Literature DB >> 20463892

Heterologous expression and maturation of an NADP-dependent [NiFe]-hydrogenase: a key enzyme in biofuel production.

Junsong Sun1, Robert C Hopkins, Francis E Jenney, Patrick M McTernan, Michael W W Adams.   

Abstract

Hydrogen gas is a major biofuel and is metabolized by a wide range of microorganisms. Microbial hydrogen production is catalyzed by hydrogenase, an extremely complex, air-sensitive enzyme that utilizes a binuclear nickel-iron [NiFe] catalytic site. Production and engineering of recombinant [NiFe]-hydrogenases in a genetically-tractable organism, as with metalloprotein complexes in general, has met with limited success due to the elaborate maturation process that is required, primarily in the absence of oxygen, to assemble the catalytic center and functional enzyme. We report here the successful production in Escherichia coli of the recombinant form of a cytoplasmic, NADP-dependent hydrogenase from Pyrococcus furiosus, an anaerobic hyperthermophile. This was achieved using novel expression vectors for the co-expression of thirteen P. furiosus genes (four structural genes encoding the hydrogenase and nine encoding maturation proteins). Remarkably, the native E. coli maturation machinery will also generate a functional hydrogenase when provided with only the genes encoding the hydrogenase subunits and a single protease from P. furiosus. Another novel feature is that their expression was induced by anaerobic conditions, whereby E. coli was grown aerobically and production of recombinant hydrogenase was achieved by simply changing the gas feed from air to an inert gas (N2). The recombinant enzyme was purified and shown to be functionally similar to the native enzyme purified from P. furiosus. The methodology to generate this key hydrogen-producing enzyme has dramatic implications for the production of hydrogen and NADPH as vehicles for energy storage and transport, for engineering hydrogenase to optimize production and catalysis, as well as for the general production of complex, oxygen-sensitive metalloproteins.

Entities:  

Mesh:

Substances:

Year:  2010        PMID: 20463892      PMCID: PMC2865534          DOI: 10.1371/journal.pone.0010526

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

From the human economic perspective, molecular hydrogen (H2) is an ideal form of transportable energy. It is superior to current forms such as gasoline as it is less toxic, safer to use, and has an approximately three-fold higher energy yield per kilogram [1]. A number of problems must be surmounted before a ‘hydrogen economy’ is a reality, however, including the economic production and transportation of H2 [2], [3]. At present H2 is generated from fossil fuels by steam reforming processes and by electrolysis of water using electricity typically produced from fossil fuels [1]–[3]. Biological H2 production is an attractive, and renewable, alternative for human needs. The gas is generated by microorganisms from all three domains of life, and for some, H2 provides an excellent source of low potential reducing power (H2/H+, Eo' = −420mV) for growth and biosynthesis [4], [5]. Microorganisms have evolved elegant and efficient mechanisms for H2 metabolism. All are based on the enzyme hydrogenase, which catalyzes the reversible reduction of protons (Eqn. 1): Many microorganisms obtain energy by metabolically coupling H2 oxidation to a variety of terminal electron acceptors such as fumarate, sulfate, carbon dioxide, and oxygen [4], [6]. The production of H2 is typical of organisms occupying anaerobic environments and is used as a means of disposing of excess reductant from oxidative metabolism. Hydrogenases catalyze H2 production using a binuclear metal center active site consisting of either [NiFe] or [FeFe] [6], [7]. The [FeFe]-hydrogenases usually have high catalytic rates but are extremely sensitive to irreversible inactivation by oxygen, much more so than the [NiFe]-enzymes [4]. In contrast to [FeFe]-hydrogenases, which are limited to certain bacteria and a few unicellular eukaryotes, [NiFe]-hydrogenases are widespread in both bacteria and archaea. Although these two classes of hydrogenase are not phylogenetically related, the geometry of their catalytic sites is highly similar [7], and both contain the unusual biological ligands carbon monoxide (CO) and cyanide (CN) which serve to modulate their electronic structure and facilitate catalysis [8]. All [NiFe]-hydrogenases are comprised of at least two subunits, one of which (the large subunit, or LSU) contains the [NiFe] catalytic site, while the other (the small subunit, or SSU) contains three iron-sulfur (FeS) clusters. These clusters transfer electrons from an external electron donor to the [NiFe] active site in the LSU for reduction of protons. The assembly of the [NiFe] site and maturation of the enzyme requires the concerted reactions of multiple gene products. The facultative anaerobe E. coli contains three membrane-bound hydrogenases, and elegant studies by Böck and coworkers have shown that the assembly of one of them (HYD3) requires the participation of eight accessory proteins (encoded by hypA-hypF, hycI, and slyD, Fig. 1a) [9]. The final step of hydrogenase maturation requires a specific protease (HycI) that removes a peptide of ≤20 residues from the C-terminal of the LSU, allowing the protein to fold around the [NiFe] active site [12]. In contrast, it appears that only three maturation proteins are required for the production of a functional [FeFe]-hydrogenase [13].
Figure 1

Synthesis of P. furiosus soluble hydrogenase I (SHI) and the plasmid constructs used for recombinant production.

(a) Maturation pathway for the [NiFe] catalytic site of P. furiosus SHI is based on that proposed for E. coli hydrogenase 3 [10]. HypE and HypF generate thiocyanate in an ATP-dependent process from carbamoyl phosphate (CP). The source of the CO ligand is unknown. The HypCD complex binds the iron atom containing the CN and CO ligands and donates it to the catalytic subunit (PF0894). The Ni atom is provided by the HypAB-SlyD complex in a GTP-dependent reaction. The Ni and Fe atoms in the [NiFe] site are coordinated to PF0894 by the S atoms of four of its Cys residues (indicated by S). Activation of PF0894 requires cleavage of four C-terminal residues (-VVRL) catalyzed by a newly identified peptidase, FrxA (and to a much lesser extent by HycI). It is not known how the biosynthesis of PF0894 is coordinated with that of the other three subunits (PF0891, PF0892 and PF0893) to give catalytically-active SHI. The predicted cofactor content of mature heterotetrameric SHI [11] is shown together with their roles in the reversible production of hydrogen gas from NADPH. The abbreviations used are: CP, carbamoyl phosphate; CO, carbonyl ligand; CN, cyano ligand; FAD, flavin adenine dinucleotide. (b) The expression plasmids utilized for production of SHI in E. coli strain MW4W. The antibiotics refer to the selective marker on each plasmid: Amp, Ampicillin; Sm, Streptomycin; Kan, Kanamycin; Cam, Chloramphenicol.

