| Literature DB >> 21483702 |
Galliano Zanello1, Mustapha Berri, Joëlle Dupont, Pierre-Yves Sizaret, Romain D'Inca, Henri Salmon, François Meurens.
Abstract
BACKGROUND: Enterotoxigenic Escherichia coli (ETEC) infections result in large economic losses in the swine industry worldwide. ETEC infections cause pro-inflammatory responses in intestinal epithelial cells and subsequent diarrhea in pigs, leading to reduced growth rate and mortality. Administration of probiotics as feed additives displayed health benefits against intestinal infections. Saccharomyces cerevisiae (Sc) is non-commensal and non-pathogenic yeast used as probiotic in gastrointestinal diseases. However, the immuno-modulatory effects of Sc in differentiated porcine intestinal epithelial cells exposed to ETEC were not investigated. METHODOLOGY/PRINCIPALEntities:
Mesh:
Substances:
Year: 2011 PMID: 21483702 PMCID: PMC3070739 DOI: 10.1371/journal.pone.0018573
Source DB: PubMed Journal: PLoS One ISSN: 1932-6203 Impact factor: 3.240
Figure 1Interaction of Saccharomyces cerevisiae or ETEC with differentiated IPEC-1 cells.
Differentiated IPEC-1 cells were cultured overnight with Sc (3×106 yeasts/well) or exposed to ETEC (3×107 CFU/well) for 45 min. IPEC-1 cells were then assessed to scanning electron microscopy. (A) Differentiated IPEC-1 cells expressed microvilli on their surface, (B) Sc interacts with differentiated IPEC-1 cells, (C) ETEC interacts with differentiated IPEC-1 cells.
Primer sequences, annealing temperatures of primer sets (°C), expected PCR fragment sizes (bp) and accession numbers or references.
| Primer name | Primer sequence | Annealing temperature(s) (°C) | PCR product (bp) | Accession number or reference |
|
| S: | 60 | 172 | Meurens |
|
| S: | 60 | 103 | Meurens |
|
| S: | 60 | 112 | Meurens |
|
| S: | 67 | 169 | Bruel |
|
| S: | 66 | 146 | Meurens |
|
| S: | 60 | 184 | DB798783 |
|
| S: | 62 | 105 | NM_001025214 |
|
| S: | 60 | 116 | ENSFM00600000921619 |
|
| S: | 60 | 137 | GU_17420 |
|
| S: | 60 | 171 | Meurens |
|
| S: CCCACATGTTGAGATCATTGC AS: | 60 | 168 | Meurens |
|
| S: | 58 | 173 | AY312066 |
|
| S: | 58 | 83 | Nygard |
|
| S: | 60 | 91 | Nygard |
|
| A: | 60 | 167 | Meurens |
|
| S: | 60 | 170 | NM_214029 |
|
| S: | 65 | 173 | Meurens |
|
| S: | 64 | 105 | Meurens |
|
| S: | 62 | 177 | Meurens |
|
| S: | 62 | 100 | Meurens |
|
| S: | 60 | 202 | NM_214041 |
|
| S: | 64 | 180 | Meurens |
|
| A: | 67 | 159 | Meurens |
|
| A: | 66 | 103 | Meurens |
|
| S: CTCCTTCTCCGCCTCAAGATCC AS:TTGCTGCTCCATGGGCGAAGAC | 70 | 82 | Meurens |
|
| S: | 63 | 126 | Meurens |
|
| S: | 60 | 134 | XM_001926883 |
|
| S: | 62 | 150 | Bruel |
|
| S: | 60 | 133 | DQ848681 |
|
| S: | 62 | 150 | Meurens |
|
| S: | 62 | 180 | Meurens |
|
| S: | 62 | 149 | Bassaganya-Riera et al., 2006 |
|
| S: | 60 | 147 | Meurens |
|
| S: | 64 | 131 | CJ025705 |
|
| S: | 64 | 162 | Meurens |
|
| S: | 62 | 116 | Meurens |
|
| S: | 58 | 164 | Meurens |
Reference genes are underlined.
Effects of Saccharomyces cerevisiae or ETEC on transcript expressions in IPEC-1 cells (fold changes in comparison to controls).
