BACKGROUND: Cannabinoids represent unique compounds for treating tumors, including astrocytomas. Whether CB(1) and CB(2) receptors mediate this therapeutic effect is unclear. PRINCIPAL FINDINGS: We generated astrocytoma subclones that express set levels of CB(1) and CB(2), and found that cannabinoids induce apoptosis only in cells expressing low levels of receptors that couple to ERK1/2. In contrast, cannabinoids do not induce apoptosis in cells expressing high levels of receptors because these now also couple to the prosurvival signal AKT. Remarkably, cannabinoids applied at high concentration induce apoptosis in all subclones independently of CB(1), CB(2) and AKT, but still through a mechanism involving ERK1/2. SIGNIFICANCE: The high expression level of CB(1) and CB(2) receptors commonly found in malignant astrocytomas precludes the use of cannabinoids as therapeutics, unless AKT is concomitantly inhibited, or cannabinoids are applied at concentrations that bypass CB(1) and CB(2) receptors, yet still activate ERK1/2.
BACKGROUND:Cannabinoids represent unique compounds for treating tumors, including astrocytomas. Whether CB(1) and CB(2) receptors mediate this therapeutic effect is unclear. PRINCIPAL FINDINGS: We generated astrocytoma subclones that express set levels of CB(1) and CB(2), and found that cannabinoids induce apoptosis only in cells expressing low levels of receptors that couple to ERK1/2. In contrast, cannabinoids do not induce apoptosis in cells expressing high levels of receptors because these now also couple to the prosurvival signal AKT. Remarkably, cannabinoids applied at high concentration induce apoptosis in all subclones independently of CB(1), CB(2) and AKT, but still through a mechanism involving ERK1/2. SIGNIFICANCE: The high expression level of CB(1) and CB(2) receptors commonly found in malignant astrocytomas precludes the use of cannabinoids as therapeutics, unless AKT is concomitantly inhibited, or cannabinoids are applied at concentrations that bypass CB(1) and CB(2) receptors, yet still activate ERK1/2.
Cannabinoids produce the majority of their biological effects by activating two receptors: CB1 and CB2. In healthy brain, CB1 is expressed by neurons, astrocytes and neural progenitor cells, whereas CB2 is only expressed by a small population of neurons located in the brain stem [1], [2]. Activation of CB1 and CB2 receptors regulates fundamental physiological processes, including neurotransmission efficacy, astrocytic function, and the fate and proliferation rate of neural progenitor cells [3], [4]. Thus, because these receptors regulate such fundamental physiological processes, extensive effort has been invested toward understanding how cannabinoid compounds activate CB1 and CB2 receptors, as well as regulate the signal transduction mechanisms they couple to, with the goal of developing novel therapeutics to treat various neuropathologies [5], [6].One of the most promising therapeutic uses of cannabinoids is linked to their ability to induce apoptosis in tumors, including in astrocytoma subclones grown either in vitro, subcutaneously in immunodeficientmice, or intracranially in rats [7], [8]. In fact, these data were so compelling that one clinical trial has already been carried-out, in which patients afflicted with recurrent astrocytomas (grade IV) were treated with cannabinoids stereotactically injected directly into the mass of the malignant tumors [9]. While there are clear results for the use of cannabinoids to treat astrocytomas, the requirement of cannabinoid receptors in mediating this therapeutic effect is still unproven [10]. In fact, evidence suggests that high concentrations of cannabinoids may induce biological effects, including the induction of apoptosis in cells, independently of CB1 and CB2 receptors [7], [11], [12], [13]. Thus whether CB1 and CB2 receptors, or yet another cannabinoid-like receptor, mediate the therapeutic effects of cannabinoids toward astrocytomas is still unclear.Other unanswered questions are: Why does CB1 and CB2 expression in astrocyomas gradually increase as a function of cancerous transformation? [14], [15] Does this increase in receptor expression modify the coupling of CB1 and CB2 to signal transduction pathways in astrocytomas? Does this increase in receptor expression modify the efficacy of cannabinoids at inducing apoptosis in astrocytomas? Indeed, while it is known that CB1 and CB2 couple to ERK1/2, AKT, JNK, p38 and GSK-3β [8], [16], [17], [18], [19], and that both ERK1/2 and AKT mediate the induction of apoptosis by cannabinoids in astrocytomas [8], [11], [18], [20], nothing is known about how changes in CB1 and CB2 