Synthesis of P. furiosus soluble hydrogenase I (SHI) and the plasmid constructs used for recombinant production.

(a) Maturation pathway for the [NiFe] catalytic site of P. furiosus SHI is based on that proposed for E. coli hydrogenase 3 [10]. HypE and HypF generate thiocyanate in an ATP-dependent process from carbamoyl phosphate (CP). The source of the CO ligand is unknown. The HypCD complex binds the iron atom containing the CN and CO ligands and donates it to the catalytic subunit (PF0894). The Ni atom is provided by the HypAB-SlyD complex in a GTP-dependent reaction. The Ni and Fe atoms in the [NiFe] site are coordinated to PF0894 by the S atoms of four of its Cys residues (indicated by S). Activation of PF0894 requires cleavage of four C-terminal residues (-VVRL) catalyzed by a newly identified peptidase, FrxA (and to a much lesser extent by HycI). It is not known how the biosynthesis of PF0894 is coordinated with that of the other three subunits (PF0891, PF0892 and PF0893) to give catalytically-active SHI. The predicted cofactor content of mature heterotetrameric SHI [11] is shown together with their roles in the reversible production of hydrogen gas from NADPH. The abbreviations used are: CP, carbamoyl phosphate; CO, carbonyl ligand; CN, cyano ligand; FAD, flavin adenine dinucleotide. (b) The expression plasmids utilized for production of SHI in E. coli strain MW4W. The antibiotics refer to the selective marker on each plasmid: Amp, Ampicillin; Sm, Streptomycin; Kan, Kanamycin; Cam, Chloramphenicol. In the present study we demonstrate for the first time the heterologous expression in a genetically-tractable organism (E. coli) of a functional [NiFe]-hydrogenase enzyme, that from a model hyperthermophilic microorganism, Pyrococcus furiosus (Pf), which grows optimally at 100°C [14]. Previous attempts to heterologously produce [NiFe]-hydrogenases have involved related host organisms and/or have met with limited success. For example, Desulfovibrio gigas hydrogenase produced in D. fructosovorans exhibited only low activity [15], and transfer of the entire H2 uptake (hup) gene cluster (∼18 kb) from Rhizobium leguminosarum led to functional expression in only some closely-related species [16]. A functional, NAD-dependent [NiFe] hydrogenase from a gram-positive organism, Rhodococcus opacus, was produced in the gram-negative Ralstonia eutropha [17], and the membrane bound hydrogenase of Ralstonia eutropha was produced in Pseudomonas stutzeri using a broad-host-range plasmid containing the hyp genes and a regulatory hydrogenase-histidine kinase system [18]. This H2-sensing, regulatory hydrogenase of R. eutropha has also been heterologously produced in E. coli but this does not require the proteolytic processing involved in maturation of the [NiFe]-hydrogenase enzymes [19]. While previous attempts to heterologously produce a recombinant [NiFe]-hydrogenase in E. coli have been unsuccessful [20], [21], our system employs a novel set of compatible vectors modified with an anaerobically-induced E. coli hydrogenase promoter, Phya, and minimally requires a single processing gene from Pf. It therefore appears that the E. coli processing enzymes can assemble functional (and soluble) [NiFe]-hydrogenase enzyme from phylogenetically distant organisms, even from a completely different domain of life, including those growing at extreme temperatures. Pf grows by fermenting carbohydrates to organic acids, CO2 and H2 [14]. It contains three [NiFe]-hydrogenases; two are cytoplasmic enzymes consisting of four subunits, and the third is a membrane-bound hydrogenase (MBH) of fourteen subunits. The two cytoplasmic enzymes, termed soluble hydrogenase I (SHI) and hydrogenase II (SHII), utilize NADP(H) as the physiological electron carrier [22]. MBH accepts electrons from reduced ferredoxin (Fdred) and is the enzyme responsible for evolving hydrogen during growth, while SHI and SHII are thought to be involved in the recycling of hydrogen produced by MBH [23]. Herein we demonstrate heterologous production of functional PfSHI.

Results

Pf SHI is encoded by four genes (PF0891-0894) in a single operon, with the catalytic LSU encoded by PF0894 and SSU encoded by PF0893 [22]. One of the additional subunits is predicted to contain two FeS clusters (PF0891) while the other (PF0892) is predicted to contain another FeS cluster and flavin adenine dinucleotide (FAD), and to interact with NAD(P)(H). SHI purified from P. furiosus biomass is extremely stable at high temperatures (t1/2 for loss of activity ∼2 hours at 100°C) and in the presence of oxygen (t1/2 ∼6 hours at 23°C in air) [11]. The four structural genes encoding Pf SHI (PF0891-PF0894) were coexpressed in E. coli under anaerobic conditions with eight processing genes identified in the Pf genome (hypCDABEF, hycI and slyD), based on sequence similarity to the processing genes identified in E. coli. These include PF0617, which is the homolog of the E. coli peptidase (HycI) involved in C-terminal processing of one of its three hydrogenases, termed HYD3. However, the C-terminal region of Pf SHI is more similar to the catalytic subunit of another E. coli hydrogenase, HYD2, rather than to HYD3, and HYD2 is processed by another protease (HybD) [24]. A search of the Pf genome revealed a gene (PF0975), annotated as ferredoxin oxidoreductase A (frxA), which shows 47% sequence similarity to E. coli HybD. This was included as the ninth Pf gene to be coexpressed in E. coli under anaerobic conditions. A series of four compatible vectors based on the DUET vector system (Novagen) had been modified previously to contain GATEWAY™ recombination sites (Invitrogen) [25], which allows coexpression of as many as eight separate genes or operons under the control of T7 promoters. This cloning approach also inserts 19 amino acids (GSITSLYKKAGSENYFQGG, ∼2.0 kDa) at the N-terminus of the first gene of the operon in each plasmid. Since the standard T7 promoter does not function in E. coli under anaerobic conditions, four different promoters were investigated for anaerobic heterologous expression of the Pf genes in E. coli. Three were native E. coli hydrogenase promoters that are anaerobically-induced (hya, hyb, and hyc, [26]-[28]), while the fourth (hyp, [29]) induces expression of E. coli hydrogenase-processing genes. Expression of the lacZ gene by these four promoters (Fig. 2) and several of the Pf hyd genes, including hypCDAB and hycI, were examined using RT-PCR (data not shown). The hya promoter (Phya) was induced by anaerobiosis and gave the highest level of expression. The T7 promoters on all expression vectors were therefore replaced with Phya (Fig. 3). One vector (pDEST-C3A) was further modified to include the tRNA genes from plasmid pRIL (Stratagene), which is typically required for efficient expression of Pf genes in E. coli due to differing codon usage, creating the plasmid pC3A-RIL. The complete list of expression vectors used in this study is given in Table 1.
Figure 2

Analysis of E. coli promoters with a lacZ gene fragment β-galactosidase reporter assay.

