Literature DB >> 21299863

Polymorphic microsatellites in the human bloodfluke, Schistosoma japonicum, identified using a genomic resource.

Ning Xiao1, Justin Remais, Paul J Brindley, Dongchuan Qiu, Robert Spear, Yang Lei, David Blair.   

Abstract

Re-emergence of schistosomiasis in regions of China where control programs have ceased requires development of molecular-genetic tools to track gene flow and assess genetic diversity of Schistosoma populations. We identified many microsatellite loci in the draft genome of Schistosoma japonicum using defined search criteria and selected a subset for further analysis. From an initial panel of 50 loci, 20 new microsatellites were selected for eventual optimization and application to a panel of worms from endemic areas. All but one of the selected microsatellites contain simple tri-nucleotide repeats. Moderate to high levels of polymorphism were detected. Numbers of alleles ranged from 6 to 14 and observed heterozygosity was always >0.6. The loci reported here will facilitate high resolution population-genetic studies on schistosomes in re-emergent foci.

Entities:  

Mesh:

Substances:

Year:  2011        PMID: 21299863      PMCID: PMC3042964          DOI: 10.1186/1756-3305-4-13

Source DB:  PubMed          Journal:  Parasit Vectors        ISSN: 1756-3305            Impact factor:   3.876


Findings

The Asian bloodfluke, Schistosoma japonicum, causes serious human disease in several parts of eastern Asia, and in particular in China where more than 30 million people living in the tropical and subtropical zones are at risk [1]. On the heels of widespread progress in controlling S. japonicum over the past two decades [2], China is facing the challenges posed by re-emergence of schistosomiasis in localities where control activities have nearly ceased and where apparent elimination had been achieved [2,3]. In comparison to traditional assessment methods, molecular tools will be increasingly important as China targets regions with low prevalence and low infection intensity for elimination [4-6] on the path to reducing schistosome infection to less than 1% by 2015 [2]. Such tools will be important for high-resolution monitoring of infections in snails and in mammalian hosts, elucidating transmission networks, and improving the targeting of interventions to achieve final elimination of the disease. This important pathogen has already received attention from population geneticists using microsatellites [7,8]. Most of the loci used had been found by examination of the GenBank accessions for S. japonicum data existing at that time or through testing of primers that amplified microsatellite loci in another bloodfluke, S. mansoni. A near-complete draft genome of S. japonicum has been released by the Chinese Human Genome Center in Shanghai [9] and the raw data are available at http://lifecenter.sgst.cn/schistosoma/cn/schistosomaCnIndexPage.do. An earlier study [10] reported 17 loci from this resource. In this study we report on additional loci suitable for research into gene flow in S. japonicum in Sichuan Province. Results of this search are presented here. We searched this resource for microsatellite loci using the following criteria: • Repeats should be 2, 3 or 4-mer, • The number of tandem repeats should be in the range 10-25, • Loci should not include compound repeats, • Loci should be flanked by single-copy DNA sequences to which PCR primers could be targeted, • Loci should be far apart so as to avoid linkage disequilibrium. In practice, since chromosomal assignment of super-contigs is unknown as yet, loci were selected from different super-contigs, • Loci should not be in, or close to, known or predicted coding regions. The search was undertaken using the software SciRoKo [11]. Following the above criteria, we identified 72 new loci for which primers were designed and synthesized. For 30 loci showing a single band of the correct size in a preliminary screening using an agarose gel, new forward primers were synthesized to permit M13 tailing [12,13]. All 30 loci were then used for genotyping of ten adult worms. Loci failing to provide clear signals in the expected size range, or that lacked polymorphism, were not considered further. Finally 20 new loci, plus two from [10], were optimized for PCR and used in the genotyping of 20 individual adult worms. Primer annealing temperatures were designed to be very similar with eventual multiplexing in mind. The Sichuan Center for Disease Control and Prevention (SCDC) maintains S. japonicum lifecycles, including S. japonicum from infected snails sourced from Hubei and Anhui Provinces passed through rabbit hosts. For this study, existing samples were obtained from SCDC of adult schistosomes that were derived from a single passage of mixed Hubei and Anhui cercariae through a definitive host. Genomic DNA was extracted from 10 individual male and 10 female worms by incubation in hot sodium hydroxide with pH adjustment using a Tris solution (HotSHOT) [14]. The lysates were used as templates for PCR directly. Each worm was genotyped individually. All PCRs were carried out in a 10 μl reaction mixture containing 0.5 μl of template DNA (about 17.5 ng), 0.5 μM of each primer but 0.125 μM of any forward primer with an M13 tail, and 5 μl of 2X GoTaq Green Master Mix (Promega Corporation, WI, USA). For PCR amplification, templates were denatured at 94°C for 5 minutes followed by 30 cycles (94°C 30 seconds, 55°C 45 seconds, 72°C 45 seconds), and then by 8 cycles ( 94°C 30 seconds, 53°C 45 seconds, 72°C 45 seconds), and a final extension at 72°C for 10 minutes. PCR products were separated using an ABI 3130 XL automated DNA sequencer with ABI GS500 LIZ internal size standards. Results were read in GeneMapper 4.0 software (Applied Biosystems). Estimates of heterozygosity were made, tests conducted for Hardy-Weinberg equilibrium and linkage disequilibrium, and alleles counted. The software package GenAlEx [15] was used for most data analysis. Micro-Checker [16] was used to identify loci at which null (non-amplifying) alleles might be present. Use of the Bonferroni-adjusted 95% confidence interval indicates that null alleles may occur only at locus SjP9, one of the loci reported by [10]. Table 1 presents the findings for each locus, including numbers of alleles and observed heterozygosity (H). Observed heterozygosity (Ho) at all loci was high, never below 0.6. A few loci deviated significantly from Hardy Weinberg expectations (Table 1), including SjP9 at which null alleles were suspected. Surprisingly, many pairs of loci were in linkage disequilibrium (data not shown). We consider this to be a consequence of the fact that adult worms were derived from pooled cercariae from infected snails: each snail is likely to yield many sibling/clonal cercariae, resulting in significant linkage disequilibrium (e.g. [10]). The pooling of cercariae from two distinct populations is likely to increase this effect. Previous workers [7] noted a high frequency of linkage disequilibrium in S. japonicum and considered it due to inbreeding and non-random mating.
Table 1

