| Literature DB >> 20100801 |
Juliane Merl1, Steffen Jakob, Katrin Ridinger, Thomas Hierlmeier, Rainer Deutzmann, Philipp Milkereit, Herbert Tschochner.
Abstract
Formation of eukaryotic ribosomes requires more than 150 biogenesis factors which transiently interact with the nascent ribosomal subunits. Previously, many pre-ribosomal intermediates could be distinguished by their protein composition and rRNA precursor (pre-rRNA) content. We purified complexes of ribosome biogenesis factors from yeast cells in which de novo synthesis of rRNA precursors was down-regulated by genetic means. We compared the protein composition of these largely pre-rRNA free assemblies with the one of analogous pre-ribosomal preparations by semi-quantitative mass spectrometry. The experimental setup minimizes the possibility that the analysed pre-rRNA free protein modules were derived from (partially) disrupted pre-ribosomal particles and provides thereby strong evidence for their pre-ribosome independent existence. In support of the validity of this approach (i) the predicted composition of the analysed protein modules was in agreement with previously described rRNA-free complexes and (ii) in most of the cases we could identify new candidate members of reported protein modules. An unexpected outcome of these analyses was that free large ribosomal subunits are associated with a specific set of ribosome biogenesis factors in cells where neo-production of nascent ribosomes was blocked. The data presented strengthen the idea that assembly of eukaryotic pre-ribosomal particles can result from transient association of distinct building blocks.Entities:
Mesh:
Substances:
Year: 2010 PMID: 20100801 PMCID: PMC2875017 DOI: 10.1093/nar/gkp1244
Source DB: PubMed Journal: Nucleic Acids Res ISSN: 0305-1048 Impact factor: 16.971
Yeast strains used in this study
| Name | Genotype | TOY | Origin |
|---|---|---|---|
| CG379 | MATα, ade5, his7-2, leu2-112, trp1-289, ura3-52 | 543 | ( |
| YCC95 | MATα, ade5, his7-2, leu2-112, trp1-289, ura3-52, | – | ( |
| CG379 Noc1p-TAP | MATα, ade5, his7-2, leu2-112, trp1-289, ura3-52, NOC1::NOC1-TAP-TRP1 | 576 | this article |
| YCC95 Noc1p-TAP | MATα, ade5, his7-2, leu2-112, trp1-289, ura3-52, | – | this article |
| CG379 Nop7p-TAP | MATα, ade5, his7-2, leu2-112, trp1-289, ura3-52, NOP7::NOP7-TAP-TRP1 | 580 | this article |
| YCC95 Nop7p-TAP | MATα, ade5, his7-2, leu2-112, trp1-289, ura3-52, | 544 | this article |
| CG379 Rio2p-TAP | MATα, ade5, his7-2, leu2-112, trp1-289, ura3-52, RIO2::RIO2-TAP-TRP1 | 587 | this article |
| YCC95 Rio2p-TAP | MATα, ade5, his7-2, leu2-112, trp1-289, ura3-52, | 551 | this article |
| CG379 Rix1p-TAP | MATα, ade5, his7-2, leu2-112, trp1-289, ura3-52, RIX1::RIX1-TAP-TRP1 | 583 | this article |
| YCC95 Rix1p-TAP | MATα, ade5, his7-2, leu2-112, trp1-289, ura3-52, | 547 | this article |
| CG379 Arx1p-TAP | MATα, ade5, his7-2, leu2-112, trp1-289, ura3-52, ARX1::ARX1-TAP-TRP1 | 584 | this article |
| YCC95 Arx1p-TAP | MATα, ade5, his7-2, leu2-112, trp1-289, ura3-52, | 548 | this article |
| CG379 Enp1p-TAP | MATα, ade5, his7-2, leu2-112, trp1-289, ura3-52, ENP1::ENP1-TAP-TRP1 | 588 | this article |
| YCC95 Enp1p-TAP | MATα, ade5, his7-2, leu2-112, trp1-289, ura3-52, | 552 | this article |
Oligonucleotides used in this study
| Name | Sequence | Purpose | Gene/Locus |
|---|---|---|---|
| 177 | ATCTGCCGACGATTATGCTCAATATTTAGATCA AGATTCAGACTCCATGGAAAAGAGAAG | Primer to obtain amplicon of pBS1479 for genomic integration of TAP-Tag | NOC1 |
| 178 | TAATTTACAACACCGAAGTGTTTAGTTAATGTA TTATTATTTTTACGACTCACTATAGGG | Primer to obtain amplicon of pBS1479 for genomic integration of TAP-Tag | NOC1 |