Plasmids were transformed into DH10B. The specific activity of lacZ was measured by a modified Miller [30] assay calculated as 200(OD420-t1-OD420-t2) min−1mg−1, where t1 and t2 are the start and end time points, respectively.

Figure 3

Plasmid construction for rSHI production in E. coli.

Phya was cloned into a set of patented plasmids constructed by inserting Invitrogen Gateway cassettes into Novagen Duet plasmids [25]. (a) Sequences of E. coli anaerobic promoter Phya, attB1 and TEV protease recognition site sequence and their encoded peptide sequence [31]. (b) Elements constructed in the final expression plasmids: Phya promoter, N-terminus of the first protein in the operon derived from the Gateway recombination cloning site (attB1) including a TEV protease site [31] and P. furiosus genes. (c) Artificial Shine-Dalgarno sequences inserted between P. furiosus fused ORFs in plasmids pC11A2-CDABI, pC3AR2-SdFa and pRA2-EF.

Table 1

Strains and plasmids used in this study.

Strains and plasmidsGenotypeSource
Strains
E. coli MW1001 lacI q rrnB T14 ΔlacZ WJ16 hsdR514 ΔaraBAD AH33 ΔrhaBAD LD78 ΔhyaB ΔhybCΔhycE 32
E. coli DH10B F endA1 recA1 galE15 galK16 nupG rpsL ΔlacX74 Φ80lacZΔM15 araD139 Δ(ara,leu)7697 mcrA Δ(mrr-hsdRMS-mcrBC) λ Invitrogen
E. coli MW4WMW1001 strain with plasmids: pC11A2-CDABI/pC3AR2-SF/pRA2-EF/pEA2-SH1This study
Plasmids
a. lacZ reporter plasmids
pSB2019AmpR PxylA-GFP33
pLXAAmpR Phya-lacZThis study
pLXBAmpR Phyb-lacZThis study
pLXCAmpR Phyc-lacZThis study
pLXPAmpR Phyp-lacZThis study
b. Destination and Expression plasmids
pDEST-C1Cloning vector, SmR 25
pDEST-C11A2Cloning vector, SmR This study
pC11A2-CDABIExpression vector, SmR This study
pDEST-C3Cloning vector, CmR 25
pDEST-C3ACloning vector, CmR This study
pRILExpress tRNA argU/ileY/leuW, CmR Stratagene
pC3A-RIL* Cloning vector, CmR This study
pC3AR2-slyD* Expression vector, CmR This study
pC3AR2-SdFa* Expression vector, CmR This study
pET-CAG2Cloning vector, AmpR This study
pEA2-SH1Expression vector, AmpR This study
pET-A-SH1Expression vector, AmpR This study
pRSFDuet-1Cloning vector, KanR Novagen
pRSF-CAG2Cloning vector, KanR This study
pRA2-EFExpression vector, KanR This study

*Contain tRNA genes argU/ileY/leuW.

Analysis of E. coli promoters with a lacZ gene fragment β-galactosidase reporter assay.

Plasmids were transformed into DH10B. The specific activity of lacZ was measured by a modified Miller [30] assay calculated as 200(OD420-t1-OD420-t2) min−1mg−1, where t1 and t2 are the start and end time points, respectively.

Plasmid construction for rSHI production in E. coli.

Phya was cloned into a set of patented plasmids constructed by inserting Invitrogen Gateway cassettes into Novagen Duet plasmids [25]. (a) Sequences of E. coli anaerobic promoter Phya, attB1 and TEV protease recognition site sequence and their encoded peptide sequence [31]. (b) Elements constructed in the final expression plasmids: Phya promoter, N-terminus of the first protein in the operon derived from the Gateway recombination cloning site (attB1) including a TEV protease site [31] and P. furiosus genes. (c) Artificial Shine-Dalgarno sequences inserted between P. furiosus fused ORFs in plasmids pC11A2-CDABI, pC3AR2-SdFa and pRA2-EF. *Contain tRNA genes argU/ileY/leuW. To facilitate detection of heterologously-produced Pf SHI, all four vectors (Fig. 1b) were co-transformed into an E. coli strain MW1001 lacking the catalytic subunits of its own hydrogenases (ΔhyaB ΔhybC ΔhycE) [32]. Strain MW1001 produces no H2 during anaerobic growth, and cell extracts have no detectable hydrogenase activity at either 37 or 80°C (using the standard assay of methyl viologen (MV)-linked H2 evolution vide infra). However, cell-free extracts of anaerobically-grown E. coli MW1001 containing the four vectors encoding Pf SHI and the Pf hydrogenase processing genes did show hydrogenase activity at 80°C (Fig. 4a), which must therefore arise from recombinant Pf hydrogenase I.
Figure 4

Accessory proteins required for maturation of recombinant P. furiosus SHI in vivo and in vitro.

(a) Recombinant SHI (rSHI) was expressed in the presence of different Pf processing genes and the resulting E. coli cell-extracts were assayed at 80°C. The bars indicate methyl viologen-linked specific activity expressed as U mg−1 or µmol H2 evolved min−1 mg−1. FrxA but not SlyD is necessary to produce high amounts of active hydrogenase. (b) Processing of rSHI in cell-free extracts of E. coli by FrxA and HycI of P. furiosus. An E. coli cell-extract containing rSHI (PF0891-0894) as the only expressed Pf genes, was added to another cell-extract containing only either FrxA or HycI as the only expressed Pf genes. The mixtures were incubated for 30 min at the indicated temperature and the specific activity was determined at 80°C by the methyl viologen-linked assay.