Primer sequences and other characteristics for each of 22 microsatellite loci amplified from 20 specimens of Schistosoma japonicum

Locus namePrimer sequences (tails removed)Repeat unitLength of locus in Sj Genome draft (excl tails)Length range (PCR product - bp excl tail)No. of allelesIn HWE?HoHe
SjP4F:ACAAGCTCCAATCGTCTCTGA R:GAATACTGCCGCCCTTGTAATAA217182-244140.7890.831

SjP9F:GATGAAACAGATACCCAGCAC R:TGCATGTAAAAATGGCTTGCTAA283239-30114**0.6000.915

SjP18F:TCCTTTATCTGGGCTGTGGA R:TTTCAGCAGGATAACATGACGTGA286261-29870.6840.703

SjP19F:GGTATCTTCGCTTTTTAGCATGGR:TCCTAGGGTGTGGTATCAGAGATT196161-25712**0.7370.896

SjP22F:CAAAGCCTAAACGTCATAGACAG R:CAACCACCGATAAGTAGAGTGGATTA150105-16711*0.8500.892

SjP23F:GTACGATATGAGGGAAAGTTCA R:CTCTCCTTCAGACGAATTGAGTAA219192-253141.000.933

SjP26F:CAAGGGAACATTGTACATGAAG R:TGGTAAAGGAGAAAGTGAACGTAA307229-31270.7000.659

SjP28F:TAACGCCTTTTCCCACATTC R:ATAACCACGATGGGAACCAATTA242232-26913**0.9000.926

SjP32F:TGTCACCGAGTCTTCATTAGC R:ACAGTCAGTAGACCTGGATAAACTTA175142-192140.9500.929

SjP34F:GGCGACCATACATAAGGAGAAT R:GACCGATTTCTAATGGAGCATAA409381-43013*0.7780.908

SjP37F:TCCTTGACACGAGGTACATGT R:ATTACGTAACAGAAGGCTGGATAT290240-31480.8330.714

SjP39F:GACGACTGTTAAGTCCATCTGA R:ATAACCAATCTCCACGAAAGCATT239223-25180.9000.871

SjP42F:GCTGCAGCTTCTGTGTAGTAA R:GTCTTGCTCAGATCAGTTCGTTAA216199-23490.9500.855

SjP43F:ACAATGGCTATTGGTTGAGTAG R:GGAGCATGCGTATATGGAAAATAA188184-23590.7500.854

SjP45F:ATAACACCGAATCTGTTCAGC R:TAATCCGGTCAGGATGTATGTTAT156150-244130.8500.921

SjP48F:TTGTTGGGTAGTGATGGTAGG R:TAGTTCATTCCACCTCTTGGATAA246251-27360.6500.795

SjP54F:TTAGGCTTGTTGGTGCTGATA R:AGGTAAAGCAAATCCCATAGCGGTA437373-44691.000.712

SjP58F:TCCCAGTACCAATGTAGATGTG R:CTAATAAAGTCGTCAAGGAGCAAAT227439-49912**0.8000.921

SjP60F:CGATTCATTCATAGCCTGACT R:GAATCCCATCACAGATTAACGTAT155134-165100.9000.867

SjP61F:TCATCTTGTCACCAACTAGGC R:GCTTGGAGGAGGCTAAAATACTAT188158-23890.7000.679

SjP63F:ACCGCCACTACCACTAACCTCA R:TTGACCTGAAATCTGTCCCTATAA390333-38913**0.8000.904

SjP88F:GCTTTCCAGGCATAAACTTCAC R:TCTCCTAATGATGGGAACAGTAA408380-41790.9500.887

Sequences of microsatellites reported here have been deposited in GenBank [AB604199 - AB604218].

