although the consensus trees of matK (Supplementary Figs. S7, S8, S9) showed inexact results, it supported the trees of trnL-F, showing that H. wangii and H. kimballianum form a new clade outside the Holcoglossum clade. The BI consensus trees of ITS, trnL-F, and combinational dataset were similar, but most of the clades and subclades were better delimited and more strongly supported by the combinational dataset, implying that combinational datasets may be better than single genes for phylogenetic analysis. From the tree of the combinational dataset, the Holcoglossum clade was a sister to Papilionanthe, a genus of some ten species, while H. subulifolium, H. auriculatum, H. amesianum, H. kimballianum, and H. wangii were not included in the Holcoglossum clade. They formed two clades outside the main Holcoglossum clade. In fact, H. kimballianum and H. wangii were more closely related to Vanda than to the main Holcoglossum clade in the trnL-F and matK dataset. Moreover, the clade sequences are considerably different from each other, especially in the trnL-F sequence. In order to explain the differences between them, we listed some obvious differences in the trnL-F aligned file (see Supplementary Figs. S15, S16, S17, S18 for details). This aligned file revealed that each of the three clades had their own unique characters and could be easily distinguished. In particular, H. kimballianum and H. wangii are quite distinct from the other species. Moreover, the phylogenetic relationships established between species in the three clades by analysis of morphological characters were strikingly similar to the relationships defined by the combined molecular data (Fig. 2). Therefore, we conclude that some species must be classified into two new genera, Tsiorchis and Paraholcoglossum, distinct from Holcoglossum. This conclusion may also be drawn from Jin [8] and Fan et al. [9], but they treated them only at subgeneric rank. As a result, Tsiorchis and Paraholcoglossum are proposed to be outside the Holcoglossum clade. Paraholcoglossum comprises three species, Paraholcoglossum subulifolium, P. auriculatum, and P. amesianum, while Tsiorchis consists of two species, Tsiorchis kimballiana and T. wangii. Holcoglossum includes the remaining ten species. The three genera show obvious morphological differences. In Holcoglossum, the white lip is conspicuously spurred at the base, with a crested or fleshy callus at the broad base of the mid-lobe, and the pollinia are porate and directly attached to a tapering stipe (see Supplementary Fig. S19). In Paraholcoglossum, the lip is shallowly saccate at the base, with a ridged callus at the entrance to the sac, and the mid-lobe is clawed at the base. The pollinia is porate in Paraholcoglossum, but the stipe is oblong, with both ends almost equal in width (see Supplementary Fig. S20). Tsiorchis is quite distinct from Holcoglossum and Paraholcoglossum, having a cleft, not a porate pollinia; each pollinium has a distinct caudicle attached to a common stipe; the mid-lobe of the lip is purple or has purple markings and the side-lobe is yellow with dark-purpled markings (see Supplementary Fig. S21). Within the genus Holcoglossum, the infrageneric system proposed by Jin [8] and Fan et al. [9] accurately reflect many interspecies relationships, though some changes are made in our system (Fig. 1, 2). We also analyzed the genetic distances between the sections of Holcoglossum. The average genetic distances between species in different sections are 0.0052 for H. sect. Holcoglossum, 0.0090 for H. sect. Sorotylos, and 0.0090 for H. sect. Nujiangensia. The genetic distances between sections are 0.0105 (H. sect. Holcoglossum and H. sect. Sorotylos), 0.0202 (H. sect. Holcoglossum and H. sect. Nujiangensia), and 0.0241 (H. sect. Nujiangensia and H. sect. Sorotylos) (see Supplementary Table S3). This result is consistent with topological analysis. The morphological characters and molecular evidence both support the division of Holcoglossum into three subclades (Figs. 1, 2). The first subclade, Holcoglossum sect. Holcoglossum, includes four species, H. tsii, H. quasipinifolium, H. omeiense and H. lingulatum, all of which are characterized by their mid-lobe of lip arising from the upper third of the spur, ligulate mid-lobe twice as long as the spur, mid-lobe with 2–7 lamellae adaxially (see Supplementary Fig. S19. a–c). The second subclade, Holcoglossum sect. Nujiangensia, is a new section with two species, H. nujiangense and H. linearifolium sp. nov., and is characterized by a mid-lobe of lip arising from the middle of the spur, obovate almost as long as the spur, and 3–5 crested lamellae extending down to the middle of the spur (see Supplementary Fig. S19. d, e). Holcoglossum sect. Nujiangensia is the immediate sister to Holcoglossum sect. Sorotylos and H. sect. Holcoglossum. The third subclade is Holcoglossum sect. Sorotylos, which includes four species: H. rupestre, H. sinicum. H. flavescens, and H. weixiense, all characterized by a lip with a shorter tapering spur and crest-like calli on the mid-lobe (see Supplementary Fig. S19. f, g). We also assessed the genetic distances between the individual species of main Holcoglossum clade. The mean interspecies genetic distance is 0.0137 (Table 3) and pair-wise distances range from 0.0000 (H. omeiense and H. lingulatum) to 0.0313 (H. linearifolium and H. quasipinifolium), while the genetic distances between H. linearifolium and other species range from 0.0090 to 0.0313, with a mean (0.0215) significantly higher than the average interspecific genetic distance within the genus Holcoglossum. The genetic distance between H. linearifolium and H. nujiangense is 0.0090, which is also much higher than that between most other species pairs, such as H. weixiense and H. sinicum (0.0037), H. tsii and H. rupestre (0.0053), or H. rupestre and H. weixiense (0.0047) (Table 3). Considering these molecular results as well as morphological characters, H. linearifolium is proposed as a new species that differs from its ally H. nujiangense by having a stem 4–5 cm long, filiform, soft leaves about 1 mm thick and often 30–40 cm long, side-lobes of lip narrowly ovate (not triangular), and mid-lobe obovate 8–10 mm in length. Among the 14 analyzed species in six genera (Aeridinae), the species of five genera cluster together in the cladograms forming several related clades. However Aerides flabellata, Aerides odorata, and Ascocentrum ampullaceum cluster together with Vanda to form the Vanda clade, probably due to some species missing partial fragments of trnL-F or matK region. (see Supplementary Table S2). Papilionanthe teres and P. biswasiana cluster together with the Holcoglossum sect. Nujiangensia. The results indicate that analysis of longer DNA sequences is helpful for resolving the relationships below generic rank.