Accessory proteins required for maturation of recombinant P. furiosus SHI in vivo and in vitro.

(a) Recombinant SHI (rSHI) was expressed in the presence of different Pf processing genes and the resulting E. coli cell-extracts were assayed at 80°C. The bars indicate methyl viologen-linked specific activity expressed as U mg−1 or µmol H2 evolved min−1 mg−1. FrxA but not SlyD is necessary to produce high amounts of active hydrogenase. (b) Processing of rSHI in cell-free extracts of E. coli by FrxA and HycI of P. furiosus. An E. coli cell-extract containing rSHI (PF0891-0894) as the only expressed Pf genes, was added to another cell-extract containing only either FrxA or HycI as the only expressed Pf genes. The mixtures were incubated for 30 min at the indicated temperature and the specific activity was determined at 80°C by the methyl viologen-linked assay. In order to determine the minimum number of Pf genes needed for assembly of an active form of SHI in E. coli, different Pf accessory genes and plasmids were omitted from the complete heterologous expression system (Fig. 4a and Fig. 5). The results show that maximal recombinant production of functional SHI, as measured by the specific activity in the cell-free extract at 80°C, requires, in addition to the structural genes (PF0891-PF0894), coexpression of only the plasmid containing frxA (PF0975) (Fig. 4a). FrxA is, therefore, the protease required to process SHI by removing the four C-terminal –VVRL residues (Fig. 1a). Low activity was detected if HycI was present, but there was no activity if both proteases were absent, showing that E. coli proteases cannot process SHI. The E. coli processing enzymes HypABCD and HypEF appear to assemble a functional SHI whose catalytic subunit (PF0894) lacks C-terminal processing. This was confirmed both in vivo (Fig. 5) and using an in vitro assay (Fig. 4b) where extracts from E. coli cells expressing either only the four structural genes for SHI or only frxA were mixed and SHI activity was measured after incubation at 80°C. As expected, much lower SHI activity was obtained if hycI replaced frxA. Surprisingly, unprocessed SHI (where PF0894 lacks C-terminal cleavage) appears to be stable in E. coli, which will be of great utility to those interested in studying the mechanism of assembly of the [NiFe] site. The minimal expression system in E. coli therefore contains five Pf genes encoding only SHI and FrxA.
Figure 5

Analysis of the P. furiosus maturation proteins required to produce active rSHI in E. coli.

The specific activities are shown for rSHI in cell extracts of E. coli resulting from the co-expression of different Pf processing genes in E. coli MW1001. Bars indicate MV-linked specific activity (µmol H2 evolved min−1 mg−1). All cell extracts were heated for 30 min at 80°C prior to assay.

Analysis of the P. furiosus maturation proteins required to produce active rSHI in E. coli.

The specific activities are shown for rSHI in cell extracts of E. coli resulting from the co-expression of different Pf processing genes in E. coli MW1001. Bars indicate MV-linked specific activity (µmol H2 evolved min−1 mg−1). All cell extracts were heated for 30 min at 80°C prior to assay. Recombinant PfSHI (rSHI) was purified from E. coli strain MW4W (Fig. 6a, Table 2) to a final specific activity of 100 U mg−1, which is comparable to that of the native enzyme purified from P. furiosus biomass (Fig. 6b). The hydrogenase was obtained as a homogeneous protein of MW ∼150,000 Da (based on size-exclusion chromatography, data not shown), also similar to that of the native enzyme, and contained the four different protein subunits (Fig. 6a) [11]. Comparison of the properties of the recombinant and native enzymes (Fig. 6b) demonstrate that rSHI is similar in specific activity, affinity for NADPH (apparent Km), stability upon oxygen exposure, and metal content. The only significant difference is the lower stability of rSHI at 90°C. This was not due to the additional N-terminal residues (∼2 kDa) on one of the subunits (PF0891, due to the Gateway cloning strategy) since the properties of the wild-type form of rSHI, obtained by recloning PF0891-PF0894 to include only the wild-type amino acid sequence (pET-A-SHI, Fig. 7), and that of Gateway-tagged rSHI were virtually identical (data not shown).
Figure 6

Properties of recombinant P. furiosus SHI.

(a) Gel electrophoresis (SDS-PAGE) analysis of native and recombinant SHI. Bands representing the four subunits of the SHI are indicated, all of which were confirmed by MALDI-TOF analysis (data not shown). The high molecular weight band in the native protein, not seen in the recombinant version, represents undenatured tetrameric protein [11]. Recombinant PF0891 is approximately 2 kDa larger than the native protein due to the N-terminal extension (see Fig. 3). Molecular weight markers (kDa) are indicated. (b) Physical and catalytic properties of rSHI and the native hydrogenase purified from P. furiosus biomass. Hydrogen evolution was measured using either methyl viologen (MV) or NADPH as the electron donor at 80°C.

Table 2

Purification of recombinant P. furiosus SHI from E. coli.

StepUnits (µmol min−1)Protein (mg)Specific ActivityYield (%)Purification (-fold)
(Units mg−1)
Cell Extract (CE)1183372600.031001
Heat Treated CE128723810.510917
DEAE Sepharose78957316743
Phenyl Sepharose23745520166
Superdex S-200800.810073150
Figure 7

Maps of expression plasmids.

Plasmid pEA2-SHI and pET-A-SHI were used to express rSHI in E. coli, and pET-A-SHI was used to generate SHI with a Gateway sequence and TEV recognition site attached to the N-terminal of PF0891 subunit. The plasmid pC11A2-CDABI contains the operons hypCD and hypAB, hycI from P. furiosus. The operons hypCD and hypAB, hycI of P. furiosus were linked by an intergenic region shown in Figure 3c. The Gateway sequence is located at the N-terminus of the HypC protein. The plasmid pC3AR2-SdFa has slyD and frxA of P. furiosus cloned behind Phya, the recombinant SlyD has the N-terminal Gateway sequence/TEV site. Plasmid pRA2-EF was constructed to co-express HypE/HypF, the same linker as in the plasmid pC11A2-CDABI or pC3AR2-SdFa, is inserted between hypE and hypF gene, and HypE contains the N-terminal Gateway sequence.

Properties of recombinant P. furiosus SHI.