expression will modify the coupling of these receptors to each kinase, and whether the efficacy with which cannabinoids induce apoptosis is also affected. Answering these questions is important for the following reasons. Most of the studies reporting cannabinoid receptors coupling to specific kinases were performed in heterologous expression systems and the expression level of these receptors both surpass those reached by endogenously-expressed receptors and favor promiscuous coupling to effector proteins. One particularly controversial point stems from the ability of cannabinoids to induce apoptosis in astrocytomas when CB1 and CB2 receptors also couple to the pro-survival kinase AKT. Therefore, it is important to increase our understanding of how changes in the expression level of CB1 and CB2 will affect the coupling of these receptors to specific kinases, as well as the efficacy of cannabinoids at killing astrocytomas.Here we sought to address the following two questions: Are the therapeutic effects of cannabinoids toward astrocytomas truly mediated by CB1 and CB2 receptors? Does the increase in cannabinoid receptor expression known to occur in malignant astrocytomas determine the efficacy of cannabinoids at killing these tumors? To answer these questions, we generated astrocytoma subclones that express low, medium and high levels of either CB1 or CB2, and studied the ability of the cannabinoid agonist CP-55,940 to regulate the activity of various kinases and to induce apoptosis in these tumor cells.
Results
Astrocytoma Subclones Stably Expressing Set Levels of Either CB1 or CB2 Receptors
To determine whether the expression level of CB1 or CB2 receptors dictate cannabinoid-mediated responses in astrocytomas, we sought to use heterologous gene expression technology to drive the expression of these receptors to precise levels in an astrocytoma cell line that normally lacks these receptors. Specifically, we found that the murine delayed brain tumor (DBT) cell line expresses neither CB1 nor CB2 receptors (Table 1). Thus we transfected these cells with IRES constructs containing the gene that encodes either CB1 or CB2 receptors in tandem with the gene encoding eGFP, and used FACS to select for the cells that had stably incorporated the construct (see Experimental Procedures). Using this approach, we obtained 27 CB1-expressing DBT subclones and 49 CB2-expressing DBT subclones. We then randomly selected 24 subclones (twelve CB1 and twelve CB2) and performed qPCR to find out the relative expression level of CB1 and CB2 receptor mRNA in each single cell subclone (Table S1). Based on these data, we then focused our experiments on three CB1 subclones and three CB2 subclones that expressed relatively low, medium and high levels of receptor mRNA (Table 1). Please note that all CB1-expressing DBT cells were still devoid of CB2 receptor mRNA, and vice versa. Quantification of CB1 and CB2 receptor proteins by radioligand binding showed a correlation between the relative level of mRNA encoding each receptor and the corresponding protein expression level as expressed by the Bmax value (Table 1). Here it is worth noting that the expression level of CB1 and CB2 receptors in the CB1-mid and the CB2-mid subclones, respectively, lie well within the range of their levels when endogenously expressed by various cell lines and tissues [21], [22]. Thus, we generated DBT subclones that stably express set levels of either CB1 or CB2 receptors, with expression levels that lie within the range of what is found for cells endogenously expressing these receptors.
Table 1
Expression levels of CB1 and CB2 receptors in wild-type and selected DBT subclones.
Nomenclature
subclones
qPCR
Radioligand binding
CB1
CB2
Bmax
kd
(cycle threshold)
(pmol/mg)
(nM)
Wild type
WT
no ct
no ct
no binding
-
CB1-low
E3
22.4
no ct
0.2
0.8
CB1-mid
E7
17.7
no ct
0.7
0.8
CB1-high
E5
14.7
no ct
1.3
0.7
CB2-low
2G5
no ct
24.1
0.3
0.8
CB2-mid
2H1
no ct
18.0
0.6
0.4
CB2-high
1D6
no ct
14.0
2.3
0.6
Wild-type DBT cells and DBT subclones stably expressing cannabinoid receptors were expanded in 10 cm dishes, and either their RNA extracted for qPCR analysis of CB1 and CB2 mRNA levels, or homogenized for radioligand binding analysis of CB1 and CB2 receptor protein levels. mRNA levels are expressed as cycle threshold (ct) value from qPCR performed with Taqman probes. Values represent mean of three independent determinations. Receptor protein level is expressed as B values from radioligand binding experiments performed with [3H]CP-55,940. k values were also determined and show consistent low nanomolar affinities. Values represent mean of 3–5 independent determinations.
