Literature DB >> 23577083

A new molecular phylogeny and a new genus, Pendulorchis, of the Aerides-Vanda alliance (Orchidaceae: Epidendroideae).

Guo-Qiang Zhang1, Ke-Wei Liu, Li-Jun Chen, Xin-Ju Xiao, Jun-Wen Zhai, Li-Qiang Li, Jing Cai, Yu-Yun Hsiao, Wen-Hui Rao, Jie Huang, Xue-Yong Ma, Shih-Wen Chung, Lai-Qiang Huang, Wen-Chieh Tsai, Zhong-Jian Liu.   

Abstract

BACKGROUND: The Aerides-Vanda alliance is a complex group in the subtribe Aeridinae (subfamily Epidendroideae, Orchidaceae). Some phylogenetic systems of this alliance have been previously proposed based on molecular and morphological analyses. However, several taxonomic problems within this alliance as well as between it and its allies remain unsolved. METHODOLOGY/PRINCIPAL
FINDINGS: We utilized ITS and five plastid DNA regions in this phylogenetic analysis. Consensus trees strongly indicate that the Aerides-Vanda alliance is monophyletic, and the 14 genera of this alliance can be grouped into the following clades with 14 subclades: 1. Aerides, comprising two subclades: Rhynchostylis and Aerides; 2. Ascocentropsis; 3. Papilionanthe; 4. Vanda, comprising five subclades: Neofinetia, Christensonia, Seidenfadenia, Ascocentrum, and Vanda-Trudelia, in which Vanda and Trudelia form a subclade; 5. Tsiorchis, comprising three subclades: Chenorchis, Tsiorchis, and two species of Ascocentrum; 6. Paraholcoglossum; and 7. Holcoglossum. Among the 14 genera, only Ascocentrum is triphyletic: two species of the Ascocentrum subclade, an independent subclade Ascocentrum subclade in the Tsiorchis clade; the Ascocentrum subclade in the Vanda clade; and one species in the Holcoglossum clade. The Vanda and Trudelia species belong to the same subclade. The molecular conclusion is consistent with their morphological characteristics.
CONCLUSIONS: We elucidate the relationship among the 14 genera of the Aerides-Vanda alliance. Our phylogenetic results reveal that the Aerides-Vanda alliance is monophyletic, but it can be divided into 14 genera. The data prove that Ascocentrum is triphyletic. Plants with elongate-terete leaves and small flowers should be treated as a new genus, Pendulorchis. Saccolabium himalaicum (Ascocentrum himalaicum) should be transferred to Pendulorchis. Ascocentrum pumilum, endemic to Taiwan, should be transferred to Holcoglossum. A new combination, Holcoglossum pumilum, was also established. Trudelia should not be recognized as an independent genus. Two new species, Pendulorchis gaoligongensis and Holcoglossum singchianum, were described as well.

Entities:  

Mesh:

Substances:

Year:  2013        PMID: 23577083      PMCID: PMC3618120          DOI: 10.1371/journal.pone.0060097

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Orchidaceae is possibly the largest family of angiosperms with almost 25 000 species. The traditional typological classification divides Orchidaceae into Apostasioideae, Cypripedioideae, Spiranthoideae, Orchidoideae, and Epidendroideae [1]. Recently, Spiranthoideae has been integrated into Orchidoideae, where a new subfamily Vanilloideae was established [2] based on the affinity analysis of internal transcribed spacer (ITS), trnL-F, and matK sequences. Epidendroideae is a subfamily that accounts for more than 80% of the orchid species. The AeridesVanda alliance described in this study is a member of the subtribe Aeridinae and an advanced but complex group in Epidendroideae. Tsi [3] and Christenson [4]–[7] identifiedthe AeridesVanda alliance by a comparative analysis of Holcoglossum and its allied genera, such as Vanda, Papilionanthe, Ascocentrum, Aerides, Rhynchostylis, Seidenfadenia, Trudelia [8], and Neofinetia. Subsequently, the following genera were established within the alliance: Christensonia [9], Chenorchis [10], Paraholcoglossum [11], Tsiorchis [11], and Ascocentropsis [12]. Consequently, 14 genera were included in the alliance. However, the AeridesVanda alliance is somewhat ambiguous in taxonomic literature, i.e., the same species may be classified under different genera [2], [13]. This confusion arises from using partly overlapping morphological characteristics to distinguish one genus from another. Similarly, Seidenfaden [14] pointed out that “The difficulties arise because we again and again meet with species that can be accommodated in a genus only by widening such a generic circumscription until the situation becomes completely blurred.” Christenson [4] conducted a branch analysis of this alliance (excluding Neofinetia and genera subsequently established) using 11 features, and divided the AeridesVanda alliance into two branches. One branch comprises Vanda and Ascocentrum, and the other branch includes Holcoglossum, Papilionanthe, Aerides, Rhynchostylis, and Seidenfadenia. The latter branch is further divided into the three sub-branches, namely, Aerides, Papilionanthe, and HolcoglossumRhynchostylis–Seidenfadenia subclades. In the AeridesVanda alliance, Garay [15] placed Papilionanthe between Vanda and Aerides, but it is more closely linked to Aerides. By contrast, Jin [16] considered Vanda as a relatively primal genus of this alliance. The members of Ascocentrum considerably differ in the shapes of their leaves, which can be divided into two types: subterete and nearly lorate leaves. Based on the morphological analysis of the mid-lobe of the lip, stipe, and spur of this genus, Jin [16] stated that Ascocentrum maybe grouped between Aerides and Seidenfadenia because the bilobed uplifted rostellum is unique to Ascocentrum and Seidenfadenia in the AeridesVanda alliance, and the leaves of some Ascocentrum species are similar to those of Seidenfadenia. However, Christenson [4] classified Ascocentrum under the same branch where Vanda belongs because of its notch-tipped leaves. This finding indicates that the Ascocentrum species with terete leaves do not belong to the VandaAscocentrum branch. Christenson [4] inferred that Holcoglossum and Seidenfadenia are two parallel evolutive branches, whereas Jin [16] considered Seidenfadenia to be more evolutive because of the special structure of its spur and rostellum. Most Seidenfadenia, Holcoglossum, and Ascocentrum species have closely similar vegetative organs, specifically, a very short stem and subterete leaves with a ventrally longitudinal groove. Their distribution areas usually overlap with one another, and they have very similar habits. However, the floral structures of these three genera are distinct, particularly their rostellum, pollinia, and stipe. The vegetative comparison in these three genera can be considered as their adaptation to similar habitats [16]. Given that this finding is only a speculation, molecular confirmation is still necessary. Rhynchostylis is relatively close to Vanda in terms of its morphological structures, including its robust habit, entirely or slightly trilobed labellum, bilaterally compressed spur with its apex pointing backward, and two cleft pollinia. This species is a relatively primitive genus in the AeridesVanda alliance. However, its stipe is long and narrows downwards, which make it appear specialized. Christenson [4] performed the initial branch analysis of the AeridesVanda alliance and stated that the generic relation of this alliance may have undergone considerable changes after thoroughly researching each genus. The character status of some genera has changed, but some rather ambiguous genera are reclassified. For example, although Holcoglossum is polymorphic, it has been treated as a single genus until recently [17]–[19]. However, Liu et al. [11] divided the Holcoglossum alliance into three genera, namely, Holcoglossum, Tsiorchis, and Paraholcoglossum, based on further molecular and morphological analyses of more taxa under this alliance and its allied groups. The two new genera were treated by Jin [18] and Fan et al. [19] as either subgeneric or sectional rank. Although some molecular and morphological systems of this alliance have been proposed in previous studies [2], [20], the relationships among the members of this alliance are unclear. Two species of Papilionanthe have been placed in the section Nujiangensia of Holcoglossum after molecular analysis [11]. Thus, to seek clarification of the AeridesVanda alliance phylogenetically, molecular and morphological analyses of more species are necessary. The two recently published genera, Ascocentropsis and Chenorchis, which genetically belong to the AeridesVanda alliance, are both monotypic. Ascocentropsis has been established based on Ascocentrum pusillum [12], whereas Chenorchis is perceived to be genetically related to Holcoglossum and Ascocentrum [10]. In this study, we focused on improving the sampling of the AeridesVanda alliance to facilitate a more accurate reconstruction of the phylogenetic relationships. We collected specimens of 68 species under the 14 genera of the AeridesVanda alliance and its three allied genera, with emphasis on Holcoglossum, Paraholcoglossum, Tsiorchis, Chenorchis, Ascocentrum, Neofinetia, Seidenfadenia, Christensonia, Trudelia, and Ascocentropsis. Based on the molecular and morphological analyses, we provided a well-supported phylogenetic resolution for the placement of the 14 genera in the AeridesVanda alliance.