(a) Gel electrophoresis (SDS-PAGE) analysis of native and recombinant SHI. Bands representing the four subunits of the SHI are indicated, all of which were confirmed by MALDI-TOF analysis (data not shown). The high molecular weight band in the native protein, not seen in the recombinant version, represents undenatured tetrameric protein [11]. Recombinant PF0891 is approximately 2 kDa larger than the native protein due to the N-terminal extension (see Fig. 3). Molecular weight markers (kDa) are indicated. (b) Physical and catalytic properties of rSHI and the native hydrogenase purified from P. furiosus biomass. Hydrogen evolution was measured using either methyl viologen (MV) or NADPH as the electron donor at 80°C.

Maps of expression plasmids.

Plasmid pEA2-SHI and pET-A-SHI were used to express rSHI in E. coli, and pET-A-SHI was used to generate SHI with a Gateway sequence and TEV recognition site attached to the N-terminal of PF0891 subunit. The plasmid pC11A2-CDABI contains the operons hypCD and hypAB, hycI from P. furiosus. The operons hypCD and hypAB, hycI of P. furiosus were linked by an intergenic region shown in Figure 3c. The Gateway sequence is located at the N-terminus of the HypC protein. The plasmid pC3AR2-SdFa has slyD and frxA of P. furiosus cloned behind Phya, the recombinant SlyD has the N-terminal Gateway sequence/TEV site. Plasmid pRA2-EF was constructed to co-express HypE/HypF, the same linker as in the plasmid pC11A2-CDABI or pC3AR2-SdFa, is inserted between hypE and hypF gene, and HypE contains the N-terminal Gateway sequence.

Discussion

The ability of recombinant Pf SHI to accept electrons from the physiological electron carrier NADPH[22] is of some significance since this requires a properly processed, mature, and folded enzyme containing the FAD- (PF0892) and the FeS-containing (PF0891 and PF0892) subunits, in addition to catalytic LSU (PF0894) and SSU (PF0893). In contrast, electrons from the low potential artificial electron donor MV, which was used in all of the routine assays of hydrogenase activity, can theoretically be donated to any of the FeS clusters in the enzyme. The results (Fig. 6b) demonstrate that rSHI can accept electrons from NADPH as efficiently as the native enzyme, indicating that it is functionally folded and contains all cofactors. Like other hydrogenases, Pf SHI is much more active with an artificial redox dye (methyl viologen) than with its physiological electron carrier ([34], see Figure 6), nevertheless, the specific activity of H2 production from NADPH by Pf SHI is more than 6-fold higher than that reported for an NADH-dependent hydrogenase [34]. While the recombinant form of SHI is as active as the native enzyme at 80°C, it is not as thermostable (Figure 6). Interestingly, the native enzyme gives rise after SDS-electrophoresis to a protein band of ∼80 kDa, in addition to the four subunits. This band retains hydrogenase activity and is thought to represent a highly stable SDS-resistant residual form of the holoenzyme ([11], and Lane 1 of Figure 6). The lack of this additional band in the recombinant preparations (Figure 6) suggests that assembly of the recombinant hydrogenase is not completely correct, even though its catalytic activity indicates that it is functionally assembled. It is possible that holoenzyme assembly to the native-like form of SHI represents a kinetic problem, as speculated with other recombinant hydrogenases [15], since all known Pf accessory genes are present in the recombinant host. The availability of a system to produce rSHI provides a ready supply of the enzyme as well as the opportunity to generate mutant forms with desired characteristics. For example, it was recently demonstrated that a combination of NADPH-utilizing Pf SHI, obtained from native Pf biomass, with enzymes of the pentose phosphate pathway and starch phosphorylase, evolved H2 in vitro from starch with surprisingly high efficiency and yield [35]. Similarly, attempts have been made to link hydrogenase to the low potential reductant generated by photosynthesis, thereby constructing a light-driven H2-production system [36], [37]. A major problem is the generation of oxygen by photolysis of water, which inhibits the oxygen-sensitive hydrogenase. A functional expression system for hydrogenase provides the tools needed to engineer a hydrogenase enzyme resistant to O2 inactivation, as well for optimizing output of H2. Directed evolution techniques can now be utilized to generate [NiFe]-hydrogenases with tailored catalytic activity, oxygen sensitivity, and potentially even changing coenzyme specificity. There are also broader implications for heterologous production of complex, heteromeric metalloproteins. If E. coli does not possesses homologs of the required accessory genes for any candidate metalloprotein complex, coexpression of multiple genes involved in multiprotein complex assembly is now possible even under anaerobic conditions, and even for complex metalloproteins from extremophiles. While expression of stable hyperthermophilic proteins in E. coli is well-documented (e.g., see [38]), it is surprising that at least some of them, such as the Pf protease, are functional at 37°C, in this case to efficiently process Pf SHI in E. coli. The ability to heterologously produce and engineer a soluble hydrogenase, particularly one as thermostable and as relatively oxygen-insensitive as Pf SHI, makes this enzyme an excellent model system for future basic and also applied studies (e.g., [39]).

Methods

Strains and growth conditions

Escherichia coli strain MW1001 (lacI q rrnB T14 ΔlacZ WJ16 hsdR514 ΔaraBAD AH33 ΔrhaBAD LD78 ΔhyaBΔhybCΔhycE) [32] was a generous gift from Dr. Thomas K. Wood (Department of Civil and Environmental Engineering, Texas A & M University). E. coli strains were routinely grown in 2X YT [40] medium containing Ampicillin 50 µg/mL, Chloramphenicol 20 µg/mL, Streptomycin 25 µg/mL, Kanamycin 25 µg/mL, supplemented with 1 mM MgSO4. For anaerobic expression, an overnight culture was used to inoculate (1% vol/vol) 1 L of medium in a 2.8 L baffled Fernbach flask, and the culture was grown at 37°C shaking at 150 rpm under N2 for 3–5 hours to an OD600nm ∼0.8. Cultures were then decanted into 1 L bottles and 100 µM FeCl3, 25 µM NiSO4 and 56 mM glucose were added. The bottles were sealed with 43 mm Straight Plug stoppers (Wheaton, Millville, NJ) under N2, and incubated at 37°C with shaking at 120 rpm for 12–16 hours. For larger scale fermentations (15 L), cultures were grown aerobically as described above and were decanted into a carboy (20 L) and sealed under N2. The culture was allowed to grow anaerobically to induce expression and maturation of the recombinant hydrogenase for 14 hours. Cells were harvested by centrifugation at 10,000×g for 5 min. The cell pellets were flash frozen in liquid nitrogen and stored at −80°C before use. Molecular biology techniques were performed as described [40], and unless otherwise indicated, chemicals were obtained from Sigma-Aldrich (St. Louis, MO). All molecular biology reagents were utilized following the manufacturer's protocols and were obtained from New England Biolabs (Ipswich, MA), except for Pfu DNA polymerase (Stratagene, La Jolla, CA) and the reagents for GATEWAY™ recombination (Invitrogen, Carlsbad, CA).