| 638 | GCCAAACAAAAAGCTAAACTGAATAAACTAGA TTCCAAGAAATCCATGGAAAAGAGAAG | Primer to obtain amplicon of pBS1479 for genomic integration of TAP-Tag | NOP7 |
| 639 | AGACAAAATTTTTGAGAGGCTATTGGAAAAGA AGAGAAAATACGACTCACTATAGGG | Primer to obtain amplicon of pBS1479 for genomic integration of TAP-Tag | NOP7 |
| – | AAATCTAAAAATGGATAAACTAGGAAACTATA TACTAGAGTCCATGGAAAAGAGAAG | Primer to obtain amplicon of pBS1479 for genomic integration of TAP-Tag | RIO2 |
| – | TTGATTATTTGCGGCCATTTATGCAGTCGTCTA AACTAAATACGACTCACTATAGGG | Primer to obtain amplicon of pBS1479 for genomic integration of TAP-Tag | RIO2 |
| 646 | CGAATTAAGTGATGACGAAGAGGAGGAGGAA GAAGGAGAATCCATGGAAAAGAGAAG | Primer to obtain amplicon of pBS1479 for genomic integration of TAP-Tag | RIX1 |
| 647 | TCTAGTCGAAATATAACCAAACAAAATCTGGTT GATATTATACGACTCACTATAGGG | Primer to obtain amplicon of pBS1479 for genomic integration of TAP-Tag | RIX1 |
| 648 | TGAGACATCAAATGGCGGAGTTGAAGAAACCA TGAAAATGTCCATGGAAAAGAGAAG | Primer to obtain amplicon of pBS1479 for genomic integration of TAP-Tag | ARX1 |
| 649 | TATATTATTTATATACTAGCTTTAGAAATGATG AAGTTTCTACGACTCACTATAGGG | Primer to obtain amplicon of pBS1479 for genomic integration of TAP-Tag | ARX1 |
| – | TCCACAGGAAGCTAATGATGATTTAATGATTG ATGTCAATTCCATGGAAAAGAGAAG | Primer to obtain amplicon of pBS1479 for genomic integration of TAP-Tag | ENP1 |
| – | CCGAGCGATATAAAATTGATGAAAAATTGATA TTACAGCATACGACTCACTATAGGG | Primer to obtain amplicon of pBS1479 for genomic integration of TAP-Tag | ENP1 |
| 205 | CATGGCTTAATCTTTGAGAC | 32P-labelled probe for northern blot hybridization (detection of 18S rRNA) | – |
| 212 | CTCCGCTTATTGATATGC | 32P-labelled probe for northern blot hybridization (detection of 25S rRNA) | – |
| 210 | GGCCAGCAATTTCAAGTTA | 32P-labelled probe for northern blot hybridization in ITS2 region (detection of 35/32S, 27SA2, 27SB, 7S pre-rRNAs) | – |
| 1819 | GTAAAAGCTCTCATGCTCTTGCC | 32P-labelled probe for northern blot hybridization in ITS1 region (detection of 35/32S, 23S, 20S pre-rRNAs) | – |
Figure 1.Analysis of cellular pre-rRNA and ribosome biogenesis factor levels after shut down of rRNA de novo synthesis. (A) Northern hybridization analysis of precursor and mature rRNA species of both ribosomal subunits was performed on RNA extracts from whole cells. Yeast strains with RRN3 and with rrn3-8 background were analysed at permissive (24°C) and restrictive (3 h 37°C) temperature. RNA from equal number of cells was loaded and different oligonucleotides (‘Materials and methods’ section) were used for detection of the different indicated (pre-) rRNA species (B) Protein levels of TAP–tagged ribosome biogenesis factors in RRN3 (rRNA synthesis +) and in rrn3-8 background (rRNA synthesis –) were analysed at restrictive (3h, 37°C) temperature by western blotting using PAP visualization reagent. Equal loading was controlled by determination of the protein level of rpS8.
Figure 2.Subcellular localization of TAP–tagged ribosome biogenesis factors after shut down of Pol I transcription. The localization of the indicated tagged proteins in yeast strains with (A) RRN3 and with (B) rrn3-8 background after 3 h shift to 37°C was analysed by fluorescence microscopy using an antibody directed against the Protein A moiety of the TAP-tag. Nucleolar structures were visualized by an anti–Nop1p antibody, yeast nuclei were stained with DAPI. Additionally, the ProteinA-signal (red) and the staining for Nop1p (green) were overlaid for better visualization of subcellular distribution. Whole yeast cells morphology was visualized by differential contrast (DIC). For better comparison the chosen exposition time for detection of the Protein A was not changed during analysis of the different tagged proteins. This results in slightly overexposed pictures for Nop7p-TAP and Arx1p-TAP.