Conclusion

In the present study, we investigated the phylogenetic relationships between Holcoglossum and allied genera, as well as the infrageneric classification of the genus Holcoglossum based on both morphological characters and molecular evidence. Holcoglossum is triphyletic and can be divided into two major sister clades and a distant clade. The three clades are regarded as three genera: Holcoglossum, Paraholcoglossum, and Tsiorchis. The latter two are published here as new genera. Paraholcoglossum includes three species and is related to Holcoglossum, but is quite distinct in many respects. Tsiorchis includes two species and is more closely related to Vanda than to Holcoglossum. The genus Holcoglossum itself comprises three subclades, all recognized here at sectional rank: H. sect. Holcoglossum with four species, H. sect. Sorotylos with four species and H. sect. Nujiangensia with two species (Fig. 1, 2). Taxonomic treatment Key to the genera, sections, and species of Paraholcoglossum, Tsiorchis, and Holcoglossum shown in Fig. 3.
Figure 3

Key to the genera, sections, and species of Paraholcoglossum, Tsiorchis, and Holcoglossum.

I. Z. J. Liu, S. C. Chen & L. J. Chen, gen. nov. [urn:lsid:ipni.org:names: 77113675–1] · Diagnosis. Genus novum Holcoglosso affine, a quo labello saccato prope basin, callo porcato ad marginem anticum oris sacci praedito, lobo intermedio unguiculato ad basin, stipite oblongo, ejus basi et apice aequilato. The new genus is akin to Holcoglossum, from which it differs by its lip saccate at base, with a ridged callus on the front margin of the sac mouth, mid-lobe clawed at base, and stipe oblong, with its base as wide as apex. · Description. Epiphytic plants. Stems often elongate. Leaves broadly subterete to terete, adaxially channeled. Inflorescence racemose or paniculate (with 1–2 branches), with several to many flowers; bracts much shorter than pedicellate ovary; flowers open widely; sepals and petals subsimilar; lateral sepals usually slightly larger; lip saccate at base, trilobed, with a ridged callus at the front margin of the sac mouth; mid-lobe clawed at base; column short, winged, with a very short but distinct foot; pollinia 2, waxy, globose, porate, attached by an oblong stipe to a broad viscidium. · Type: (Rchb. f.) Z. J. Liu, S. C. Chen & L. J. Chen 1. (Rchb. f.) Z. J. Liu, S. C. Chen & L. J. Chen, comb. nov. [urn:lsid:ipni.org:names: 77113676–1] · Type: Myanmar, Shan State, Herb. Reichenbach 37196 (holotype, W). Vanda amesiana Rchb. f. in Gard. Chron., ser. 3, 1: 764. 1887. Holcoglossum amesianum (Rchb. f.) Christenson in Notes Roy. Bot. Gard. Edinburgh 44: 255. 1987. · Distribution: China, India, Laos, Myanmar, Thailand, Vietnam. · Habitat: On tree trunks; 1200–2000 m. 2. (Rchb. f.) Z. J. Liu, S. C. Chen & L. J. Chen, comb. nov. [urn:lsid:ipni.org:names: 77113677–1] · Type: Myanmar, Herb. Reichenbach 37215 (holotype, W). Vanda subulifolia Rchb. f., Flora 69: 552. 1886. Vanda watsonii Rolfe in Gard. Chron. Ser. 3, 37: 82, 123. 1906. Holcoglossum subulifolium (Rchb. f.) Christenson in Notes Roy. Bot. Gard. Edinburgh 44: 255. 1987. · Distribution: China, Myanmar, Thailand, Vietnam. · Habitat: On tree trunks; 1300–2200 m. 3. (Z. J. Liu, S. C. Chen & X. H. Jin) Z. J. Liu, S. C. Chen & L. J. Chen, comb. nov. [urn:lsid:ipni.org:names: 77113678–1] · Type: China, NE Yunnan, Malipo, 16 May 2003, Z. J. Liu 2758 (holotype, NOCC!) Holcoglossum auriculatum Z. J. Liu, S. C. Chen & X. H. Jin in J. Wuhan Bot. Res., 23 (2):154–156. 2005. · Distribution: China, NE Yunnan (Malipo County). · Habitat: On tree trunks; 2200 m. · Note: This is a distinct species based on both molecular and morphological data. II. Z. J. Liu, S. C. Chen & L. J. Chen, gen. nov. [urn:lsid:ipni.org:names: 77113679–1] · Diagnosis. Genus novum Holcoglosso, Rhynchostyli et Vandae subsimile, differt a Holcoglosso polliniis fissis (non poratis) caudicula una distincta in quoque pollinio, labello purpureo-marmorato, calcari cylindrico, a Rhynchostyle foliis teretibus, labello trilobo lobis lateralibus conspicuis praedito, columna sine pede, stipite breviore latioreque, a Vanda foliis teretibus, caudicula praesenti, calcari cylindrico. The new genus is subsimilar to Holcoglossum, Rhynchostylis, and Vanda. It differs from Holcoglossum by its cleft (not porate) pollinia, each with a distinct caudicle, purple-mottled lip and