Results

The DNA sequences of 70 taxa, including 68 species of 17 allied genera and two species of Cymbidium as outgroup, were obtained and analyzed. The DNA sequences of all species of Holcoglossum, three species of Paraholcoglossum, two species of Tsiorchis, six species of Ascocentrum and one new species similar to Ascocentrum himalaicum, one species of Chenorchis, three species of Neofinetia, six species of Vanda, two species of Papilionanthe, and three species of Aerides were newly obtained, and other species were accessed from GenBank. Tables 1 and 2 provide the detailed sequence information, aligned length, numbers of variable sites, parsimony informative sites, tree statistics for maximum parsimony (MP) analysis, and the best-fit model selected by Modeltest.
Table 1

Statistics from the analysis datasets.

InformationNo. of taxaAligned lengthNo. variablecharactersNo. informativecharacters (%)TreelengthConsistencyindexRetentionindex
ITS67736379236(32.1%)9910.55500.7442
matK681640359186(11.3%)5890.70290.7528
trnL-F621541395221(14.3%)6430.73720.8126
psbA-trnH42102510653(5.2%)1270.87400.8621
atpI-atpH39886223176(19.9%)2680.90670.9351
trnS-trnfM39112211065(5.8%)1340.88810.9198
cpDNA6862141193701(11.3%)18850.72200.7720
Combined7069501572937(13.5%)29650.64450.7379
Table 2

Best-fit model and parameter for the analysis datasets.

RegionAIC selectmodelBase frequenciessubstitution model(rate matrix)IG
ACGTA-CA-GA-TC-GC-TG-T
ITSGTR+I+G0.17170.32550.36160.14111.00953.45400.99490.59394.42651.00000.21850.9418
matKGTR+I+G0.32290.15320.14240.38141.05761.25200.14810.49031.00831.00000.41530.9585
trnL-FTVM+I+G0.36830.12220.12920.38021.25741.15530.77850.13621.15531.00000.36450.3229
psbA-trnHGTR+I+G0.32820.15480.16060.35631.02750.91660.80450.14120.29591.00000.75430.7690
atpI-atpHK81uf+G0.35340.12670.18120.33871.00001.09520.29830.29831.09521.00000.00001.4207
trnS-trnfMK81uf+G0.34090.16660.14570.34691.00001.63690.45140.45141.63691.00000.00000.2414
cpDNAGTR+I+G0.33880.15080.15180.35870.95601.17650.54840.24590.94561.00000.54160.7061
CombinedTIM+I+G0.31570.17570.17860.33011.00001.78550.59760.59761.56321.00000.48650.5983

ITS Analysis

A total of 67 taxa were analyzed. Most genera form independent clades or subclades. The generic relationships are mostly well resolved. However, the phylogenetic positions of some species are unclear, such as those of Paraholcoglossum auriculatum, Seidenfadenia mitrata, Rhynchostylis gigantean, Rhynchostylis retusa, and Aerides odorata. Figs. S1, S2, and S3 provide the detailed results.

Chloroplast DNA Analysis

In this analysis, chloroplast DNA (cpDNA), including trnL-F, matK, psbA-trnH, atpI-atpH, and trnS-trnfM regions were combined as a dataset for analysis. A total of 68 taxa were analyzed. Most genera form independent clades or subclades. The generic relationships are mostly well resolved. However, the position of Papilionanthe hookeriana and the phylogenetic relationships of Ascocentrum, Christensonia and Seidenfadenia mitrata are unclear. Figs. S4. S5, and S6 provide the detailed results.

