Microsatellite characterization of Cimarron Uruguayo dogs.

Various genetic markers, including microsatellites, have been used to analyze the genetic polymorphism and heterozygosity in canine breeds. In this work, we used nine microsatellite markers to investigate the genetic variability in Cimarron Uruguayo dogs, the only officially recognized native canine breed in Uruguay. DNA from 30 Cimarron Uruguayo dogs from northeastern and southern Uruguay was analyzed. The allelic frequencies for each microsatellite, the genetic variability and the consanguinity were calculated, as were the polymorphic information content (PIC) and the probability of exclusion (PE). All of the microsatellites studied were polymorphic. FH 2361, FH 2305 and PEZ 03 were the most informative, with PIC values > 0.7, in agreement with results for other canine breeds. The PE values for the markers were within the ranges previously described and were generally greater for microsatellites with higher PIC values. The heterozygosity value (0.649) was considered high since only nine microsatellites were analyzed. Compared with data for other breeds, the results obtained here indicate that Cimarron Uruguayo dogs have high genetic diversity.

Most canine breeds were developed during the 19th century and are therefore considered to be recent. In contrast to other domestic animals, rapid phenotypic selection has resulted in extremely diverse breeds. The strong selection pressure that was applied to develop the different breeds has led to a loss of genetic variation, the extent of which varies, depending on the history of the breed and the breeding practices used. Various genetic markers have been used to analyze the genetic polymorphism and heterozygosity of canine breeds, including microsatellites (Irion ). These markers show a high degree of polymorphism, random distribution across the genome and neutrality with respect to selection (Serrano ).

The Cimarron Uruguayo is the only native dog breed in Uruguay and was officially recognized as a formal breed by the Fédération Cynologique Internationale in February 2006. These dogs have a moloso type, an average size, and are nimble, brawny, compact and strong, with good bones (Silveira ,b). Throughout their history, numerous attempts were made to exterminate these dogs because of the serious threat they posed to men and cattle. However, a few specimens survived in the wild in the north eastern provinces of Cerro Largo and Treinta y Tres, where the breed originated (Silva Valdés, 1957; Assunçao, 1997). In urban areas, these dogs are currently used as pets and guard dogs while in rural areas they are used for hunting and working with cattle (Silveira ). In this work, we used microsatellite markers to examine the genetic variation in Cimarron Uruguayo dogs.

Thirty Cimarron Uruguayo dogs (13 from northeastern Uruguay and 17 from southern Uruguay) were analyzed. These areas were selected because they represented the geographic origin of this breed (the provinces of Cerro Largo and Treinta y Tres in northeastern Uruguay) and the region of highest population density for the breed (the provinces of Montevideo and Canelones in southern Uruguay). DNA was isolated from venous blood samples using AxyPrep Multisource Genomic DNA Miniprep kits (Axygen Biosciences). Table 1 shows the microsatellite markers, their respective primers and the PCR conditions for each marker used in this work. The amplifications were done using a standard protocol (denaturation at 95 °C for 4 min followed by 35 cycles of 95 °C for 1 min, 44–60 °C for 30 s and 72 °C for 45 s). The results were analyzed using MegaBACE 1000 software, with a permit issued to the University of Zaragoza. The allelic frequencies for each microsatellite, the genetic variability and the consanguinity were calculated using the software Genetix, whereas the polymorphic information content (PIC) and the probability of exclusion (PE) were calculated using the software Cervus (Slate ); both softwares are available free on the internet.

Table 1

Primers and PCR conditions used for each microsatellite marker.

Marker	MgCl2 (50 μM) (μL)	Annealing temperature (°C)	Primers (5′-3′)
AHTk211	1	60	TTAGCAGCCGAGAAATACGCATTCGCCCGACTTTGGCA
FH 2305	0.5	56	TCATTGTCTCCCTTTCCCAGAAGCAGGACATTCATAGCAGTG
FH 2326	0.5	60	GAATCCCCAATGTACATGGCCAGCCATCCAGGAAATCG
FH 2328	0.75	60	ACCAGGTAGTTTTCAGAAATGCAGTTATGGGACTTGAGGCTG
FH 2361	0.5	60	GCTTGGAAGGTGAGACTGAATGAGCACTTAGAATGTACCAGGCAC
LEI2D2	1	65	CGAGACCACATTGGGCTCCCCAGACGCTCTCCATGCCTC
PEZ 03	0.5	44	CACTTCTCATACCCAGACTCCAATATGTCAACTATACTTC
PEZ 11	0.5	50	ATTCTCTGCCTCTCCCTTTGTGTGGATAATCTCTTCTGTC
PEZ 12	0.75	56	GTAGATTAGATCTCAGGCAGTAGGTCCTGGTAGGGTGTGG

All of the microsatellites analyzed were polymorphic, with the average number of alleles per locus being 5.67 (range: 4–8). The markers with the lowest number of allelic variants were AHTk 211, FH 2328 and PEZ 12, whereas FH 2326 had the highest number of variants. Table 2 summarizes the PIC, PE and heterozygosities of each microsatellite. Previous studies have reported 5–18 allelic variants for these markers (Neff ; Eggleston ). The discrepancy between these studies and our results may reflect the larger number of dogs analyzed by other workers, e.g., Eggleston analyzed an average of 41 samples per breed in 28 breeds, whereas Neff analyzed 218 samples of cross-bred dogs. The analysis of a larger sample of Cimarron Uruguayo dogs may have yielded more alleles for this breed.