cylindrical spur; from Rhynchostylis by its terete leaves, trilobed lip with conspicuous side-lobes at base, footless column and shorter and broader stipe; from Vanda by its terete leaves, distinct caudicle and cylindrical spur. · Description. Epiphytic plants. Stems often elongate. Leaves terete, adaxially channeled. Inflorescence racemose, often nodding, with many flowers; bracts small; flowers opening widely; dorsal sepal and petals subsimilar; lateral sepals slightly larger; lip with purple markings, trilobed, conspicuously spurred at base; spur long-cylindrical, mid-lobe suborbicular, not clawed at base; column footless; pollinia waxy, subglobose, cleft, each with a distinct caudicle attached by a common tapering stipe to a broad viscidium. · Type: (Rchb. f.) Z. J. Liu, S. C. Chen & L. J. Chen 1. (Rchb. f.) Z. J. Liu, S. C. Chen & L. J. Chen, comb. nov. [urn:lsid:ipni.org:names: 77113680–1] · Type: Myanmar, southern Shan States, Herb. Reichenbach 37216 (holotype, W). Vanda kimballiana Rchb. f. in Gard. Chron, ser. 3, 5: 232. 1889. Vanda saprophytica Gagnep. in Bull. Soc. Bot. Fr. 79:37, 1932. Holcoglossum saprophyticum (Gagnep.) Christenson in Not. Bot. Gard. Edinb. 44(2): 255. 1987. · Distribution: China (S Yunnan), Laos, Myanmar, Thailand, NW Vietnam. 2. (Christenson) Z. J. Liu, S. C. Chen & L. J. Chen, comb. nov. [urn:lsid:ipni.org:names: 77113681–1] · Type: China, Yunnan, Hort. Mountain. Orchids s.n. (holotype, K in spirit). Holcoglossum wangii Christenson in Lindleyana 13: 123. 1998. · Distribution: China, SW Guangxi and SE Yunnan. · Habitat: On tree trunks in broad-leaved evergreen forests; 800–1200 m. III. Schlechter in Repert, Spec. Nov. Regni Veg. Beih. 4: 285. 1919 · Description. Epiphytic plants. Stems short. Leaves many, distichous, terete, subterete, or broadly subterete, fleshy, adaxially channeled, jointed and dilated into sheathing base. Inflorescences axillary, racemose, with few to many flowers; rachis usually purple; flowers usually opening widely; sepals and petals subsimilar, usually ± carinate abaxially; lateral sepals often slightly larger, oblique; lip spurred, 3-lobed; lateral lobes erect beside entrance of spur, spotted; mid-lobe rather larger, often narrowed and with appendages at base; spur often cylindric and curved, attenuated toward tip, usually hispid-papillose inside. Column short, thick, winged, with a very short but distinct foot; pollinia 2, waxy, globose, porate, attached by a common, linear stipe to a broad viscidium. · Type: (Hayata) Schlechter. Holcoglossum sect. Holcoglossum 1. (Hayata) Schltr. In Fedde Repert. Sp. Nov. Beih. 4: 285. 1919. · Type: China, Taiwan, Mt. Arisan, Hayata & Sasaki s.n. (holotype, T). Saccolabium quasipinifolium Hayata, Icon. Pl. Formos, 2: 144. 1912. · Distribution: China, C Taiwan, Jiayi county and Xinju county. · Habitat: On tree trunks in mixed or coniferous forests; 1800–2800 m. 2. T. Yukawa in Ann. Tsukuba Bot. Gard. 19: 1. 2000. · Type: China, Yunnan, TNS 9512285 (holotype, Hort. Tsukuba Bot. Gard; isotype PE!) · Distribution: China, Yunnan, no precise locality. · Habitat: Unknown. 3. X. H. Jin et S. C. Chen in Kew Bull. 59: 633. 2005. · Type: China, Sichuan, Mt. Emei, K. H. Shing et K. Y. Lang 1365A (holotype, PE!) · Distribution: Known only from type locality. · Habitat: On tree trunks in open forest; 700–1000 m. 4. (Averyanov) Averyanov, Konsp. Sosud. Rast. Fl. Vetnama 1: 110. 1990. · Type: Vietnam, between Chapa and Hoan Lien Song, Takhtajan 0745 (holotype, LE). Holcoglossum kimballianum (Rchb. f.) Garay var. lingulatum Averyanov in Bot. Zhurn. (Mosow & Leningrad) 73: 426. 1988. Holcoglossum tangii Christenson in Lindleyana 13 (2): 121–124. 1999. syn. nov. · Distribution: China (SE Yunnan), Vietnam. · Habitat: On tree trunks in open forests; 1000–1400 m. Holcoglossum sect. Nujiangensia Z. J. Liu, S. C. Chen & L. J. Chen sect. nov. [urn:lsid:ipni.org:names: 77113682–1] · Diagnosis. Sectio nova Holcoglosso sect. Holcoglosso similis, a quo differt lobo intermedio labelli ad medium calcaris exorienti obovato calcari longiore. New section is similar to Holcoglossum sect. Holcoglossum, from which it differs by the mid-lobe of lip arising from the middle of the spur, obovate, longer than spur. · Type: X. H. Jin & H. Li 5. Z. J. Liu, S. C. Chen & L. J. Chen, sp. nov. [urn:lsid:ipni.org:names: 77113683–1] (Fig. 4 & Supplementary Fig. S22).
Figure 4