Combined Dataset Analysis

We also combined all datasets into a single dataset for the phylogenetic analysis of the AeridesVanda alliance. The strict consensus trees strongly suggest that the AeridesVanda alliance is monophyletic, and the 14 genera under this alliance can be divided into the following 7 clades with 14 subclades: 1. Aerides, comprising two subclades: Rhynchostylis and Aerides; 2. Ascocentropsis; 3. Papilionanthe; 4. Vanda, comprising five subclades: Neofinetia, Christensonia, Seidenfadenia, Ascocentrum, and Vanda; 5. Tsiorchis, comprising three subclades: Chenorchis, Tsiorchis, as well as one species of Ascocentrum and one new species, Pendulorchis gaoligongensis; 6. Paraholcoglossum; and 7. Holcoglossum. Among these clades, only Ascocentrum is triphyletic and comprises two subclades. One is the Ascocentrum subclade that is related to the Seidenfadenia subclade; the other is the Ascocentrum himalaicum and Pendulorchis gaoligongensis form an independent subclade that is much more closely related to Tsiorchis than to Ascocentrum subclade. Another species, Ascocentrum pumilum, should be transferred to the Holcoglossum clade. Trudelia species do not form an independent subclade but belong to the Vanda subclade. The molecular conclusion is consistent with their morphological characteristics. Fig. 1 provide the detailed results.
Figure 1

Phylogram obtained from Bayesian inference analysis of the combined nrDNA ITS and cpDNA data.

Numbers near the nodes are Bayesian posterior probabilities (×100) and bootstrap percentages (PP left, BBML middle, BBMP right), respectively. “–” indicates that the node was not supported in ML and MP analysis.

Phylogram obtained from Bayesian inference analysis of the combined nrDNA ITS and cpDNA data.

Numbers near the nodes are Bayesian posterior probabilities (×100) and bootstrap percentages (PP left, BBML middle, BBMP right), respectively. “–” indicates that the node was not supported in ML and MP analysis.

Discussion

Data Analysis

In this study, six DNA regions were utilized, including one nuclear (ITS) and five plastid (trnL-F, matK, psbA-trnH, atpI-atpH, and trnS-trnfM) regions. The results show that most phylogenetic relationships based on ITS agree with the plastid datasets and their combination, but some genera such as Rhynchostylis, Siedenfadenia and Paraholcoglossum appear to have some different phylogenetic relationships between ITS and plastid data. Such differences may result from intergeneric hybridization or introgression at some point during the evolution of these genera, which should need further study to testify. We performed an incongruence length difference test between ITS with cpDNA, and the result shows incongruence to a certain extent between the ITS and plastid regions (P = 0.01), but it did not affect the whole phylogenetic relationship. In fact, different genes (including ITS and cpDNA) are incongruent in many cases. Different genes are known to have different evolutionary rates and can provide different evolutionary information. Thus, we need to use more than one gene to assess their phylogenetic relationship because of their incongruence. Based on our experience and those of other researchers, the obtained phylogenetic relationship is better when more genes are used. The combination dataset still produced the best trees. Among them (Fig. 1), most species belong to their phylogenetic clades or subclades and most nodes have good support. Therefore, we believe that combining a nuclear ITS and plastid regions to solve the phylogenetic relationship is appropriate.

Overall Tree and Effect of Taxon Sampling

The phylogenetic analyses identified the following seven major clades: 1. Aerides, comprising two subclades: Rhynchostylis and Aerides; 2. Ascocentropsis, monotypic; 3. Papilionanthe, comprising four species; 4. Vanda, comprising five subclades, Neofinetia, Christensonia, Seidenfadenia, four species of Ascocentrum, and Vanda; 5. Tsiorchis, comprising three subclades: Chenorchis, Tsiorchis, as well as two species of Ascocentrum and Pendulorchis gaoligongensis (PP 1.00, BSML 100 and BSMP 97); 6. Paraholcoglossum; and 7. Holcoglossum, comprising all species of Holcoglossum and one species of Ascocentrum (PP 1.00, BSML 95 and BSMP 63). Among the 14 genera, only Ascocentrum is triphyletic and comprises three subclades. First is the Ascocentrum subclade that is related to the Seidenfadenia subclade; second is the Ascocentrum himalaicum and Pendulorchis gaoligongensis form an independent subclade that is much more closely related to Tsiorchis than to Ascocentrum; and third is a species, Ascocentrum pumilum, that should be transferred to the Holcoglossum clade. The parsimony, maximum likelihood, and Bayesian approaches for the combined dataset result in similar tree topologies, with the identification of seven well-supported major clades (Fig. 2). This topology partially agrees with the proposal of Liu et al. [11].
Figure 2

Pendulorchis gaoligongensis G. Q. Zhang, Ke Wei Liu et Z. J. Liu.

1.Flowering plant. 2.Flower, front view. 3. Column and lip, side view. 4. Dorsal sepal, petal and lateral sepal. 5. Lip. 6. Column and lip, longitudinal section. 7. Pollinarium, front view and back view. Drawn by X. Y. Ma from the type Z. J. Liu 5871 (NOCC).

Pendulorchis gaoligongensis G. Q. Zhang, Ke Wei Liu et Z. J. Liu.

1.Flowering plant. 2.Flower, front view. 3. Column and lip, side view. 4. Dorsal sepal, petal and lateral sepal. 5. Lip. 6. Column and lip, longitudinal section. 7. Pollinarium, front view and back view. Drawn by X. Y. Ma from the type Z. J. Liu 5871 (NOCC). The seven clades mostly receive moderate to high support (over 50). Species of the Holcoglossum clade are related to the species of the Paraholcoglossum clade (PP 1.00, BSML 97 and BSMP 68). Ascocentrum himalaicum, often placed in Holcoglossum, is related to the Tsiorchis subclade (PP 0.99, BSML 88 and BSMP 78). The Ascocentrum species are divided into three groups, belonging to the Tsiorchis, Vanda, and Holcoglossum clades respectively.