Wild-type DBT cells and DBT subclones stably expressing cannabinoid receptors were expanded in 10 cm dishes, and either their RNA extracted for qPCR analysis of CB1 and CB2 mRNA levels, or homogenized for radioligand binding analysis of CB1 and CB2 receptor protein levels. mRNA levels are expressed as cycle threshold (ct) value from qPCR performed with Taqman probes. Values represent mean of three independent determinations. Receptor protein level is expressed as B values from radioligand binding experiments performed with [3H]CP-55,940. k values were also determined and show consistent low nanomolar affinities. Values represent mean of 3–5 independent determinations.
Independent of Expression Levels, CB1 and CB2 Receptors Similarly Regulate ERK1/2 Signaling
Because previous studies performed on astrocytoma cell lines have implicated ERK1/2 signaling in the therapeutic actions of cannabinoids [23], we sought to determine whether different expression levels of CB receptors would affect their coupling to this signal transduction pathway. To do so, we treated each subclone with CP-55,940 (1 µM, maximally efficacious concentration [17], [24]) and measured ERK1/2 phosphorylation by Western blot analysis. We found that CP-55,940 induced a significant increase in ERK1/2 phosphorylation above vehicle-treated controls in all six subclones (Figure 1a). All these responses were receptor-mediated since they were significantly attenuated by either the CB1 antagonist SR141716A, or the CB2 antagonist SR144528, respectively (Figure 1a). Furthermore, CP-55,940 did not affect ERK1/2 phosphorylation in wild-type DBT cells (Figure S1a). The magnitude and kinetics of CP-55,940-induced ERK1/2 phosphorylation mediated in each subclone were remarkably similar despite a 10-fold difference in receptor expression level between the CB1-low and the CB1-high subclones, and between the CB2-low and the CB2-high subclones (Figure 1b,c). The only differences that we noted between CB1- and CB2-mediated regulation of ERK1/2 phosphorylation were that CP-55,940 induced a slightly slower and sustained increase in ERK1/2 phosphorylation in CB1-expressing subclones (peak at 5 min returning to basal by 20–30 min) compared to CB2-expressing subclones (peak at 3 min returning to basal by 10–20 min) (Figure 1b,c). These results show that CB1 and CB2 receptors heterologously expressed in DBT cells are functional for they regulate ERK1/2 phosphorylation. They also show that the efficacy of this regulation is largely independent of receptor expression levels and receptor subtype.
Figure 1
Activation of CB1 and CB2 receptors increases ERK1/2 phosphorylation in all DBT subclones.
DBT subclones stably expressing cannabinoid receptors were expanded in 24-well plates, incubated with CP-55,940 (CP, 1 µM), and ERK1/2 phosphorylation quantified by Western blot analysis. (a) CB1- and CB2-expressing subclones were incubated with CP for 5 and 3 min, respectively (white bars). When testing the effect of antagonists, cells were pretreated with SR141716A (5 µM) and SR144528 (3 µM) added 10 min before CP (black bars). (b,c) Kinetics of CP-induced increase in ERK1/2 phosphorylation in CB1-low, CB1-high, CB2-low and CB2-high subclones. Data = mean±s.e.m. of 6–8 independent experiments expressed as % of vehicle (i.e. level of ERK1/2 phosphorylation when treated with vehicle, i.e. 0.1% DMSO. Note that basal ERK1/2 phosphorylation did not vary significantly over time (Figure S1a). In (a), (*) = p<0.05 and (**) = p<0.01 significantly different from the response in the presence of inhibitor, ANOVA followed by Bonferroni's post-test. In (b,c), (*) and (#) = p<0.05, and (**) and (##) = p<0.01 significantly different from vehicle at corresponding time point, ANOVA followed by Bonferroni's post-test.