Table 2

Results obtained for each microsatellite marker.

Locus	PE	Ho	He	PIC	FIS (95% CI)
AHTk 211	0.380	0.567	0.669	0.590	0.156 (−0.112–0.398)NS
FH 2328	0.223	0.369	0.416	0.378	0.121 (−0.174–0.422)NS
FH 2361	0.579	0.786	0.800	0.753	0.018 (−0.178–0.203)NS
LEI2D2	0.487	0.767	0.734	0.679	−0.045 (−0.241–0.113)NS
FH 2326	0.370	0.633	0.645	0.565	0.018 (−0.256–0.252)NS
FH 2305	0.534	0.767	0.767	0.717	0.001 (−0.199–0.118)NS
PEZ 03	0.537	0.733	0.753	0.710	0.026 (−0.148–0.190)NS
PEZ 11	0.549	0.633	0.714	0.654	0.115 (−0.125–0.326)NS
PEZ 12	0.179	0.367	0.346	0.314	−0.061 (−0.241–0.147)NS
Global	0.994	0.624	0.649		0.039 (−0.044–0.085)NS

FIS: subpopulation inbreeding coefficient, He: expected heterozygosity, Ho: observed heterozygosity, PE: probability of exclusion, PIC: polymorphic information content.

Usual values for the PIC of microsatellites range from 0.25 to 0.5, whereas values > 0.5 are considered to be high (Arruga, 1994; Zajc and Sampson, 1999). In other breeds, the PIC values for the same markers used here vary considerably (Eggleston ). Among the nine markers analyzed in the present study, seven were highly polymorphic, with a PIC > 0.5. FH 2361, FH 2305 and PEZ 03 were the most informative (PIC values > 0.7), in agreement with the findings of Oberbauer for other dog breeds.

The PE was generally greater for microsatellites with higher PIC values. The PE values for each marker in Cimarron Uruguayo dogs were within the ranges previously reported for dogs (Eggleston ). The global PE (99.4%) obtained for the nine microsatellites used here was also within the range (95%–99%) reported for other breeds in which a larger number of markers was used. The PE value tends to increase with the number of microsatellites analyzed and this provides greater certainty when determining paternity. However, there appears to be an upper limit (plateau) in this relationship beyond which the contribution of each additional microsatellite to the PE value is minimal (Zajc and Sampson, 1999).

The microsatellites used here were selected because of their usefulness in identifying individuals and in establishing paternity (Eggleston ). The PE and PIC results obtained here confirmed the usefulness of these microsatellites for genetic studies in Cimarron Uruguayo dogs. The global heterozygosity of the samples analyzed was high, with an expected heterozygosity of 0.649 and an observed value of 0.624. Previous studies using other microsatellites in different dog breeds have reported heterozygosities between 0.36 and 0.758 (Zajc ; Morera Sanz ; Puja ). Table 3 compares the results for Cimarron Uruguayo dogs with those obtained in other breeds (generally based on a larger number of animals and microsatellite markers than used here). Irion and Morera Zanz reported heterozygosities of 0.387 to 0.758 in different breeds. This variability partly reflects the fact that some of the markers analyzed by these authors were monomorphic in breeds with lower heterozygosity. Morera Zanz reported a mean value of 0.7 for the genetic variability in Alano Español dogs, a breed that contributed to the initial genetic composition of Cimarron Uruguayo dogs; this value was comparable to that calculated here for Cimarron Uruguayo dogs. The value obtained for Cimarron Uruguayo dogs can be considered high since only nine microsatellites were analyzed. This finding indicates that, compared to other breeds, Cimarron Uruguayo dogs have high genetic diversity. This diversity probably reflects the fact that the dogs that took refuge in northeastern Uruguay during attempts to exterminate the breed retained considerable genetic variability that was enhanced by natural crosses with wild animals, i.e., no artificial selection. In addition, since this breed is relatively new, it probably has not experienced the extensive selective pressure undergone by older breeds.

Table 3

Genetic heterozygosity in different dog breeds.

Breed	No of animals	No of microsatellites	Ho	He	Reference
Cimarron Uruguayo	30	9	0.624	0.649	This paper
Bali Street dog	40	31	0.692	0.746	Puja et al. (2005)
Kintamani dog	40	31	0.681	0.700	Puja et al. (2005)
Chow Chow	20	31	0.640	0.649	Puja et al. (2005)
Greyhounds	50	19	0.333	0.357	Zajc et al. (1997)
Labradors	50	19	0.352	0.481	Zajc et al. (1997)
German Shepherds	50	19	0.310	0.431	Zajc et al. (1997)
Golden Retriever	25	10	0.61	0.62	Koskinen and Bredbacka (2000)
Wirehaired Dachshund	25	10	0.67	0.72	Koskinen and Bredbacka (2000)
Pembroke Welsh Corgi	25	10	0.55	0.64	Koskinen and Bredbacka (2000)
Bedlington Terrier	25	10	0.55	0.56	Koskinen and Bredbacka (2000)
German Shepherd	25	10	0.62	0.64	Koskinen and Bredbacka (2000)

He: expected heterozygosity, Ho: observed heterozygosity.