Morphological Characteristics and Distribution Analyses

The morphological characteristics of the AeridesVanda alliance support its division into the following 14 genera. (1) Rhynchostylis, which includes two species that are both large plants with flat leaves, laterally compressed and backward-pointing spur, cleft pollinia with narrow stipe much longer than the pollinia, and a small viscidium. This genus is widespread in tropical Asia north to south China. (2) Aerides includes 17 species with flat leaves, elongated column, appendiculate spur, bifid rostellum, cleft pollinia, and semicircular viscidium. This genus is widespread in tropical Asia from north China to the Himalayas. (3) Ascocentropsis is a monotypic genus similar to Ascocentrum, from which it differs by having more or less cross-shaped pollinarium with sulcate or split pollinia, visible caudicle, narrowly linear stipe much longer than either the pollinia or viscidium, and strongly incurved side-lobes of the lip. This genus is found in Thailand. (4) Papilionanthe includes four species with terete leaves, large flowers, trilobed lip attached to the column foot, elongated rostellum, and cleft pollinia attached by a broadly triangular or subquadrate stipe to a large viscidium. This genus is distributed in China, India, and Southeast Asia. (5) Neofinetia has flat narrow leaves, cleft pollinia, footless column, and narrow stipe much longer than pollinia. This genus is found in China, Japan, and Korea. (6) Christensonia is a monotypic genus that exhibits a mosaic of characters found in its closely related genera Aerides and Rhynchostylis. This genus, distributed in Vietnam, differs from the former by having a footless column and from the latter by a clearly three-lobed lip [9]. (7) Seidenfadenia, a monotypic genus similar to Holcoglossum, from which it differs by having a pouched and backward-pointing spur, is found in Thailand and Myanmar. (8) Ascocentrum miniatum, Ascocentrum ampullaceum, Ascocentrum curvifolium, and Ascocentrum aurantiacum have flat leaves, similar sepals and petals, lip firmly adnate to the column base with suberect lateral lobes adnate to column, and oblong mid-lobe thickening at the base. These species are found in Southeast Asia and the Himalayas. (9) Vanda includes five species of Vanda and two species transferred back from Trudelia (T. alpina and T. pumila), with cleft pollinia, footless column, and a broad stipe shorter than pollinia. This genus is widespread in tropical Asia extending to New Guinea and Australia. (10) Chenorchis is a monotypic genus with clavate rachis, three-lobed lip with its side-lobes from both lower sides of the mid-lobe, and large rostellum conspicuously broader than the column. This species is distributed in China (West Yunnan). (11) Tsiorchis, consisting of T. kimballiana and T. wangii, is characterized by their long-cylindrical spur, cleft pollinia, distinct caudicle attached to a common stipe, and purple-marked lip. This genus is found in China (Guangxi, Yunnan), Laos, Myanmar, Thailand, and North Vietnam. (12) Ascocentrum himalaicum and new species (Pendulorchis gaoligongensis), pendulous plant with terete leaves 30 cm to 60 cm long, very small flowers, white lip with very long spur, and very short sepals and petals. These plants are distributed in China (Yunnan), Bhutan, NE India, and Myanmar. (13) Paraholcoglossum, consisting of P. amesianum, P. subulifolium, and P. auriculatum, is characterized by a lip shallowly saccate at the base, a ridged callus at the sac entrance, a mid-lobe clawed at the base, and oblong stipe. These plants are found in China (Yunnan, Hainan), India, Laos, Myanmar, Thailand, and Vietnam. (14) Holcoglossum, which has 13 species including one new species and one new combination, is characterized by horn-shaped spur, porate pollinia directly attached to a common stipe, and white lip. This genus is found in China (Taiwan, Fujian, Sichuan, Guangxi, and Yunnan) and North Vietnam.

Holcoglossum Clade

This clade comprises all species of Holcoglossum, including one species transferred from Ascocentrum. Our data strongly suggest (PP1.00) that the Holcoglossum clade is related to the Paraholcoglossum clade. However, Tsiorchis should be placed distantly outside the Holcoglossum clade. Papilionanthe is treated as an independent clade outside the Holcoglossum clade. The aforementioned four genera have marked differences in morphology (Fig. 1). The phylogenetic relationships between Holcoglossum and its allied genera are well resolved, and all data sets supported the recognition of Papilionanthe. The Holcoglossum alliance is divided into the Tsiorchis, Paraholcoglossum, and Holcoglossum clades (PP1.00). Holcoglossum is treated as a genus of 13 species, including a new species, H. singchianum, and a new combination. They all combine to form a homologous subclade. The new species is related to Holcoglossum quasipinifolium, but distinguishable from it by some marked characteristics and should be treated as a new species.

Paraholcoglossum Clade

From the tree of the combined dataset, the Paraholcoglossum clade is related to the Holcoglossum clade. Paraholcoglossum comprises three species: P. subulifolium, P. auriculatum, and P. amesianum. Morphologically, this genus differs from Holcoglossum by a lip that is saccate (not spurred) at the base, a ridged (not crested or fleshy) callus at the sac entrance (not mid-lobe base), and an oblong (not tapering) stipe [11]. Three distinct pollination systems are observed in the Holcoglossum and Paraholcoglossum alliance, specifically, the autogamy in Paraholcoglossum amesianum [21], beetle pollination in Holcoglossum rupestre [22], and bee pollination in Holcoglossum nujiangense [23].

Rhynchostylis–Aerides Clade

This clade consists of the two subclades Rhynchostylis and Aerides. Rhynchostylis has three or four species, and its two Chinese species, which combine to form a subclade, were analyzed in this study. This study further suggests that Rhynchostylis is an independent genus. Aerides has approximately 20 species, among which 16 species were analyzed in this study. They combine to form a basal subclade of the AeridesVanda alliance and another basal subclade related to the Rhynchostylis subclade. The topology of Aerides partially agrees with that described by Kocyan et al. [2].

Papilionanthe Clade

This clade is composed of all 12 Papilionanthe species. The four species selected in this study combine to form a group distantly related to Holcoglossum, which contradicts previous findings [11]. Papilionanthe has an elongated stem, terete leaves, two- or three-lobed mid-lobe of the lip, cylindrical or horn-shaped spur, and short cleft pollinia. These characteristics relatively leave an evolutionary trace in Tsiorchis, Paraholcoglossum, and Holcoglossum.

Ascocentropsis Clade

The Ascocentropsis clade includes a monotypic genus formerly established based on Ascocentropsis pumila [12]. The molecular data from this study strongly support the independent position of this clade at the generic level, and prove that the Ascocentropsis clade is a basal clade compared with the Holcoglossum clade.