Activation of CB1 and CB2 receptors increases ERK1/2 phosphorylation in all DBT subclones.
DBT subclones stably expressing cannabinoid receptors were expanded in 24-well plates, incubated with CP-55,940 (CP, 1 µM), and ERK1/2 phosphorylation quantified by Western blot analysis. (a) CB1- and CB2-expressing subclones were incubated with CP for 5 and 3 min, respectively (white bars). When testing the effect of antagonists, cells were pretreated with SR141716A (5 µM) and SR144528 (3 µM) added 10 min before CP (black bars). (b,c) Kinetics of CP-induced increase in ERK1/2 phosphorylation in CB1-low, CB1-high, CB2-low and CB2-high subclones. Data = mean±s.e.m. of 6–8 independent experiments expressed as % of vehicle (i.e. level of ERK1/2 phosphorylation when treated with vehicle, i.e. 0.1% DMSO. Note that basal ERK1/2 phosphorylation did not vary significantly over time (Figure S1a). In (a), (*) = p<0.05 and (**) = p<0.01 significantly different from the response in the presence of inhibitor, ANOVA followed by Bonferroni's post-test. In (b,c), (*) and (#) = p<0.05, and (**) and (##) = p<0.01 significantly different from vehicle at corresponding time point, ANOVA followed by Bonferroni's post-test.
The Expression Level of CB1 and CB2 Receptors Dictates Their Ability to Regulate AKT, JNK and p38 Signaling
CB1 and CB2 receptors have been shown to regulate a plethora of kinases, including AKT, JNK, p38 and GSK-3β [8], [16], [17], [18], [19]. Thus we sought to assess if CB1 and CB2 heterologously expressed in DBT cells also regulate these four kinases. To do so, we treated all DBT subclones with CP-55,940 and assessed the phosphorylation state of these kinases using a Luminex multiplexed immunoassay system.With regard to AKT, three points are noteworthy. First, the CP-55,940-induced increase in AKT phosphorylation correlated with receptor expression levels (Figure 2a). Specifically, CP-55,940 did not significantly increase AKT phosphorylation in the CB1-low subclone, which expresses the lowest level of receptor of all six subclones that we have selected; it induced a small, but significant increase in AKT phosphorylation in CB2-low and CB2-mid, which express slightly more receptors than the CB1-low subclone; and it induced the most pronounced increase in AKT phosphorylation in CB1-mid, CB1-high and CB2-high subclones (see Table 1 for Bmax values). Second, all responses were mediated by cannabinoid receptors since they were antagonized by either SR141716A or SR144528, respectively, and CP-55,940 did not increase AKT in wild type DBT cells (Figures 2a and S1b). Third, there was a clear difference in the kinetics of AKT activation linked to either CB1 or CB2 receptors. Specifically, while the response obtained in the CB1-high subclone peaked at 3 min and returned to the basal level at 5 min, the response measured in the CB2-high clone remained above 250% of basal during the entire 30 min of the incubation period (Figure 2b,c).
Figure 2
Activation of CB1 and CB2 receptors differentially increases AKT phosphorylation in DBT subclones.
DBT subclones stably expressing cannabinoid receptors were expanded in 24-well plates, incubated with CP-55,940 (CP, 1 µM), and AKT phosphorylation quantified by Luminex multiplex immunoassay. (a) CB1- and CB2-expressing subclones were incubated with CP for 5 and 3 min, respectively (white bars). When testing the effect of antagonists, cells were pretreated with SR141716A (5 µM) and SR144528 (3 µM) added 10 min before CP (black bars). (b,c) Kinetics of CP-induced increase in AKT phosphorylation in CB1-low, CB1-high, CB2-low and CB2-high subclones. Data = mean±s.e.m. of 6 to 8 independent experiments expressed as % of vehicle (i.e. level of AKT phosphorylation when treated with vehicle, i.e. 0.1% DMSO. Please note that basal AKT phosphorylation did not vary significantly over time (Figure S1b). In (a), (*) = p<0.05 significantly different from the response in the presence of inhibitor, ANOVA followed by Bonferroni's post-test. In (b,c), (*) and (#) = p<0.05, and (**) and (##) = p<0.01 significantly different from vehicle at corresponding time point, ANOVA followed by Bonferroni's post-test. Non-significant (ns).