| Transcripts | Expression level |
| ETEC |
|
| moderate | 0.60 | 1.13 |
|
| low | 0.40 | 0.74 |
|
| moderate | 1.32 | 6.83 |
|
| not detected | - | - |
|
| moderate | 3.61 | 5726.08 |
|
| not detected | - | - |
|
| moderate | 2.73 | 1.11 |
|
| moderate | 1.65 | 857.44 |
|
| moderate | 1.18 | 7.05 |
|
| moderate | 1.50 | 2.98 |
|
| not detected | - | - |
|
| moderate | 7.37 | 46.93 |
|
| not detected | - | - |
|
| moderate | 0.97 | 2.56 |
|
| high | 0.39 | 7.80 |
|
| moderate | 5.08 | 670.15 |
|
| low | 1.07 | 2.00 |
|
| moderate | 10.69 | 0.85 |
|
| low | 0.93 | 0.93 |
|
| not detected | - | - |
|
| high | 0.47 | 1.66 |
|
| not detected | - | - |
|
| high | 2.21 | 1.30 |
|
| low | 1.46 | 0.74 |
|
| moderate | 0.9 | 0.77 |
|
| low | 0.5 | 1.07 |
|
| not detected | - | - |
|
| high | 2.59 | 1.21 |
|
| high | 0.66 | 0.78 |
|
| high | 1.64 | 0.62 |
|
| low | 5.12 | 3075.63 |
|
| moderate | 1.17 | 1.36 |
Level of mRNA expressions in untreated cells are expressed in the second column (high: Amplification around 17–24 cq (cycle quantification), moderate: Around 25–29 cq, low: Around 30–33 cq, not detected: More than 33 cq). Asterisks
denote p<0.01
Figure 2Viable Saccharomyces cerevisiae down-regulates cytokine and chemokine mRNA relative expressions induced by ETEC.
Differentiated IPEC-1 cells were cultured overnight with (A) viable Sc or (B) killed Sc (3×106 yeasts/well) and then ETEC (3×107 CFU/well) was added to the co-culture for 3 h. Gene expression was analysed by RT-qPCR. Data are presented as means ± SEM (n = 6), asterisks denote: ** (P<0.01). (A) Data are representative of three independent experiments.
Figure 3Saccharomyces cerevisiae up-regulates CCL25, PPAR-γ and IL-12p35 mRNA relative expressions.
Differentiated IPEC-1 cells were cultured overnight with (A) viable Sc or (B) killed Sc (3×106 yeasts/well) and then ETEC (3×107 CFU/well) was added to the co-culture for 3 h. Gene expression was analysed by RT-qPCR. Data are presented as means ± SEM (n = 6), asterisks denote: * (P<0.05), ** (P<0.01). (A) Data are representative of three independent experiments.
Figure 4Saccharomyces cerevisiae decreases IL-6 and IL-8 secretions induced by ETEC.
Differentiated IPEC-1 cells were cultured overnight with (A) viable or (B) killed Sc (3×106 yeasts/well) and then ETEC (3×107 CFU/well) was added to the co-culture for 30 min. Differentiated IPEC-1 cells were then washed and cultured for another 24 h before the assessment of apical IL-6 and IL-8 secretions by ELISA. Data are presented as means of cytokine concentration ± SEM (n = 3-4), asterisks denote: * (P<0.05), ** (P<0.01). Data are representative of two independent experiments.
Figure 5Saccharomyces cerevisiae decreases the MAP Kinase (ERK1/2, p38) phosphorylation in differentiated IPEC-1 cells.
Differentiated IPEC-1 cells were exposed for 30 and 60 min with ETEC (3×107 CFU/well) in the presence and absence of Sc (3×106 yeasts/well). Western blots for phospho-ERK1/2 (p-ERK1/2) and phospho-p38 (p-p38) were performed. Total ERK1/2 and total p38 are shown as loading controls and did not change with each condition over time. Data are presented as means ± SEM, (n = 3) and the different letters represent significant differences between the treatments (P<0.05). Results are representative of three independent experiments.
Figure 6Saccharomyces cerevisiae agglutinates ETEC.
(A) IPEC-1 cells were exposed to ETEC (3×107 CFU/well) for 30 min in the presence or absence of Sc (3×106 yeasts/well). Cells were then lysed and cell lysates were diluted and plated on agar in order to quantify the cell-associated bacteria, (n = 4). (B) IPEC-1 cells were exposed to ETEC (3×107 CFU/well) for 3 h in the presence or absence of Sc (3×106 yeasts/well) and 100 µl of culture supernatant were then harvested from the apical compartment, diluted and plated on agar in order to quantify the non cell-associated bacteria, (n = 4). (C) IPEC-1 cells were overnight pre-incubated with Sc (3×106 yeasts/well) and then exposed to ETEC (3×107 CFU/well) for 3 h. Apical IPEC-1 cell culture supernatant was harvested and physical interaction between Sc and ETEC was observed by phase contrast microscopy (x 1000). Data are presented as means ± SEM, asterisks denote: * (P<0.05), *** (P<0.001). (A, B) Data are representatives of two independent experiments.
Figure 7Saccharomyces cerevisiae failed to preserve the barrier function.
Measurement of transepithelial electrical resistance (TER) in differentiated IPEC-1 cells untreated, pre-incubated with Sc (3×106 yeasts/well), exposed to ETEC (3×107 CFU/well) or pre-incubated with Sc and then exposed with ETEC. Data are presented as means ± SEM, (n = 4). Data are representative of two independent experiments, asterisks denote: *** (P<0.001).