Vanda (Trudelia)–Ascocentrum–Neofinetia Clade

This group is a multifarious clade composed of the following subclades: (1) Neofinetia comprising the monophyletic genus Neofinetia with three species; (2) Christensonia, a monotypic genus that is considered independent at the generic level and related to the Seidenfadenia and Ascocentrum subclades; (3) Seidenfadenia, also a monotypic genus and a subclade related to the Ascocentrum subclade; (4) Ascocentrum, comprising four species with big flowers and flat leaves, i.e., a subclade related to the Seidenfadenia subclade. One other species and one new species (Pendulorchis gaoligongensis) with small flowers and terete leaves are considered independent genera placed in the PendulorchisTsiorchisChenorchis clade. Pendulorchis gaoligongensis has unique characteristics and should be treated as a new species. Ascocentrum pumilum should be transferred to Holcoglossum; and (5) Vanda, comprising approximately 40 species, seven of which were selected in this study and combined to form a subclade. Trudelia alpina and Trudelia pumila should be transferred back to Vanda.

Pendulorchis–Tsiorchis–Chenorchis Clade

This clade is composed of the following subclades. (1) Chenorchis comprising a monotypic genus described in 2008 in China [10]. This species was previously believed [13] to be identical with the Indian plant Penkimia nagalandensis [24]. However, further molecular comparative analysis between these two species is needed. The sample in our study is from the type specimen of Chenorchis, which provides evidence that it is genetically related to Tsiorchis (original Holcoglossum) and Pendulorchis (original Ascocentrum). Thus, these subclades are all related. (2) Tsiorchis comprises a genus of two species and originally belongs to Holcoglossum. Tsiorchis is related to the Pendulorchis subclade, but it is quite distinct from Holcoglossum and Paraholcoglossum due to its cleft, not its porate. The pollinia each have a distinct caudicle attached to a common stipe and lip marked with purple or dark purple on the mid-lobe and side-lobes. (3) Pendulorchis subclade includes a genus of one species that originally belongs to Ascocentrum and one new species. These two species are pendulous and have tiny, not fully open flowers. Pendulorchis is closely related to Tsiorchis and to a lesser extent to Chenorchis. These species form the PendulorchisTsiorchisChenorchis clade. Our molecular analysis and morphological observation strongly support the recognition of the following as independent genera: Holcoglossum, Paraholcoglossum, Tsiorchis, Chenorchis, Christensonia, Seidenfadenia, Ascocentropsis, Neofinetia, Ascocentrum, Pendulorchis, Papilionanthe, Aerides, Rhynchostylis, and Vanda. However, the branch analysis by Christenson [4] is only partially supported. We do not support the placement of Papilionanthe between Vanda and Aerides, as previously treated by Garay [15]. Instead, we propose that Papilionanthe should be placed between the AeridesRhynchostylis and VandaAscocentrum–Neofinetia alliances. Although this study covered all types of species, not all species of the genera in the AeridesVanda alliance were considered. Thus, further research is needed to confirm whether all the species in these genera are homologous.

Conclusion

The AeridesVanda alliance is confirmed to be monophyletic, but it can be divided into 14 genera, including the recently established Chenorchis, Ascocentropsis, Christensonia, Seidenfadenia, Paraholcoglossum, and Tsiorchis. We elucidate the relationship among the 14 genera of the AeridesVanda alliance, which comprises 7 main clades with 14 subclades. Its basal groups are Rhynchostylis and Aerides. Our molecular data prove that Ascocentrum is triphyletic. Ascocentrum pumilum is closely related genetically to Holcoglossum and should be transferred to this genus. One species of Ascocentrum and one new species with terete leaves and tiny flowers are treated in this study as a new genus, Pendulorchis, which is more closely related to Tsiorchis than to Ascocentrum. This study suggests that Vanda alpina and Vanda pumila should not be separated from Vanda to form an independent genus, Trudelia. A new genus, Pendulorchis, and two new species, Holcoglossum singchianum, are also described. Three new combinations, Pendulorchis gaoligongensis, Pendulorchis himalaica, and Holcoglossum pumilum, are established as well.

Taxonomic Treatment

Pendulorchis

Z. J. Liu, Ke Wei Liu et G. Q. Zhang, gen. nov. [urn:lsid:ipni.org:names: 77125660-1].

Diagnosis

Genus novum Ascocentro Schlechter ex J. J. Smith et Tsiorchide Z. J. Liu, S. C. Chen et L. J. Chen simile, a quibus plantis pendulis, caulibus saepe 13 cm to 24 cm longis foliis 6 to 14 praeditis, inflorescentiis multis (saepe 6 to 15), floribus 17 ad 39, viscidio diametro pollinium fere aequanti bene differt.

Description

Epiphytic pendulous plants, with many long and flattened roots. Stem often 13 cm to 24 cm long, enclosed by leaf sheaths, often branched. Leaves 6 to 14, fleshy, deep green, subterete, 30 cm to 60 cm long, 3 mm to 5 mm in diameter, channeled adaxially, jointed and sheathed at the base. Inflorescences often 6 to 15, paniculate or racemose, arising from the axils of the lower leaves, with 17 to 39 flowers; flowers 4 mm to 5 mm in diameter, not fully open; sepals, petals, and lip reddish; dorsal sepal oblong, abaxially carinate; lateral sepals elliptic; petals obovate-elliptic; lip 3-lobed; side-lobe erect, oblong, toward abaxial base strongly concave forming a callus-like structure; mid-lobe spreading forward, obovate, adaxially with three longitudinal midveins; spur cylindric; column stout and short; pollinia two globose, cleft, attached by a common stipe to a large suborbicular viscidium.

Type

Pendulorchis gaoligongensis G. Q. Zhang, Ke Wei Liu et Z. J. Liu.