Activation of CB1 and CB2 receptors differentially increases AKT phosphorylation in DBT subclones.
DBT subclones stably expressing cannabinoid receptors were expanded in 24-well plates, incubated with CP-55,940 (CP, 1 µM), and AKT phosphorylation quantified by Luminex multiplex immunoassay. (a) CB1- and CB2-expressing subclones were incubated with CP for 5 and 3 min, respectively (white bars). When testing the effect of antagonists, cells were pretreated with SR141716A (5 µM) and SR144528 (3 µM) added 10 min before CP (black bars). (b,c) Kinetics of CP-induced increase in AKT phosphorylation in CB1-low, CB1-high, CB2-low and CB2-high subclones. Data = mean±s.e.m. of 6 to 8 independent experiments expressed as % of vehicle (i.e. level of AKT phosphorylation when treated with vehicle, i.e. 0.1% DMSO. Please note that basal AKT phosphorylation did not vary significantly over time (Figure S1b). In (a), (*) = p<0.05 significantly different from the response in the presence of inhibitor, ANOVA followed by Bonferroni's post-test. In (b,c), (*) and (#) = p<0.05, and (**) and (##) = p<0.01 significantly different from vehicle at corresponding time point, ANOVA followed by Bonferroni's post-test. Non-significant (ns).With regard to JNK and p38, CP-55,940 induced a small (150–170% of basal) but significant increase in the phosphorylation state of these kinases only in the CB2-high clone that also lasted throughout the 30 min incubation period (Figure S2a,b). With regard to GSK-3β, CP-55,940 did not significantly affect the phosphorylation state of this kinase in any of the subclones throughout the 30 min incubation time period (data not shown).Taken together, these results suggest that the different expression levels of CB1 and CB2 receptors determine the efficacy with which cannabinoids regulate AKT, JNK and p38 signaling. They also suggest that CB1 and CB2 receptors differentially couple to these kinases.
Only Activation of CB1 Receptors Expressed at Low Levels in DBT Cells Leads to Apoptosis: Involvement of ERK1/2
Several studies suggest that activation of CB1 or CB2 is sufficient to induce apoptosis in astrocytomas [8], [14], whereas other studies suggest that only high concentrations of cannabinoids kill astrocytomas and furthermore, independently of cannabinoid receptor activation [7], [11], [12], [13]. We directly tested these possibilities by treating the DBT subclones, as well as wild-type DBT cells, with CP-55,940 at either 1 µM (receptor-mediated) or 10 µM (receptor-independent). To assess for cell viability, we used WST-1, an indicator of mitochondrial activity. We found that 1 µM CP-55,940 induced ∼50% cell death in the CB1-low DBT subclone, whereas 10 µM CP-55,940 induced 35–90% cell death in wild type DBT cells and all six subclones (Figure 3a). This result suggests that only the activation of CB1 receptors expressed at low levels in DBT cells leads to significant receptor-dependent killing of these cells. Two additional sets of results support this conclusion. First, SR141617A blocked the 1 µM CP-55,940-induced killing of the CB1-low DBT cells, whereas this antagonist did not affect the 10 µM CP-55,940-induced cell death of wild type DBT cells (Figure 3b). Second, CP-55,940 killed CB1-low DBT cells with an EC50 of 0.56 µM, whereas this compound induced the cell death of wild type DBT cells with an EC50 of 5 µM (Figure 3c). Interestingly, when comparing the effect of 1 µM CP-55,940 on CB1-low DBT cells to the effect of 10 µM CP-55,940 on wild-type DBT, we found that the 10 µM CP-55,940-induced killing of wild-type DBT (receptor-independent) is more rapid than the CB1-mediated cell death (Figure 3d).
Figure 3
CP-55,940 kills DBT cells via cannabinoid receptor-dependent and -independent mechanisms.