Purification of recombinant P. furiosus SHI

All purification steps were performed under strictly anaerobic conditions. Frozen cell pellets were resuspended in Buffer A (50 mM Tris, 2 mM sodium dithionite (J.T. Baker, Phillipsburg, NJ), pH 8.0) containing 0.5 mg/mL lysozyme (Sigma) and 50 µg/mL deoxyribonuclease I (Sigma) in a ratio of 3 mL/g wet weight cells. The resuspended cells were incubated with stirring at room temperature under an atmosphere of argon for one hour and sonicated on ice with a Branson Sonifer 450 for 30 minutes (output 6.0, 50% duty cycle). Cell lysates were heated to 80°C for 30 minutes, cooled to room temperature, and centrifuged (Beckman L90K ultra centrifuge 45Ti rotor at 100,000×g for 1 hr). The supernatant was collected and loaded onto a DEAE anion exchange column (66 mL; GE Healthcare, Piscataway, NJ) equilibrated in Buffer A. The column was washed with 5 volumes of Buffer A and the proteins were eluted with a gradient of 0 to 500 mM NaCl in Buffer A over 20 column volumes and collected in 25 ml fractions in an anaerobic chamber. Fractions containing hydrogenase activity were pooled and Buffer A containing 2.0 M ammonium sulfate was added to a final concentration of 0.8 M. The sample was then loaded on to a column of Phenyl Sepharose (45 ml; GE Healthcare) equilibrated in Buffer C (Buffer A containing 0.8M (NH4)2S04). The column was washed with 5 volumes of Buffer C and eluted with a 20 column volume gradient from 0.8-0 M (NH4)2SO4 in Buffer A collected in 20 ml fractions. Fractions containing hydrogenase activity were combined and concentrated anaerobically by ultrafiltration (PM-30 kDa MWCO membrane, Millipore, Billerica, MA), and applied to a gel filtration column (Superdex S-200 26/60 GE Healthcare) equilibrated with Buffer D (Buffer A containing 300 mM NaCl) and eluted anaerobically in 2 mL fractions over 1.5 column volumes. Native P. furiosus SHI was isolated as previously described [41]. The results of the procedure are summarized in Table 2.

Hydrogenase assays

Hydrogen production by E. coli cultures was routinely measured by removing 100 µl from the culture headspace with a gas-tight syringe (Hamilton Co, Reno, NV) and injecting into a Shimadzu GC8 gas chromatograph equipped with a washed molesieve 5A 80/100 (6′×1/8″×0.085″) column. Hydrogenase activity was routinely determined by H2 evolution from methyl viologen (1 mM) reduced by sodium dithionite (10 mM) at 80°C as described previously [41], except the buffer was 100 mM EPPS, pH 8.4. For the physiologically-relevant hydrogen evolution assay, methyl viologen and sodium dithionite were replaced by NADPH (1 mM). One unit of hydrogenase specific activity is defined as 1 µmole of H2 evolved min−1 mg−1. Oxygen sensitivity assays were performed by exposing samples to air at 25°C. Thermal stability assays were measured by anaerobic incubation of the hydrogenase samples (0.06 mg/ml in 100 mM EPPS buffer, pH 8.4, containing 2 mM sodium dithionite) at 90°C. Residual enzyme activities were measured using the MV-linked H2-evolution assay.

Construction of lacZ reporter anaerobic expression plasmids

Four E. coli anaerobic promoters, Phya, Phyb, Phyc and Phyp (Fig. 2) were inserted into the plasmid pLX1 between EcoRI and XmaI sites to construct plasmids pLXA, pLXB, pLXC and pLXP. pLX1 was constructed from plasmid pSB2019 [33] by replacing a green fluorescent protein gene between XmaI and SalI with the N-terminal sequence of lacZ. Plasmids containing lacZ under control of these promoters were transformed into E. coli DH10B cells. β-galactosidase activity in extracts of anaerobically-grown cells was analyzed (Spectra MAX 190 96 well microplate reader) using a modified Miller assay [30]. The specific activity of β-galactosidase is expressed as units per mg of total protein in the cell-free extract.

Construction of anaerobic expression vectors

A series of four vectors were constructed by Horanyi et al. [25] in which the GATEWAY™ recombination cassette from Invitrogen was combined with the four compatible expression vectors of the Novagen (EMD Chemicals, San Diego, CA) DUET vector system (Table 1). The four original DUET vectors, as well as the four GATEWAY-modified versions (pDEST-C3A, pDEST-C11A, pRSF-ACG, and pET-ACG), were further modified to replace the native T7 promoter, which is not functional under anaerobic growth conditions [42]. The hya promoter [43] (see Fig. 3) was amplified from genomic DNA purified from the E. coli strain MG1655 using the primers (JS1 5′-CTCGAATTCCTTCTCTTTTACTCGTTTAG, JS2 5′-CACCCATATCGCACGTCTCTCCTCC). The PCR product was then treated with T4 polynucleotide kinase, and ligated to plasmid pDEST-C3 digested with EcoICRI to create pDEST-C3A; the entire cassette containing Phya and Gateway cloning sites was amplified with primers (JS1 and JS3 5′-GCCGCAAGCTTAGCAGCCGGAT, the cassette was digested with EcoRI and HindIII, then ligated with the similarly digested plasmids (pCDFDuet1, pRSFDuet1 and pET23) to create pDEST-C11A, pRSF-ACG and pET-ACG respectively. A 813 bp DNA fragment containing three tRNA genes from plasmid pRIL [44] was amplified using the primers JS4 (5′-CGCGGATCCGTCACCCTGGATGCTGTAC) and JS5 (5′-AAGTACGAGCTCAGGTCGCAGACGTTTTGCA), and cloned into pDEST-C3A between BamHI and SacI to create the plasmid pC3A-RIL (Table 1).