Pendulorchis gaoligongensis

G. Q. Zhang, Ke Wei Liu et Z. J. Liu, sp. nov. Fig. 2, Fig. S7. [urn:lsid:ipni.org:names: 77125661-1]. China, Yunnan, Gaoligongshan, Lushui, 2010 m, growing on the branch of a big tree, 2011. 10. 10, Z. J. Liu 5871 (NOCC). Species nova Ascocentro himalaico (Deb, Sengupta & Malick) Christenson similis, a quo caulibus 14–25 cm longis foliis 6–16 praeditis, inflorescentiis 5–18 floribus 18 ad 41 praebentibus, labello rubello coloro sepala petalasque aequanti, viscidio diametro pollinium fere aequanti bene differt. Epiphytic plants, pendent, with many flattened roots. Stem 14–25 cm long, 4–5 mm in diameter, enclosed by leaf sheaths, often branched. Leaves 6–16, fleshy, deep green, subterete, 40–60 cm long, 4–5 mm in diameter, channeled adaxially, acute at apex, jointed and sheathing at base; sheaths 4–5 cm long. Inflorescences 5–16, racemose, arising from the axils of the lower leaves, 7–15 cm long, with 18–41 flowers; floral bracts broadly ovate, 2–3 mm long; flowers 8–9 mm in diameter, reddish; pedicel and ovary 1.2–1.5 cm long; dorsal sepal oblong, 4–5 mm long, 1.8–2.2 mm wide, rounded at apex; lateral sepal elliptic, 4–5 mm long, 2.5–2.8 mm wide, obtuse at apex; petals obovate-elliptic, 4–5 mm long, 2.2–2.4 mm wide, obtuse at apex; lip 3-lobed; side-lobe erect, oblong, 2–2.5 mm long, 1–1.2 mm wide, obtuse, toward abaxial base strongly concave forming a callus-like structure; mid-lobe spreading forward, obovate, 2.5–3 mm long, 2.5–3 mm wide, adaxially with 3 longitudinal midveins; spur cylindric, 1.2–1.5 cm long, 1.2–1.5 mm thick, obtuse-tipped; column stout and short, 1.8–2 mm long; anther cap purple; pollinia 2, globose, cleft, attached by a common stipe to a large suborbicular viscidium.

Flowering period

October–November.

Distribution

China, SW Yunnan (Lushui County).

Habitat

Epiphytic, on branches of tall trees in evergreen forest at an altitude of 1800–2100 m.

Pendulorchis himalaica

(Deb, Sengupta & Malick) Z. J. Liu, Ke Wei Liu et X. J. Xiao, comb. nov. [urn:lsid:ipni.org:names: 77125662-1].

Basionym

Saccolabium himalaicum Deb, Sengupta, & Malick, Bull. Bot. Soc. Bergal 22 (2): 213. 1968.

Synonym

Holcoglossum himalaicum (Deb, Sengupta, & Malick) Averyanov in Bot. J. (Leningrad) 73 (1) 101–107, 1988; H. junceum Z. H. Tsi in Acta Phytotax. Sin. 20 (4): 442. Fig. 1. 1982; Ascocentrum himalaicum (Deb, Sengupta, & Malick) Christenson in Notes Bot. Gard. Edinb. 44∶256. 1987. China, SW and W Yunnan; Bhutan, NE India, and Myanmar.

Holcoglossum singchianum

G. Q. Zhang, L. J. Chen, & Z. J. Liu sp. nov. Fig. 3, Fig. S8. [urn:lsid:ipni.org:names: 77125663-1].
Figure 3

Holcoglossum singchianum G. Q. Zhang, L. J. Chen et Z. J. Liu.

1. Flowering plant; 2. Flower, front view; 3. Lip and column, side view; 4. Dorsal sepal, petal, and lateral sepal; 5. Pollinarium, front view and back view.

Holcoglossum singchianum G. Q. Zhang, L. J. Chen et Z. J. Liu.

1. Flowering plant; 2. Flower, front view; 3. Lip and column, side view; 4. Dorsal sepal, petal, and lateral sepal; 5. Pollinarium, front view and back view. Yunnan, Xichou, in forest, on tree trunk, alt. 1300 m. 2009. 04. 30. Z. J. Liu 4532 (NOCC). Species nova Holcoglosso linearifolio similis, a quo differt foliis 3–4 mm in diam., inflorescentia 12- ad 16-flora, lobo intermedio labelli subobovato-rhambico, ejus lobis lateralibus flavis et bruneo-maculatis. Epiphytic plant. Stem nearly ascending, 5–6 cm long, enclosed in persistent leaf sheaths, 7- to 8-leaved. Leaves fleshy, cylindric, 19–37 cm long, 3–4 mm thick, adaxially channeled, acuminate at apex, base dilated into amplexicaul sheaths. Inflorescence 12- to 16-flowered; peduncle 8–9 cm long, with 2 to 3 tubular sheaths; rachis 14–20 cm long; floral bracts broadly ovate, 3–4.5 cm long, obtuse at apex; pedicel and ovary 2.4–3.5 cm long; flowers 3–3.8 cm across; sepals and petals white with a purple midvein; mid-lobe of lip white, purple-spotted on lamellae; side-lobes yellow, brown-spotted; dorsal sepal obovate-elliptic, 1.6–2 cm long, 6–7 mm wide, acuminate at apex; lateral sepals falcate-oblong, 1.7–2.2 cm long, 8–10 mm wide, obtuse at apex; petals obovate-oblong, 1.6–2.1 cm long, 5.5–6.5 mm wide, acuminate at apex; lip 3-lobed; side-lobes erect, apex deeply emarginate forming front and rear lobules; front lobule subovate triangular, 3–3.5 mm long, obtuse at apex; rear lobule subovate; mid-lobe subovate-rhombic, 1.7–2.3 cm long, 1.1–1.3 cm wide, apex fork-shaped, front margin undulate and toothed; spur horn-shaped, 1.7–2.1 cm long, apex slightly obtuse; column 5–6 mm long; pollinia 2, globose. Capsule ellipsoid, ca. 4.5 cm long, 7.5 mm thick. The new species is similar to H. linearifolium, differing by its nearly ascending stem, leaves 3–4 mm thick, inflorescence 12- to 16-flowered, lip with subobovate-rhombic mid-lobe, and yellow side-lobes spotted with brown. November to December. China, SE Yunnan (Malipo County). Epiphytic, on tree trunks in broad-leaved forests, 1300–1500 m.

Holcoglossum pumilum

(Hayata) L. J. Chen, X. J. Xiao et G. Q. Zhang comb. nov. [urn:lsid:ipni.org:names: 77125664-1]. Saccolabium pumilum Hayata in Bot. Mag. (Tokyo) 20∶77, 1906. Ascocentrum pumilum (Hayata) Schlechter in Repert. Spec. Nov. Regni Veg. Beih. 4∶285. 1919; Ascolabium pumilum (Hayata) S. S. Ying in Col. Ill. Inding. Orch. Taiwan 1∶54, 1977. Taiwan, China.