Holcoglossum linearifolium Z. J. Liu, S. C. Chen & L. J. Chen:

1. Flowering plant; 2. Flower, front view; 3. Flower, side view; 4. Lip and column, longitudinal section; 5. Dorsal sepal, petal and lateral sepal; 6. Pollinarium, front view and back view (Drawn by X. Y. Ma from type Z. J. Liu 4865).

Holcoglossum linearifolium Z. J. Liu, S. C. Chen & L. J. Chen:

1. Flowering plant; 2. Flower, front view; 3. Flower, side view; 4. Lip and column, longitudinal section; 5. Dorsal sepal, petal and lateral sepal; 6. Pollinarium, front view and back view (Drawn by X. Y. Ma from type Z. J. Liu 4865). · Type: China, Yunnan, Malipo, alt. 1600 m, 27 March 2010, Z. J. Liu 4865 (holotype, NOCC!); China, Yunnan, Malipo, alt. 1500, 28 March 2010, Z. J. Liu 4948 (NOCC!); China, Yunnan, Malipo, alt. 2000, 28 March 2010, Z. J. Liu 4950 (NOCC!). · Diagnosis. Species nova Holcoglosso nujiangensi similis, a quo differt caule 4–5 cm longo, foliis filiformibus mollibus ca. 1 mm in diam. saepe 30–40 cm longis, lobis lateralibus labelli anguste ovatis (non triangu), ejus lobo intermedio obovato 8–10 mm longo. New species is similar to Holcoglossum nujiangense, from which it differs by having a stem 4–5 cm long, filiform, soft leaves ca. 1 mm thick and often 30–40 cm long, side-lobes of lip narrowly ovate (not triangular), and mid-lobe obovate, 8–10 mm long. · Description. Epiphytic plants. Stem 4–5 cm long. Leaves 6–9, filiform, soft, pendent, with their base almost as wide as the apex, inconspicuously channeled adaxially, 30–40 cm long, ca. 1 mm thick, acuminate at apex, jointed and dilated into sheathing base. Raceme 1–2 cm long, with 2–3 flowers; floral bracts ovate, 5–7 mm long; flowers white; sepals and petals with purple-red midrib abaxially; lip with purple-red stripes on side-lobes; dorsal sepal elliptic, 10–11×4.5–5 mm, obtuse at apex; lateral sepals obliquely ovate-elliptic, 11–12.5×5.5–6 mm, subobtuse at apex; petals elliptic, 9.5–10.5×4.5–4.8 mm, rounded at apex; lip adnate to column foot, 3-lobed; side-lobes erect, narrowly ovate, 6–7×2.5–3 mm, acuminate at apex; mid-lobe arising from the middle of the spur, obovate, 8–10 mm long, rounded at apex, base with a very thick callus ridged-swollen on both sides; spur narrowly conical, 5–6 mm long, acuminate at the end; column 3–3.5 mm long, with a foot 1–1.5 mm long. Pollinia 2; stipe tapering. Flowering period: March and April. · Distribution: China, SE Yunnan (Malipo County). · Habitat: Epiphytic, pendulous, on tree trunks in broad-leaved forests, 1500–2000 m. 6. X. H. Jin & H. Li in Nordic J. Bot. 25: 127. 2008. · Type: China, Yunnan. Fugong, Jiakeding, 2400 m, 16 May 2005, X. H. Jin 6930 (PE). · Distribution: China, W Yunnan. · Habitat: On tree trunks in broad-leaved evergreen forests; 2500–3000 m. Holcoglossum sect. Sorotylos X. H. Jin & S. C. Chen 7. (Hand.-Mzt.) Garay in Bot. Mus. Leafl. 23 (4): 182. 1972. · Type: China, Yunnan, Zhongdian (now Sangrilla), Handel-Mazzett 8802 (holotype, W; isotypes Wu, E, K). Vanda rupestris Hand.-Mzt. in Anz. Akad. Wiss. Wien, Math.-Naturwiss. Kl. 62: 241. 