Wild-type (wt) DBT cells and DBT subclones stably expressing cannabinoid receptors were expanded in 24-well plates, incubated with CP-55,940 (CP) at either 1 µM (receptor mediated) or 10 µM (receptor independent), and cell viability was assessed by quantifying WST-1 conversion. (a) Five days after treatment, only CB1-low DBT cells showed significant sensitivity to CP at 1 µM, whereas all subclones were sensitive to CP at 10 µM. Data represent means±s.e.m. of 5–9 independent experiments in triplicate. (b) Only the pretreatment of CB1-low DBT cells with SR141617A (5 µM) prevented the CP-induced killing, whereas pretreatment with PD 98059 (PD, 10 µM) significantly reduced both the CP 1 µM and CP 10 µM induced toxicity in CB1-low and wild-type, respectively. Data represent means±s.e.m. of 3–5 independent experiments in triplicate. (c) Dose-response and (d) kinetics of CP-induced killing of wt and CB1-low DBT cells. Data represent means±s.e.m. of 3–9 independent experiments in triplicate. All results are expressed as % of WST-1 measurements in corresponding cells treated with vehicle (0.1% DMSO) for the indicated time point. In (a), (*) = p<0.05 and (**) = p<0.01 significantly different from the viability in the presence of vehicle only, ANOVA followed by Bonferroni's post-test. In (b), (**) = p<0.01 significantly different the viability after treatment with either 1 or 10 µM CP, ANOVA followed by Bonferroni's post-test. In (c), (**) and (##) = p<0.01 significantly different from the viability in the presence of vehicle only, ANOVA followed by Bonferroni's post-test. In (d), (#) = p<0.05, and (**) and (##) = p<0.01 significantly different from the viability in the presence of vehicle only at corresponding time point, ANOVA followed by Bonferroni's post-test.
CP-55,940 kills DBT cells via cannabinoid receptor-dependent and -independent mechanisms.
Wild-type (wt) DBT cells and DBT subclones stably expressing cannabinoid receptors were expanded in 24-well plates, incubated with CP-55,940 (CP) at either 1 µM (receptor mediated) or 10 µM (receptor independent), and cell viability was assessed by quantifying WST-1 conversion. (a) Five days after treatment, only CB1-low DBT cells showed significant sensitivity to CP at 1 µM, whereas all subclones were sensitive to CP at 10 µM. Data represent means±s.e.m. of 5–9 independent experiments in triplicate. (b) Only the pretreatment of CB1-low DBT cells with SR141617A (5 µM) prevented the CP-induced killing, whereas pretreatment with PD 98059 (PD, 10 µM) significantly reduced both the CP 1 µM and CP 10 µM induced toxicity in CB1-low and wild-type, respectively. Data represent means±s.e.m. of 3–5 independent experiments in triplicate. (c) Dose-response and (d) kinetics of CP-induced killing of wt and CB1-low DBT cells. Data represent means±s.e.m. of 3–9 independent experiments in triplicate. All results are expressed as % of WST-1 measurements in corresponding cells treated with vehicle (0.1% DMSO) for the indicated time point. In (a), (*) = p<0.05 and (**) = p<0.01 significantly different from the viability in the presence of vehicle only, ANOVA followed by Bonferroni's post-test. In (b), (**) = p<0.01 significantly different the viability after treatment with either 1 or 10 µM CP, ANOVA followed by Bonferroni's post-test. In (c), (**) and (##) = p<0.01 significantly different from the viability in the presence of vehicle only, ANOVA followed by Bonferroni's post-test. In (d), (#) = p<0.05, and (**) and (##) = p<0.01 significantly different from the viability in the presence of vehicle only at corresponding time point, ANOVA followed by Bonferroni's post-test.We then determined whether the CB1-dependent and the cannabinoid receptor-independent killing of DBT cells were apoptotic in nature. Specifically, we treated CB1-low DBT cells with 1 µM CP-55,940 and wild type DBT cells with 10 µM CP-55,940, and assessed for propidium iodide and annexin V staining (to assess for cell permeability and apoptosis, respectively). Figure 4 shows that after five days, cell death by apoptosis was induced in 78% of the wild-type DBT cells treated with 10 µM CP-55,940 compared to 48% of the CB1-low DBT cells treated with 1 µM CP-55,940. Furthermore, in agreement with the data we have obtained with WST-1, 10 µM CP-55,940 killed more wild-type DBT cells by apoptosis (27%) 3 days after treatment compared to CB1-low DBT cells treated with 1 µM CP-55,940 (15%) (Figure 4). Together, these data show that both the CB1-dependent and the cannabinoid receptor-independent killing of DBT cells are due to apoptosis, but that these processes occur with slightly different time courses.