Materials and Methods

Materials

A total of 70 species of 18 genera were analyzed, including all genera of the AeridesVanda alliance proposed by Tsi [3] and Christenson [4]. These genera include Holcoglossum, Vanda, Trudelia, Papilionanthe, Ascocentrum, Aerides, Rhynchostylis, Seidenfadenia, Neofinetia, and the recently established genera, Chenorchis, Paraholcoglossum, Tsiorchis, Ascocentropsis, and Christensonia. The analyzed samples comprise the type species of all genera. Two Cymbidium species, C. kanran and C. goeringii, were selected as outgroup [20], [25]. To compare the genera of the AeridesVanda alliance, we added three relevant genera, Phalaenopsis, Pteroceras, and Saccolabium to the analyzed samples. Table S1 provides detailed information regarding the assessment.

Amplification and Sequencing

Total DNA was extracted from fresh material or silica gel-dried plant tissue using a Multisource Genomic DNA Miniprep Kit (Axygen Biosciences) following the manufacturer’s instructions. The amplification reaction included total DNA, primers, Ex-Taq buffer, and Ex-Taq DNA polymerase (Takara Bio). The polymerase chain reaction (PCR) profile consisted of an initial 5 min pre-melting stage at 95°C, followed by 30 cycles of 30 s at 95°C (denaturation), 30 s at 50°C to 55°C (annealing temperature was determined based on the primer requirement), and 1 min to 3 min at 72°C (extension time was determined based on the length of the target DNA region), and a final 10 min extension at 72°C. The amplification of the ITS region was performed using the primer pairs ITS A and ITS B [26]. The trnL-F region was amplified with primers c and f [27] or the two sets of primers developed by Liu et al. [11]. For matK sequences, amplification was performed using the primer pair matK-19F and trnK-2R [26], and several fragments were amplified using the three sets of primers developed by Liu et al. [11]. The psbA-trnH region was amplified and sequenced by the primer pairs psbAF and trnHR [28]. The atpI-atpH region was amplified and sequenced using the primer pairs atpI and atpH [29]. The trnS-trnfM region was amplified and sequenced using the primer pair trnS-trnfM [30]. Table 3 contains the detail information.
Table 3

Primers used in this study.

PrimerSequence(5′→3′)Origin
ITS A GGAAGGAGAAGTCGTAACAAGG Mike et al. [26]
ITS B CTTTTCCTCCGCTTATTGATATG Mike et al. [26]
trnL-C CGAAATCGGTAGACGCTACG Taberlet et al. [27]
trnL-FATITGAACTGGTGACACGAGTaberlet et al. [27]
trnL-MF TAAAGAGAGAGTCCCATTTTAC Liu et al. [11]
trnL-MR GAGCGAGGAAGTAAAATGGGC Liu et al. [11]
trnK-2R AACTAGTCGGATGGAGTAG Mike et al. [26]
matK-19F CGTTCTCATATTGCACTATG Mike et al. [26]
matK-969R CTTTTCCTTGATATCGAACAT Liu et al. [11]
matK-731F AAGAAAAGATTCTTTTGGTTCC Liu et al. [11]
psbAF GTTATGCATGAACGTAATGCTC Sang et al. [28]
trnHR CGCGCATGGTGGATTCACAAATC Sang et al. [28]
atpITATTTACAAGYGGTATTCAAGCTShaw et al. [29]
atpHCCAAYCCAGCAGCAATAACShaw et al. [29]
trnS GAGAGAGAGGGATTCGAACC Demesure [30]
trnfM CATAACCTTGAGGTCACGGG Demesure [30]
The PCR products were run on 1.5% agarose gels to assess the quality of the amplified DNA. The gels with the target products were excised, purified using DNA Gel Extraction Kits (Axygen Biosciences), and then sequenced by Life Technologies Corporation.

Sequence Editing and Assembling

Both forward and reverse sequences, as well as electropherograms were edited and assembled using DNASTAR (http://www.dnastar.com/). DNA sequences were aligned to the muscle model and manually adjusted using MEGA5.05 [31]. Aligned sequences are available from the corresponding authors upon request.

Data Analyses

The datasets included a nuclear ITS, plastid DNA (cpDNA; including the trnL-F, matK, psbA-trnH, atpI-atpH, trnS-trnfM), and their combination. Insertions, deletions, and some unavailable sequences were treated as missing. Phylogenetic analyses were performed under ML, MP, and Bayesian inference (BI) methods. The best-fit model for each dataset was selected by Modeltest 3.7 [32] under the Akaike Information Criterion (Table 2). The homogeneities between nrDNA ITS data and the combined cpDNA dataset were tested using the incongruence length difference (ILD) test [33], as implemented in PAUP* version 4.0b10 [34]. The ILD test was conducted with 1000 replicates, each with 10 random addition sequence replicates, TBR branch swapping, and keeping no more than 100 trees per random addition replicate. Following Cunningham [35], a significance level of P = 0.01 was adopted for this test. MP analyses were performed using the PAUP* version 4.0b10 [34]. All characters were equally weighed and unordered. Test settings included 1000 replications of random addition sequence and heuristic search with tree bisection-reconnection branch swapping. Table 1 lists the tree length, consistency index (CI), and retention index (RI) ML analysis was performed using RAxML version 7.2.8 with 100 bootstrap replicates and settings as described in Stamatakis et al. [36]. BI analysis was performed using MrBayes 3.1.2 [37]. The best-fit model for each dataset was selected using Modeltest 3.7. In the combined dataset of all datasets, the model was also based on the best fit model for each individual dataset. The following settings were applied: sampling frequency = 1000, temp = 0.1, burn-in = 10 000, and number of Markov chain Monte Carlo generations = 40 000 000. The first 10 000 trees were discarded as burn-in to ensure that the chains reached stationarity. A majority-rule consensus tree was constructed on these trees sampled after generation 10 000 000. Phylogenetic analyses were performed under the ML, MP, and BI for each dataset. The BI, MP, and ML trees of each dataset had similar topological structures, indicating the very good repeatability of the analysis and reliability of the experimental data. The differences among the BI, MP, and ML trees were the values of bootstrap percentages or posterior probabilities in each node. Generally, the values in the BI tree were higher than those in the MP and ML trees (Figs.1, S1, S2, S3, S4, S5, S6). We submitted all data and trees to TreeBase, http://purl.org/phylo/treebase/phylows/study/TB2:S13699.