1925. · Distribution: NW Yunnan, Sangrilla. · Habitat: On Quercus trunks and branches in mixed forests; 2000–2400 m. 8. Christenson in Notes. Roy. Bot. Gard. Edinburgh 44: 255. 1987. · Type: China, Yunnan, Yanbi, SEBC 380 (holotype, E; isotypes Kun, AMES). · Distribution: China, N Yunnan. · Habitat: On tree trunks in Alnus or Quercus forests; 2600–3200 m. 9. (Schltr.) Z. H. Tsi in Acta Phytotax. Sin. 20: 441. 1982. · Type: China, Yunnan, Yunpe, Simeon Ten 23 (holotype, BD). Aerides flavescens Schltr. in Fedde Rep. Sp. Nov. 19: 382. 1924. Saccolabium yunpeense T. Tang & F. T. Wang in Acta Phytotax. 1: 97. 1951. Papilionanthe flavescens (Schltr.) Garay in Bot. Mus. Leafl. Harvard Univ. 23 (4): 270. 1972. · Distribution: China, N Fujian, SW Hubei, SW Sichuan and N Yunnan. · Habitat: On tree trunks in broad-leaved evergreen forests; 1200–2700 m. 10. X. H. Jin & S. C. Chen, Syst. Gen. Holcoglossum: 94. 2003. · Type: China, Yunnan, Weixi, HK Kadoorie PT 3490 (holotype, PE). · Distribution: China, NW Yunnan. · Habitat: On tree trunks in broad-leaved forests along valleys; 2500–3000 m.

Materials and Methods

Materials

In total, 15 species of Holcoglossum were analyzed. Fourteen of them were sampled in this study, while one, H. tsii, was accessed from the GenBank. Fourteen additional species, representing six closely related genera, Aerides, Ascocentrum, Neofinetia, Papilionanthe, Rhynchostylis, and Vanda, were accessed from the GenBank and were treated as an ingroup in order to test the monophyly of Holcoglossum and to interpret its genetic relationships. Two African orchids of Vadeae, Jumellea sagittata, and Microterangis hariotiana, were chosen as outgroups [17], [18]. For information regarding the assessment, see Supplementary Table S2 for details.

Amplification and sequencing

Total DNA was extracted from fresh material or silica-gel-dried plant tissue with a Multisource Genomic DNA Miniprep Kit (Axygen Biosciences) following the manufacturer's instructions. The amplification reaction included total DNA, primers, Ex-Taq buffer, and Ex-Taq DNA polymerase (Takara Bio). The polymerase chain reaction (PCR) profile consisted of an initial 5 min pre-melt stage at 95°C, then 30 cycles of 30 s at 95°C (denaturation), 30 s at 50–55°C (annealing temperature was determined by primer's need), and 1–3 min at 72°C (extension time was determined by length of the aim DNA region), followed by a final 10 min extension at 72°C. The amplification of the ITS region was performed using the primer pairs ITS A and ITS B [19]. The trnL-F region was amplified with primers c and f [20] or two sets of primers developed specifically for this study (Table 4). For matK sequences, amplification was performed using the primer pair matK-19F and trnK-2R [19], and some fragments were amplified using three sets of primers developed for this study (Table 4). To check the quality of the amplified DNA, PCR products were run on 1.5% agarose gels. The gels with target products were excised, purified using DNA Gel Extraction Kits (Axygen Biosciences), and sequenced by BGI Americas Corporation.
Table 4

Primers used in this study.