Figure 4
Time course of the apoptotic response induced by CP-55,940 in wild-type and CB1-low DBT cells.
(a,b) Wild-type (wt) DBT cells and (c,d) CB1-low DBT cells were expanded in 6-well plates, incubated with CP-55,940 (CP) at 10 and 1 µM, respectively, and apoptosis assessed by quantifying propidium iodine (PI) and annexin V fluorescence by FACS after 1, 3, and 5 days. Shown are representative results, with values within each quadrant = mean of 3–5 independent experiments.
Time course of the apoptotic response induced by CP-55,940 in wild-type and CB1-low DBT cells.
(a,b) Wild-type (wt) DBT cells and (c,d) CB1-low DBT cells were expanded in 6-well plates, incubated with CP-55,940 (CP) at 10 and 1 µM, respectively, and apoptosis assessed by quantifying propidium iodine (PI) and annexin V fluorescence by FACS after 1, 3, and 5 days. Shown are representative results, with values within each quadrant = mean of 3–5 independent experiments.Because we found that 1 µM CP-55,940 increases ERK1/2 signaling in CB1-low DBT cells without affecting the AKT, JNK, p38 and GSKβ signaling pathways, and one study suggested that ERK1/2 mediates the apoptotic properties of cannabinoids on astrocytomas [8], we then tested if inhibiting ERK signaling would affect the CB1-mediated and the cannabinoid receptor-independent killing of DBT cells. Thus, we pretreated CB1-low and wild-type DBT cells with the ERK kinase kinase inhibitor PD98059 before applying either 1 or 10 µM CP-55,940. We found that both responses were partially prevented by this inhibitor (Figure 3b). Thus both the CB1-dependent and the cannnabinoid receptor-independent induced apoptosis of DBT cells rely on ERK signaling.Together, these results show that cannabinoid concentrations known to activate CB1 and CB2 receptors (here 1 µM) induce apoptosis in astrocytomas only when these cells express low levels of CB1 receptors, and that this response is mediated through ERK signaling. Conversely, high concentrations of cannabinoids known to bypass cannabinoid receptors (here 10 µM) induce apoptosis in all DBT subclones, a mechanism that also depends on ERK signaling.
CB1- and CB2-Induced Apoptosis of DBT Cells Is Uncovered When AKT Is Inhibited
Because increased AKT signaling promotes cell survival [25], we reasoned that activation of this pathway by CB1 and CB2 receptors expressed at mid and high levels might explain why 1 µM CP-55,940 was unable to induce apoptosis in DBT subclones. To test this hypothesis, we treated the six subclones of DBT cells with 1 µM CP-55,940 in combination with Inhibitor X, a cell-permeable inhibitor of AKT [26]. Using the WST-1 assay, we found that while this inhibitor had no effect by itself on cell viability, it uncovered the ability of 1 µM CP-55,940 to kill all the DBT subclones that were normally resistant, with the most pronounced response occurring in CB2-low DBT cells (Figure 5a). This latter response was due to apoptosis, since 76% of the cells stained positively for annexin V when measured five days after co-application of 1 µM CP-55,940 and Inhibitor X (Figure 5b). These results suggest that the coupling of CB1 and CB2 receptors to the AKT pathway (when these receptors are expressed at mid and high levels) eliminates the ability of cannabinoids to induce apoptosis in DBT cells.
Figure 5
Inhibition of AKT signaling confers sensitivity of cannabinoid receptor-expressing DBT cells to cannabinoid-dependent cytotoxicity.