Cloning of the P. furiosus genes encoding SHI and the hydrogenase maturation proteins

The P. furiosus SHI structural genes (PF0891-PF0894) were amplified using purified P. furiosus genomic DNA (DSM 3638, Genbank accession number AE009950) as the template. The entire four-gene operon was amplified with the primers (PF0891-attB1-TEV: 5′-GGGGACAAGTTTGTACAAAAAAGCAGGCTCAGAAAACCTGTATTTTCAGGGAGGAAGGTATGTTAAGTTACCCAAGG and PF0894-attB2-TEV: 5′-GGGGACCACTTTGTACAAGAAAGCTGGGTCTCCTCCCTGAAAATACAGGTTTTCCTAAAGTCTAACCACGTGGACTGAG). The 4164 bp PCR product was crossed into the GATEWAY entry vector pDONR/Zeo using the manufacturer's protocol, resulting in the entry vector pDONR-SHI, and subsequently used to cross into the modified GATEWAY expression vector pET-SHI. The plasmid pET-A-SHI was constructed to produce “tagless” recombinant P. furiosus SHI. Phya without the downstream GATEWAY tag was amplify with primer pair Pa-SacF (CTCGAATTCCTTCTCTTTTACTCGTTTAG) and Pa-HindR (TGAGGAAGCTTATCGATGGTACCGCGGCATGCATATGGCACGTCTCTCCTCCTTGCG), the pET-A plasmid was made by inserting the HindIII/EcoRI digested PCR product into the similarly treated pETDuet-1(Novagen). The tagless Pf SHI gene was amplified with primer pair 0891-NdeF (GATAGGTTCCATATGAGGTATGTTAAGTTACCCAAGGA) and 0894-KpnR (ATAGGGTACCTTAAAGTCTAACCACGTGGACTGAGC), the NdeI/KpnI digested PCR product was inserted into similarly treated pET-A to produce pET-A-SHI. To make the expression vector pC11A-CDABI, the Pf hypCD operon (PF0548-PF0549) was first amplified with primers PF0548-attB1-TEV (5′- GGGGACAAGTTTGTACAAAAAAGCAGGCTCAGAAAACCTGTATTTTCAGGGAGGATGCCTTGCAATCCCAGGGAAAG) and CD-ABI-R (5′-CTTACTATTGCATCTGCCAACGCCCATTCGTGCATTTTCCACCTCCTACATCAGGGCGCCATATTTGTAAA). This 1460 bp hypCD PCR product was used as the forward primer to join and amplify the hypABI operon (PF0615 – PF0617) creating the artificial hypCDABI operon with the reverse primer PF0617-attB2-TEV (5′- GGGGACCACTTTGTACAAGAAAGCTGGGTCTCCTCCCTGAAAATACAGGTTTTCCTAAGAAAGCTCAAGACTTTCATAA). A fused hypEF operon (PF0604 and PF0559) was obtained with the same strategy by PCR that employed the primer PF0604-attB1-TEV (5′-GGGGACAAGTTTGTACAAAAAAGCAGGCTCAGAAAACCTGTATTTTCAGGGAGGAGAAGAACTAATTAGGGAGGTAA and the primer EF-fusion (5′-GTGAATTCTATAAGCTTTCATTCTCTCCCCCAGATACATTTTCCACCTCCTAACAAACTCTAGGAACGGGATCAC). The resulting 1025 bp PCR product of PF0604 was used as the forward primer along with the reverse primer PF0559-attB2-TEV (5′-GGGGACCACTTTGTACAAGAAAGCTGGGTCTCCTCCCTGAAAATACAGGTTTTCCTACATCAGGGCGCCATATTTGTAA) to generate the 3428 bp artificial hypEF operon. The fused P.furiosus slyD (PF1401) and frxA (PF0975) genes were cloned by the same PCR method with the primers PF1401-attB1-TEV (5′-GGGGACAAGTTTGTACAAAAAAGCAGGCTCAGAAAACCTGTATTTTCAGGGAGGAAAAGTAGAGAAAGGAGATGTCA), the fusion primer SlyD-FrxA-F (5′-GAGGAGAGTGAGTCTAAAGCGGAAGAATCTTAAGAGGTGGAAAGTGAGTAACTTTTTAAACTTTCACTT) and the reverse primer frx-attB2 (5′-GGGGACCACTTTGTACAAGAAAGCTGGGTCTCCCTATTACTCA). It was not possible to transform all four plasmids simultaneously into

Metal and Proteomic Analyses

Nickel and iron were measured using a quadrupole-based ICP-MS (7500ce, Agilent Technologies, Tokyo, Japan), equipped with a MicroMist Nebulizer (Agilent Technologies). Proteins were separated using native- or SDS-PAGE gradient gel electrophoresis (4–20% Criterion gels; Biorad, Hercules, CA) and stained with Coomassie Brilliant Blue. Gel bands of interest were cut out, processed and digested for 16 h at 37°C according to the manufacturer's protocol provided with the recombinant porcine trypsin used for the in-gel protein digest (Roche Applied Science, Indianapolis, IN). The peptides were purified with C-18 reversed-phase NuTip® cartridges according to the manufacturer's instructions (Glygen Corp., Columbia, MD). Approximately 1 µL of purified peptides and 1 µL of ProteoMass Peptide & Protein MALDI-MS Calibration Kit standard (Sigma) were spotted onto a MTP 384 Massive MALDI target (Bruker Daltonics, Billerica, MA). The target was analyzed using a Bruker Daultonics Autoflex MALDI-TOF mass spectrometer (Billerica, MA) following calibration with the standard. The mass list was generated by the SNAP peak detection algorithm using a signal-to-noise threshold of four following baseline correction of the spectra. Proteins were identified by searching the mass list against the National Center for Biotechnology Information (NCBI) annotation of the P. furiosus genome (NC_003413) using Mascot's Peptide Mass Fingerprint tool (version 2.1, Matrix Science Ltd., Boston, MA). The searches were conducted using a peptide mass tolerance of 1.0, variable modifications of Carbamidomethylation (C) and Oxidation (M), and a maximum of one missed cleavage. Proteins with a p<0.05 (corresponding to a Mascot protein score of greater than 46) were considered significant.
  39 in total

Review 1.  Pathways to hydrogen as an energy carrier.