PrimerSequence (5′→3′)Origin
ITS A GGAAGGAGAAGTCGTAACAAGG other
ITS B CTTTTCCTCCGCTTATTGATATG other
trnL-C CGAAATCGGTAGACGCTACG other
trnL-F ATITGAACTGGTGACACGAG other
trnL-C-70F CAAATTCAGAGAAACCCTGGA this study
trnL-F-60R CCATTTCCCGTGCATCATCCTA this study
trnL-MF TAAAGAGAGAGTCCCATTTTAC this study
trnL-MR GAGCGAGGAAGTAAAATGGGC this study
trnK-2R AACTAGTCGGATGGAGTAG other
matK-19F CGTTCTCATATTGCACTATG other
matK-1867R TTGCAGTTTTCATTGCACACG this study
matK-147F AACAAAACTTCCTATATCCGCT this study
matK-1167R CATTTGATTTCTTACTACC this study
matK-1149F GGTAGTAAGAAATCAAATG this study
matK-969R CTTTTCCTTGATATCGAACAT this study
matK-731F AAGAAAAGATTCTTTTGGTTCC this study

Sequences editing and assembling

Both forward and reverse sequences and electropherograms were edited and assembled with DNASTAR (http://www.dnastar.com/). DNA sequences were aligned with MEGA5.05 [21] under the Muscle model and then adjusted manually with MEGA5.05 [21]. Aligned sequences are available from the corresponding authors upon request. To explore the phylogenetic positions of the Holcoglossum alliance by morphological classification, we constructed a morphological character matrix consisting of 41 characters of 31 taxa (see Supplementary Morphological Character Codes S1and Table S4 for details).

Data analyses

The datasets included ITS, matK, trnL-F, and morphological characters, a combination of ITS, matK and trnL-F, and a combination of all four. Insertions, deletions, and some unavailable sequences were treated as missing. Phylogenetic analyses were performed under maximum likelihood (ML), maximum parsimony (MP), and Bayesian inference (BI). The best fit model for each dataset was selected by Modeltest 3.7 [22] under the Akaike Information Criterion (AIC)(see the Table 3 for the detail). The MP analyses were performed using PAUP* version 4.0b10 [23]. All characters were equally weighted and unordered. Test settings included 1,000 replications of random addition sequence and heuristic search with tree bisection-reconnection (TBR) branch swapping. The length of tree, consistency indices (CI), and retention indices (RI) are given in Table 2. The ML analysis was computed by RAxML version 7.2.8 with 100 bootstrap replicates and settings as described in Stamatakis et al. [24]. BI analysis was performed using MrBayes 3.1.2 [25]. The best-fit model for each dataset was selected by Modeltest 3.7. In the combined dataset of ITS, matK and trnL-F, the model was also according to the best fit model for each individual dataset. The following settings were applied: sampling frequency = 100; temp = 0.1; burn-in = 10,000; and the number of Markov chain Monte Carlo (MCMC) generations = 4,000,000. The first 10,000 trees were discarded as burn-in to ensure that the chains reached stationarity. Majority-rule consensus tree was constructed on those trees sampled after generation 1,000,000. We also utilized MEGA5.05 [21] to estimate genetic distances between the species and sections of Holcoglossum treated under the Tajima-Nei model based on the combined molecular dataset.