Note that the first two loci are from [10] and are included for comparative purposes.

The annealing temperature of PCRs for all loci is 55°C

* P < 0.05 ** P < 0.01 as determined in GenAlEx.

Primer sequences and other characteristics for each of 22 microsatellite loci amplified from 20 specimens of Schistosoma japonicum Sequences of microsatellites reported here have been deposited in GenBank [AB604199 - AB604218]. Note that the first two loci are from [10] and are included for comparative purposes. The annealing temperature of PCRs for all loci is 55°C * P < 0.05 ** P < 0.01 as determined in GenAlEx. The loci presented here are likely to be specific for S. japonicum. Blast searches of the draft genome of S. mansoni (http://www.sanger.ac.uk/Projects/S_mansoni/) failed to find any matches that would indicate conservation of flanking regions in both species (not shown). Searches of the draft genome of S. japonicum yielded only a single "hit" for each locus. The microsatellite loci reported here are, with one exception (SjP54), perfect trinucleotide repeats, making scoring easier than for dinucleotide and/or compound repeats. The diversity of alleles and genotypes present in the populations we sampled demonstrate the utility of these markers for future studies on epidemiology of S. japonicum in eastern Asia. Finally, the obvious genetic diversity within field populations of S. japonicum in China demonstrated by these polymorphic microsatellite loci confirms the recent report of marked genetic diversity in this parasite detected by analysis of the S. japonicum transcriptome and proteome [4].

Authors' contributions

NX, JR, PB and DB conceived of and designed the study, and were assisted by DQ and RS who coordinated the study. NX and YL carried out the molecular genetic studies, and were assisted by JR, PB and DB in analysing the results. NX, JR, PB and DB drafted the manuscript. All authors read and approved the final manuscript.

Competing interests

The authors declare that they have no competing interests.
  13 in total

1.  An economic method for the fluorescent labeling of PCR fragments.

Authors:  M Schuelke
Journal:  Nat Biotechnol       Date:  2000-02       Impact factor: 54.908

2.  Preparation of PCR-quality mouse genomic DNA with hot sodium hydroxide and tris (HotSHOT).

Authors:  G E Truett; P Heeger; R L Mynatt; A A Truett; J A Walker; M L Warman
Journal:  Biotechniques       Date:  2000-07       Impact factor: 1.993

3.  Re-emerging schistosomiasis in hilly and mountainous areas of Sichuan, China.

Authors:  Song Liang; Changhong Yang; Bo Zhong; Dongchuan Qiu
Journal:  Bull World Health Organ       Date:  2006-02-23       Impact factor: 9.408

4.  SciRoKo: a new tool for whole genome microsatellite search and investigation.

Authors:  Robert Kofler; Christian Schlötterer; Tamas Lelley
Journal:  Bioinformatics       Date:  2007-04-26       Impact factor: 6.937

5.  An insight into the genetic variation of Schistosoma japonicum in mainland China using DNA microsatellite markers.

Authors:  Jaya Shrivastava; Bao Zhen Qian; Gilean Mcvean; Joanne P Webster
Journal:  Mol Ecol       Date:  2005-03       Impact factor: 6.185

6.  The Schistosoma japonicum genome reveals features of host-parasite interplay.

Authors: 
Journal:  Nature       Date:  2009-07-16       Impact factor: 49.962

7.  Multiple near-identical genotypes of Schistosoma japonicum can occur in snails and have implications for population-genetic analyses.

Authors:  Mingbo Yin; Wei Hu; Xiaojin Mo; Shengyue Wang; Paul J Brindley; Donald P McManus; George M Davis; Zheng Feng; David Blair
Journal:  Int J Parasitol       Date:  2008-06-12       Impact factor: 3.981

8.  GenAlEx 6.5: genetic analysis in Excel. Population genetic software for teaching and research--an update.

Authors:  Rod Peakall; Peter E Smouse
Journal:  Bioinformatics       Date:  2012-07-20       Impact factor: 6.937

9.  New perspectives on host-parasite interplay by comparative transcriptomic and proteomic analyses of Schistosoma japonicum.