Nomenclature Acts

The electronic version of this article in Portable Document Format (PDF) in a work with an ISSN or ISBN will represent a published work according to the International Code of Nomenclature for algae, fungi, and plants, and hence the new names contained in the electronic publication of a PLOS ONE article are effectively published under that Code from the electronic edition alone, so there is no longer any need to provide printed copies. In addition, new names contained in this work have been submitted to IPNI, from where they will be made available to the Global Names Index. The IPNI LSIDs can be resolved and the associated information viewed through any standard web browser by appending the LSID contained in this publication to the prefix http://ipni.org/. The online version of this work is archived and available from the following digital repositories: PubMed Central, LOCKSS. Bayesian consensus trees based on ITS data. The Bayesian posterior probability (×100) is given above the branches. (TIF) Click here for additional data file. Maximum likelihood (ML) trees of ITS computed by RAxML with 100 bootstrap replicates. The bootstrap values are given above the branches. (TIF) Click here for additional data file. Strict consensus tree of most parsimonious trees based on ITS data. Tree length = 991 steps, CI = 0.5550, and RI = 0.7442. The bootstrap values of the maximum parsimony analysis are given above the branches. (TIF) Click here for additional data file. Bayesian consensus trees based on cpDNA combined dataset. The Bayesian posterior probability (×100) is given above the branches. (TIF) Click here for additional data file. Maximum likelihood (ML) trees of cpDNA combined dataset computed by RAxML with 100 bootstrap replicates. The bootstrap values are given above the branches. (TIF) Click here for additional data file. Strict consensus tree of most parsimonious trees based on cpDNA combined dataset. Tree length = 1885 steps, CI = 0.7220, and RI = 0.7720. The bootstrap values of the maximum parsimony analysis are given above the branches. (TIF) Click here for additional data file. G. Q. Zhang, Ke Wei Liu et Z. J. Liu. a. Plant on tree trunk, b. Flowering plant; c. Inflorescence; d. Flower, front view; e. Pollinarium, front view; f. Pollinarium, back view; g. Flower, side view. (TIF) Click here for additional data file. G. Q. Zhang, L. J. Chen et Z. J. Liu. a. Flowering in cultivation; b. Inflorescence; c and d. Flower, front view and side view; e and f. Pollinarium, front and back views. (TIF) Click here for additional data file. Species and gene regions sequenced for analysis, as well as GenBank accession numbers. (DOC) Click here for additional data file.
  14 in total

1.  MrBayes 3: Bayesian phylogenetic inference under mixed models.

Authors:  Fredrik Ronquist; John P Huelsenbeck
Journal:  Bioinformatics       Date:  2003-08-12       Impact factor: 6.937

2.  Pollination: self-fertilization strategy in an orchid.

Authors:  Ke-Wei Liu; Zhong-Jian Liu; LaiQiang Huang; Li-Qiang Li; Li-Jun Chen; Guang-Da Tang
Journal:  Nature       Date:  2006-06-22       Impact factor: 49.962

3.  Universal primers for amplification of three non-coding regions of chloroplast DNA.

Authors:  P Taberlet; L Gielly; G Pautou; J Bouvet
Journal:  Plant Mol Biol       Date:  1991-11       Impact factor: 4.076

4.  Molecular phylogeny of Aerides (Orchidaceae) based on one nuclear and two plastid markers: a step forward in understanding the evolution of the Aeridinae.

Authors:  Alexander Kocyan; Ed F de Vogel; Elena Conti; Barbara Gravendeel
Journal:  Mol Phylogenet Evol       Date:  2008-02-29       Impact factor: 4.286

5.  MODELTEST: testing the model of DNA substitution.

Authors:  D Posada; K A Crandall
Journal:  Bioinformatics       Date:  1998       Impact factor: 6.937

6.  MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods.

Authors:  Koichiro Tamura; Daniel Peterson; Nicholas Peterson; Glen Stecher; Masatoshi Nei; Sudhir Kumar
Journal:  Mol Biol Evol       Date:  2011-05-04       Impact factor: 16.240

7.  Chloroplast DNA phylogeny, reticulate evolution, and biogeography of Paeonia (Paeoniaceae).

Authors:  T Sang; D Crawford; T Stuessy
Journal:  Am J Bot       Date:  1997-08       Impact factor: 3.844

8.  Molecular phylogenetics of Vandeae (Orchidaceae) and the evolution of leaflessness.

Authors:  Barbara S Carlsward; W Mark Whitten; Norris H Williams; Benny Bytebier
Journal:  Am J Bot       Date:  2006-05       Impact factor: 3.844

9.  Can three incongruence tests predict when data should be combined?

Authors:  C W Cunningham
Journal:  Mol Biol Evol       Date:  1997-07       Impact factor: 16.240

10.  A set of universal primers for amplification of polymorphic non-coding regions of mitochondrial and chloroplast DNA in plants.

Authors:  B Demesure; N Sodzi; R J Petit
Journal:  Mol Ecol       Date:  1995-02       Impact factor: 6.185

View more
  4 in total

1.  A new myco-heterotrophic genus, Yunorchis, and the molecular phylogenetic relationships of the tribe Calypsoeae (Epidendroideae, Orchidaceae) inferred from plastid and nuclear DNA sequences.

Authors:  Guo-Qiang Zhang; Ming-He Li; Yong-Yu Su; Li-Jun Chen; Si-Ren Lan; Zhong-Jian Liu
Journal:  PLoS One       Date:  2015-04-22       Impact factor: 3.240

2.  The complete plastid genome of Holcoglossum singchianum (Orchidaceae, Vandeae).

Authors:  Jin-Liao Chen; Xiong-De Tu; Ding-Kun Liu; Sai Zhang; Ming-He Li
Journal:  Mitochondrial DNA B Resour       Date:  2020-01-21       Impact factor: 0.658

3.  Complete plastid genome of Holcoglossum tsii (Orchidaceae, Aeridinae) and phylogenetic analysis.

Authors:  Yong-Bin Chen; Ming Xie; Sheng-Ting Guo; Xiao-Yong Zheng; Heng Li
Journal:  Mitochondrial DNA B Resour       Date:  2019-12-18       Impact factor: 0.658

4.  Phylogenetic incongruence in Cymbidium orchids.

Authors:  Guo-Qiang Zhang; Gui-Zhen Chen; Li-Jun Chen; Jun-Wen Zhai; Jie Huang; Xin-Yi Wu; Ming-He Li; Dong-Hui Peng; Wen-Hui Rao; Zhong-Jian Liu; Si-Ren Lan
Journal:  Plant Divers       Date:  2021-09-09
  4 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.