Figure 3.Co-purification of pre-rRNA with different TAP-tagged biogenesis factors of the (A) large and (B) small ribosomal subunit after shut down of Pol-I transcription. Northern hybridization analysis of precursor rRNA species of both ribosomal subunits was performed on RNA extracted from whole cell extracts (IN) and from affinity purified TAP-tagged (A) Noc1p, Nop7p, Rix1p, Arx1p, (B) Rio2p and Enp1p (IP). Yeast strains carrying the RRN3 wild-type allele or the rrn3-8 allele were analysed at restrictive (3 h, 37°C) temperature. Different oligonucleotides (‘Materials and methods’ section) were used for detection of the different indicated (pre-) rRNA species. In parallel the amounts of tagged protein in input and affinity purified fractions were determined by western blotting using PAP visualization reagent. For each precipitation sample same signal intensities in IN and IP lanes reflect a purification recovery of 1%.
Figure 4.Co-purification of mature 25S and 18S rRNA with TAP-tagged Rix1p and Arx1p after shut down of Pol-I transcription. (A) Northern hybridization analysis of mature rRNA species of both ribosomal subunits was performed on RNA extracted from whole cell extracts (IN) and from affinity purified TAP-tagged Rix1p and Arx1p (IP). Yeast strains carrying the RRN3 wild-type allele or the rrn3-8 allele were analysed at restrictive (3 h, 37°C) temperature. Different oligonucleotides ‘Materials and methods’ section) were used for detection of the indicated 18S and 25S rRNA species. Same signal intensities in IN and IP lanes reflect a purification recovery of 1%. (B) The ratio of affinity precipitation efficiencies for 25S and 18S rRNAs was calculated and normalized to the one found in the untagged wild-type yeast strain using MultiGauge V3.0 (Fujifilm). (C) Sedimentation behaviour of TAP–tagged Arx1p was analysed on sucrose density gradients with cellular extracts of strains carrying the RRN3 wild-type allele (rRNA synthesis +) or the rrn3-8 allele (rRNA synthesis −) after 3 h shift to restrictive temperature. Distribution of ribosomal particles (40S, 60S, 80S, polysomes) in the gradient was determined by OD254 measurement (data not shown) and western blot analysis of the gradient fractions using an anti-rpS8 antibody. The amount of TAP-tagged Arx1p in each fraction and in the input-sample (IN) was also visualized by western blot analysis.
Figure 5.Schematic view of relative protein quantitation set up. A typical MS spectrum is shown, where each peak represents a mixture of sequence-identical but differentially iTRAQ-labelled peptides from affinity purifications of wild-type and rrn3-8 mutant strains. In the MSMS–mode peptides are selected for fragmentation, yielding in peptide fragments with sequence specific m/z ratios used for identification of the respective protein by database search. In addition the iTRAQ reporter ions of different masses are released and are used for relative quantitation and subsequent determination of pre-rRNA-dependent or pre-rRNA-independent co-purifications.
Figure 6.Semi-quantitative comparison of co-purifying ribosome biogenesis factors from cells with or without ongoing rRNA synthesis. The diagrams show the ratio of identified proteins co-purifying with TAP-tagged bait proteins from cells carrying the RRN3 wild-type and the rrn3-8 mutant allele. The bars indicate the average value of the calculated RRN3:rrn3-8 ratios for all identified peptides of the indicated protein. Error bars represent the standard deviation of these ratios (P < 0.05). The ratio of the bait protein (highlighted by a grey bar) is set to one. For co-purified proteins, ratios >0.5 were considered to reflect associations with bait proteins barely influenced by the absence of de novo rRNA synthesis. Association of proteins with intermediate ratios between 0.25 and 0.5 were classified to be stronger affected by the shutoff of rRNA synthesis. Nevertheless they are still significantly co-purified in the rrn3-8 mutant. Associations of proteins with ratios below 0.25 seem to be strongly dependent on rRNA de novo synthesis. Two independent purifications for the indicated bait proteins were performed and for each purification mass spectrometry analysis was repeated once. Quantitation of one representative experiment is shown.