Authors:  Feng Liu; Jiong Lu; Wei Hu; Sheng-Yue Wang; Shu-Jian Cui; Ming Chi; Qing Yan; Xin-Rong Wang; Huai-Dong Song; Xue-Nian Xu; Ju-Jun Wang; Xiang-Lin Zhang; Xin Zhang; Zhi-Qin Wang; Chun-Liang Xue; Paul J Brindley; Donald P McManus; Peng-Yuan Yang; Zheng Feng; Zhu Chen; Ze-Guang Han
Journal:  PLoS Pathog       Date:  2006-04-14       Impact factor: 6.823

10.  Quantitative detection of Schistosoma japonicum cercariae in water by real-time PCR.

Authors:  Yuen Wai Hung; Justin Remais
Journal:  PLoS Negl Trop Dis       Date:  2008-11-18
View more
  10 in total

1.  Approaches to genotyping individual miracidia of Schistosoma japonicum.

Authors:  Ning Xiao; Justin V Remais; Paul J Brindley; Dong-Chuan Qiu; Elizabeth J Carlton; Rong-Zhi Li; Yang Lei; David Blair
Journal:  Parasitol Res       Date:  2013-09-08       Impact factor: 2.289

2.  Genome-wide characterization of microsatellites and marker development in the carcinogenic liver fluke Clonorchis sinensis.

Authors:  Thao T B Nguyen; Yuji Arimatsu; Sung-Jong Hong; Paul J Brindley; David Blair; Thewarach Laha; Banchob Sripa
Journal:  Parasitol Res       Date:  2015-03-19       Impact factor: 2.289

3.  Comparison of genetic diversity and population structure between two Schistosoma japonicum isolates--the field and the laboratory.

Authors:  Chao-Rong Bian; Yu-Meng Gao; Poppy H L Lamberton; Da-Bing Lu
Journal:  Parasitol Res       Date:  2015-03-25       Impact factor: 2.289

Review 4.  Genomes and geography: genomic insights into the evolution and phylogeography of the genus Schistosoma.

Authors:  Scott P Lawton; Hirohisa Hirai; Joe E Ironside; David A Johnston; David Rollinson
Journal:  Parasit Vectors       Date:  2011-07-07       Impact factor: 3.876

5.  Characterisation of a novel panel of polymorphic microsatellite loci for the liver fluke, Fasciola hepatica, using a next generation sequencing approach.

Authors:  Krystyna Cwiklinski; Katherine Allen; James LaCourse; Diana J Williams; Steve Paterson; Jane E Hodgkinson
Journal:  Infect Genet Evol       Date:  2015-03-19       Impact factor: 3.342

6.  Detecting genotyping errors at Schistosoma japonicum microsatellites with pedigree information.

Authors:  Yu-Meng Gao; Da-Bing Lu; Huan Ding; Poppy H L Lamberton
Journal:  Parasit Vectors       Date:  2015-09-08       Impact factor: 3.876

7.  Phylogeny and virulence divergency analyses of Toxoplasma gondii isolates from China.

Authors:  Min Li; Xu-Wei Mo; Lin Wang; He Chen; Qing-Li Luo; Hui-Qin Wen; Wei Wei; Ai-Mei Zhang; Jian Du; Fang-Li Lu; Zhao-Rong Lun; Ji-Long Shen
Journal:  Parasit Vectors       Date:  2014-03-28       Impact factor: 3.876

8.  Identification and Characterization of Microsatellite Markers Derived from the Whole Genome Analysis of Taenia solium.

Authors:  Mónica J Pajuelo; María Eguiluz; Eric Dahlstrom; David Requena; Frank Guzmán; Manuel Ramirez; Patricia Sheen; Michael Frace; Scott Sammons; Vitaliano Cama; Sarah Anzick; Dan Bruno; Siddhartha Mahanty; Patricia Wilkins; Theodore Nash; Armando Gonzalez; Héctor H García; Robert H Gilman; Steve Porcella; Mirko Zimic
Journal:  PLoS Negl Trop Dis       Date:  2015-12-23

9.  An investigation into the potential effects of infrapopulation structure and other sources of sampling error, on population genetic studies of the transmission of Schistosoma japonicum (Trematoda: Digenea).

Authors:  Guan-Nan Huo; Liang Liu; Hong-Bin He; Stephen W Attwood
Journal:  Parasit Vectors       Date:  2016-03-21       Impact factor: 3.876

10.  The genetic variation of different developmental stages of Schistosoma japonicum: do the distribution in snails and pairing preference benefit the transmission?

Authors:  Meng-Jie Gu; Yan-Wei Li; Aidan M Emery; Shi-Zhu Li; Yong-Zhong Jiang; Hui-Fen Dong; Qin-Ping Zhao
Journal:  Parasit Vectors       Date:  2020-07-20       Impact factor: 3.876

  10 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.