Nomenclature

The electronic version of this document in itself does not represent a published work according to the International Code of Botanical Nomenclature [26], and hence the new names contained in the electronic version are not effectively published under that Code from the electronic edition alone. Therefore, a separate edition of this document was produced by a method that assures numerous identical printed copies, and those copies were simultaneously distributed (on the publication date noted on the first page of this article) for the purpose of providing a public and permanent scientific record, in accordance with Article 29 of the Code. Copies of the print-only edition of this article were distributed on the publication date to botanical or generally accessible libraries of the following institutions (BM, COL, GH, HUA, K, MEXU, MO, NY, QCA, QCNE, USM). The separate print-only edition is available on request from PLoS (Public Library of Science) by sending a request to PLoS ONE, Public Library of Science, 1160 Battery Street, Suite 100, San Francisco, CA 94111, USA along with a check for $10 (to cover printing and postage) payable to “Public Library of Science”. In addition, new names contained in this work have been submitted to IPNI, from where they will be made available to the Global Names Index. The IPNI LSIDs (Life Science Identifiers) can be resolved and the associated information viewed through any standard web browser by appending the LSID contained in this publication to the prefix http://ipni.org/. The online version of this work is archived and available from the following digital repositories: PubMedCentral (www.pubmedcentral.nih.gov/). Bayesian consensus trees based on the last 30,001 maximum likelihood trees for ITS. The Bayesian posterior probability (×100) is given below the branches. (TIF) Click here for additional data file. The maximum likelihood (ML) trees of ITS computed by RAxML with 100 bootstrap replicates. The bootstrap values are given below the branches. (TIF) Click here for additional data file. Strict consensus tree of most parsimonious trees based on of ITS sequence data. Tree length = 347 steps, CI = 0.6801, RI = 0.7511. The bootstrap values of the maximum parsimony analysis are given below the branches. (TIF) Click here for additional data file. Bayesian consensus trees based on the last 30,001 maximum likelihood trees for . The Bayesian posterior probability (×100) is given below the branches. (TIF) Click here for additional data file. The maximum likelihood (ML) trees of , computed by RAxML with 100 bootstrap replicates. The bootstrap values are given below the branches. (TIF) Click here for additional data file. Strict consensus tree of most parsimonious trees based on of sequence data. Tree length = 442 steps, CI = 0.8348, RI = 0.8685. The bootstrap values of the maximum parsimony analysis are given below the branches. (TIF) Click here for additional data file. Bayesian consensus trees based on the last 30,001 maximum likelihood trees for . The Bayesian posterior probability (×100) is given below the branches. (TIF) Click here for additional data file. The maximum likelihood (ML) trees of , computed by RAxML with 100 bootstrap replicates. The bootstrap values are given below the branches. (TIF) Click here for additional data file. Strict consensus tree of most parsimonious trees based on sequence data. Tree length = 552 steps, CI = 0.8333, RI = 0.7870. The bootstrap values of the maximum parsimony analysis are given below the branches. (TIF) Click here for additional data file. The maximum likelihood (ML) trees of ITS, and , computed by RAxML with 100 bootstrap replicates. The bootstrap values of are given below the branches. (TIF) Click here for additional data file. Strict consensus tree of most parsimonious trees based on the combined datasets of ITS, and . Tree length = 1455 steps, CI = 0.7331, RI = 0.7216. The bootstrap values of the maximum parsimony analysis are given below the branches. (TIF) Click here for additional data file. Bayesian consensus trees based on the last 30,001 maximum likelihood trees for ITS, and , re-sequences in this study was included. The Bayesian posterior probability (×100) is given below the branches. (TIF) Click here for additional data file. The maximum likelihood (ML) trees of ITS, and , computed by RAxML with 100 bootstrap replicates, re-sequences in this study were included. The bootstrap values are given below the branches. (TIF) Click here for additional data file. Strict consensus tree of most parsimonious trees based on the combined datasets of ITS, and , re-sequences in this study was included. Tree length = 1471 steps, CI = 0.7294, RI = 0.7244. The bootstrap values of the maximum parsimony analysis are given below the branches. (TIF) Click here for additional data file. Alignment of : sites . The species name suffix with “DL” mean the sequences originate from Fan's paper. (TIF) Click here for additional data file. Alignment of : sites . The species name suffix with “DL” mean the sequences originate from Fan's paper. (TIF) Click here for additional data file. Alignment of : sites . The species name suffix with “DL” mean the sequences originate from Fan's paper. (TIF) Click here for additional data file. Alignment of : sites . The species name suffix with “DL” mean the sequences originate from Fan's paper. (TIF) Click here for additional data file. . a–c. H. quasipinifolium (genus and H. section Holcoglossum type): a. Inflorescence; b. Flower, side view; c. Pollinarium. d–e. H. nujiangense (H. section Nujiangensia type): d. Inflorescence; e. Flower, side view. f–g. H. sinicum (H. section Sorotylos type): f. Inflorescence; g. Flower, side view. (TIF) Click here for additional data file. . a–d. P. amesianum (genus type): a. Flowers; b. Lip and column, side view; c. Pollinarium, front view; d. Pollinarium, back view; e–f. P. subulifolium: e. Flowers, front view; f. Flower, side view; g–h. P. auriculatum: g. Flower, longitudinal section; h. Flower, side view. (TIF) Click here for additional data file. a–d. T. kimballiana (genus type): a. Flowers; b. Lip and column, side view; c. Pollinarium, front view; d. Pollinarium, back view. e–h. T. wangii: e. Inflorescence; f. Flower, side view; g. Pollinarium, front view; h. Pollinia, back view. (TIF) Click here for additional data file. a. Natural habitat in SW Yunnan; b. Growing on tree trunk; c, d. Flowers. (TIF) Click here for additional data file. (DOC) Click here for additional data file. Pair-wise genetic distance of all species based on combined datasets of ITS, trnL-F, and matK. (DOC) Click here for additional data file. Samples used in the gene sequencing and their information. (DOC) Click here for additional data file. Genetic distances between sections of the Holcoglossum clade. (DOC) Click here for additional data file. Morphological data matrix for the phylogenetic analysis. (DOC) Click here for additional data file.
  11 in total

1.  MrBayes 3: Bayesian phylogenetic inference under mixed models.

Authors:  Fredrik Ronquist; John P Huelsenbeck
Journal:  Bioinformatics       Date:  2003-08-12       Impact factor: 6.937

2.  Molecular phylogenetics of subtribe Aeridinae (Orchidaceae): insights from plastid matK and nuclear ribosomal ITS sequences.