Authors:  Thorsteinn I Sigfusson
Journal:  Philos Trans A Math Phys Eng Sci       Date:  2007-04-15       Impact factor: 4.226

2.  Escherichia coli hydrogenase 3 is a reversible enzyme possessing hydrogen uptake and synthesis activities.

Authors:  Toshinari Maeda; Viviana Sanchez-Torres; Thomas K Wood
Journal:  Appl Microbiol Biotechnol       Date:  2007-08-01       Impact factor: 4.813

3.  Identification of genes required for hydrogenase activity in Chlamydomonas reinhardtii.

Authors:  M C Posewitz; P W King; S L Smolinski; R Davis Smith; A R Ginley; M L Ghirardi; M Seibert
Journal:  Biochem Soc Trans       Date:  2005-02       Impact factor: 5.407

4.  Characterization of hydrogenase II from the hyperthermophilic archaeon Pyrococcus furiosus and assessment of its role in sulfur reduction.

Authors:  K Ma; R Weiss; M W Adams
Journal:  J Bacteriol       Date:  2000-04       Impact factor: 3.490

5.  The H(2) sensor of Ralstonia eutropha is a member of the subclass of regulatory [NiFe] hydrogenases.

Authors:  L Kleihues; O Lenz; M Bernhard; T Buhrke; B Friedrich
Journal:  J Bacteriol       Date:  2000-05       Impact factor: 3.490

6.  Generation of new hydrogen-recycling Rhizobiaceae strains by introduction of a novel hup minitransposon.

Authors:  E Báscones; J Imperial; T Ruiz-Argüeso; J M Palacios
Journal:  Appl Environ Microbiol       Date:  2000-10       Impact factor: 4.792

7.  Molecular characterization of an operon (hyp) necessary for the activity of the three hydrogenase isoenzymes in Escherichia coli.

Authors:  S Lutz; A Jacobi; V Schlensog; R Böhm; G Sawers; A Böck
Journal:  Mol Microbiol       Date:  1991-01       Impact factor: 3.501

8.  Insights into the metabolism of elemental sulfur by the hyperthermophilic archaeon Pyrococcus furiosus: characterization of a coenzyme A- dependent NAD(P)H sulfur oxidoreductase.

Authors:  Gerrit J Schut; Stephanie L Bridger; Michael W W Adams
Journal:  J Bacteriol       Date:  2007-04-20       Impact factor: 3.490

Review 9.  Molecular biology of microbial hydrogenases.

Authors:  P M Vignais; A Colbeau
Journal:  Curr Issues Mol Biol       Date:  2004-07       Impact factor: 2.081

10.  Biochemical and mutational analysis of a plant virus polyprotein cleavage site.

Authors:  W G Dougherty; J C Carrington; S M Cary; T D Parks
Journal:  EMBO J       Date:  1988-05       Impact factor: 11.598

View more
  22 in total

1.  Engineering hyperthermophilic archaeon Pyrococcus furiosus to overproduce its cytoplasmic [NiFe]-hydrogenase.

Authors:  Sanjeev K Chandrayan; Patrick M McTernan; R Christopher Hopkins; Junsong Sun; Francis E Jenney; Michael W W Adams
Journal:  J Biol Chem       Date:  2011-12-07       Impact factor: 5.157

2.  Natural competence in the hyperthermophilic archaeon Pyrococcus furiosus facilitates genetic manipulation: construction of markerless deletions of genes encoding the two cytoplasmic hydrogenases.

Authors:  Gina L Lipscomb; Karen Stirrett; Gerrit J Schut; Fei Yang; Francis E Jenney; Robert A Scott; Michael W W Adams; Janet Westpheling
Journal:  Appl Environ Microbiol       Date:  2011-02-11       Impact factor: 4.792

3.  Genetic analyses of the functions of [NiFe]-hydrogenase maturation endopeptidases in the hyperthermophilic archaeon Thermococcus kodakarensis.

Authors:  Tamotsu Kanai; Ayako Yasukochi; Jan-Robert Simons; Joseph Walker Scott; Wakao Fukuda; Tadayuki Imanaka; Haruyuki Atomi
Journal:  Extremophiles       Date:  2016-10-13       Impact factor: 2.395

4.  The multifaceted benefits of protein co-expression in Escherichia coli.

Authors:  Alessandra Stefan; Alessandro Ceccarelli; Emanuele Conte; Alejandro Montón Silva; Alejandro Hochkoeppler
Journal:  J Vis Exp       Date:  2015-02-05       Impact factor: 1.355

5.  Extreme Thermophiles: Moving beyond single-enzyme biocatalysis.

Authors:  Andrew D Frock; Robert M Kelly
Journal:  Curr Opin Chem Eng       Date:  2012-11-12       Impact factor: 5.163

6.  Conversion of 4-hydroxybutyrate to acetyl coenzyme A and its anapleurosis in the Metallosphaera sedula 3-hydroxypropionate/4-hydroxybutyrate carbon fixation pathway.

Authors:  Aaron B Hawkins; Michael W W Adams; Robert M Kelly
Journal:  Appl Environ Microbiol       Date:  2014-02-14       Impact factor: 4.792

7.  Design and development of synthetic microbial platform cells for bioenergy.

Authors:  Sang Jun Lee; Sang-Jae Lee; Dong-Woo Lee
Journal:  Front Microbiol       Date:  2013-04-19       Impact factor: 5.640

8.  Energy efficiency analysis: biomass-to-wheel efficiency related with biofuels production, fuel distribution, and powertrain systems.

Authors:  Wei-Dong Huang; Y-H Percival Zhang
Journal:  PLoS One       Date:  2011-07-13       Impact factor: 3.240

9.  A synthetic system links FeFe-hydrogenases to essential E. coli sulfur metabolism.

Authors:  Christina M Agapakis; Patrick M Boyle; Gerald Grandl; Buz Barstow; Pamela A Silver; Edwin H Wintermute
Journal:  J Biol Eng       Date:  2011-05-26       Impact factor: 4.355

10.  An innovative cloning platform enables large-scale production and maturation of an oxygen-tolerant [NiFe]-hydrogenase from Cupriavidus necator in Escherichia coli.

Authors:  Johannes Schiffels; Olaf Pinkenburg; Maximilian Schelden; El-Hussiny A A Aboulnaga; Marcus E M Baumann; Thorsten Selmer
Journal:  PLoS One       Date:  2013-07-05       Impact factor: 3.240

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.