Authors:  Hidayat Topik; Tomohisa Yukawa; Motomi Ito
Journal:  J Plant Res       Date:  2005-07-16       Impact factor: 2.629

3.  Universal primers for amplification of three non-coding regions of chloroplast DNA.

Authors:  P Taberlet; L Gielly; G Pautou; J Bouvet
Journal:  Plant Mol Biol       Date:  1991-11       Impact factor: 4.076

4.  A rapid bootstrap algorithm for the RAxML Web servers.

Authors:  Alexandros Stamatakis; Paul Hoover; Jacques Rougemont
Journal:  Syst Biol       Date:  2008-10       Impact factor: 15.683

5.  MODELTEST: testing the model of DNA substitution.

Authors:  D Posada; K A Crandall
Journal:  Bioinformatics       Date:  1998       Impact factor: 6.937

6.  MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods.

Authors:  Koichiro Tamura; Daniel Peterson; Nicholas Peterson; Glen Stecher; Masatoshi Nei; Sudhir Kumar
Journal:  Mol Biol Evol       Date:  2011-05-04       Impact factor: 16.240

7.  Molecular phylogenetics of Vandeae (Orchidaceae) and the evolution of leaflessness.

Authors:  Barbara S Carlsward; W Mark Whitten; Norris H Williams; Benny Bytebier
Journal:  Am J Bot       Date:  2006-05       Impact factor: 3.844

8.  Phylogenetic relationships within Orchidaceae based on a low-copy nuclear coding gene, Xdh: Congruence with organellar and nuclear ribosomal DNA results.

Authors:  Marcin Górniak; Ovidiu Paun; Mark W Chase
Journal:  Mol Phylogenet Evol       Date:  2010-03-06       Impact factor: 4.286

9.  An expanded plastid DNA phylogeny of Orchidaceae and analysis of jackknife branch support strategy.

Authors:  John V Freudenstein; Cássio van den Berg; Douglas H Goldman; Paul J Kores; Mia Molvray; Mark W Chase
Journal:  Am J Bot       Date:  2004-01       Impact factor: 3.844

10.  A phylogenetic analysis of the Orchidaceae: evidence from rbcL nucleotide.

Authors:  K M Cameron; M W Chase; W M Whitten; P J Kores; D C Jarrell; V A Albert; T Yukawa; H G Hills; D H Goldman
Journal:  Am J Bot       Date:  1999-02       Impact factor: 3.844

View more
  5 in total

1.  The anther steps onto the stigma for self-fertilization in a slipper orchid.

Authors:  Li-Jun Chen; Ke-Wei Liu; Xin-Ju Xiao; Wen-Chieh Tsai; Yu-Yun Hsiao; Jie Huang; Zhong-Jian Liu
Journal:  PLoS One       Date:  2012-05-23       Impact factor: 3.240

2.  Systematic significance of leaf epidermal features in holcoglossum (orchidaceae).

Authors:  Jie Fan; Runli He; Yinbo Zhang; Xiaohua Jin
Journal:  PLoS One       Date:  2014-07-01       Impact factor: 3.240

3.  Complete plastid genome of Holcoglossum tsii (Orchidaceae, Aeridinae) and phylogenetic analysis.

Authors:  Yong-Bin Chen; Ming Xie; Sheng-Ting Guo; Xiao-Yong Zheng; Heng Li
Journal:  Mitochondrial DNA B Resour       Date:  2019-12-18       Impact factor: 0.658

4.  A new molecular phylogeny and a new genus, Pendulorchis, of the Aerides-Vanda alliance (Orchidaceae: Epidendroideae).

Authors:  Guo-Qiang Zhang; Ke-Wei Liu; Li-Jun Chen; Xin-Ju Xiao; Jun-Wen Zhai; Li-Qiang Li; Jing Cai; Yu-Yun Hsiao; Wen-Hui Rao; Jie Huang; Xue-Yong Ma; Shih-Wen Chung; Lai-Qiang Huang; Wen-Chieh Tsai; Zhong-Jian Liu
Journal:  PLoS One       Date:  2013-04-05       Impact factor: 3.240

5.  Monophyly or paraphyly--the taxonomy of Holcoglossum (Aeridinae: Orchidaceae).

Authors:  Xiaoguo Xiang; Dezhu Li; Xiaohua Jin; Hao Hu; Hailang Zhou; Weitao Jin; Yangjun Lai
Journal:  PLoS One       Date:  2012-12-14       Impact factor: 3.240

  5 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.