(a) Wild-type (wt) DBT cells and DBT subclones stably expressing cannabinoid receptors were expanded in 24-well plates, incubated with CP-55,940 (CP) at 1 µM (receptor-mediated) without or with Inhibitor X (5 µM added 10 min before CP), and cell viability was assessed after 5 days by quantifying WST-1 conversion. Data represent means±s.e.m. of 3–9 independent experiments in triplicate. (*) = p<0.05 and (**) = p<0.01 significantly different from the viability in the presence of vehicle only, ANOVA followed by Bonferroni's post-test. (b) wt and CB2-low DBT cells were expanded in 6-well plates, incubated with CP at 1 µM (receptor-mediated) without or with Inhibitor X (5 µM added 10 min before CP), and the apoptotic response assessed after 5 days by propidium iodine (PI) and annexin V staining by FACS after 1, 3, and 5 days. Shown are representative results, with values within each quadrant = mean of 3–5 independent experiments.
Inhibition of AKT signaling confers sensitivity of cannabinoid receptor-expressing DBT cells to cannabinoid-dependent cytotoxicity.
(a) Wild-type (wt) DBT cells and DBT subclones stably expressing cannabinoid receptors were expanded in 24-well plates, incubated with CP-55,940 (CP) at 1 µM (receptor-mediated) without or with Inhibitor X (5 µM added 10 min before CP), and cell viability was assessed after 5 days by quantifying WST-1 conversion. Data represent means±s.e.m. of 3–9 independent experiments in triplicate. (*) = p<0.05 and (**) = p<0.01 significantly different from the viability in the presence of vehicle only, ANOVA followed by Bonferroni's post-test. (b) wt and CB2-low DBT cells were expanded in 6-well plates, incubated with CP at 1 µM (receptor-mediated) without or with Inhibitor X (5 µM added 10 min before CP), and the apoptotic response assessed after 5 days by propidium iodine (PI) and annexin V staining by FACS after 1, 3, and 5 days. Shown are representative results, with values within each quadrant = mean of 3–5 independent experiments.
Discussion
While many laboratories have reported that cannabinoids induce apoptosis in various tumor subtypes, including astrocytomas, the requirement for CB1 and CB2 in mediating this therapeutic effect has not yet been demonstrated. This point is especially relevant when considering that many of these studies used high concentrations of cannabinoids known to bypass CB1 and CB2 receptor activation. Here we demonstrate that cannabinoid receptors and ERK1/2 indeed mediate this therapeutic effect, but only when these compounds are applied at submicromolar concentrations and the expression level of these receptors remains low. Conversely, high concentrations of cannabinoids kill all astrocytoma subclones independently of CB1, CB2 and AKT, yet still through a mechanisms involving ERK1/2. We also show that increased expression of CB1 and CB2 receptor allows for their coupling to additional kinases, especially AKT, the result of which eliminates the ability of cannabinoids to induce apoptosis even though these receptors still couple to ERK1/2.One of the most unexpected and interesting findings of our study is that the coupling of CB1 and CB2 receptors to AKT, JNK and p38 is dictated by receptor expression levels, whereas their coupling to ERK1/2 is not. What may be the molecular mechanism underlying a gradual coupling to AKT, JNK and p38, while preserving a steady coupling to ERK1/2? Reports on the molecular mechanisms linking cannabinoid receptors to various kinases suggest that these receptors activate AKT through G-proteins, while activating ERK1/2 through EGF receptor transactivation [27]. Based on these reports, a parsimonious interpretation of our results would be that the rate limiting step controlling the efficacy of cannabinoids at stimulating AKT lies in the cannabinoid receptors themselves, whereas the rate limiting step controlling the efficacy of cannabinoids at stimulating ERK lies in EGF receptors, the expression of which is likely to remain constant in the DBT subclones that we generated. Our results may have broader implications when considering the therapeutic efficacy of cannabinoids toward other neuropathologies. For example, epileptic seizures and cerebral ischemia lead to a 3–4 fold increase in the expression of neuronal CB1 receptors, a response thought to constitute a protective mechanism [28], [29], whereas Huntington disease leads to a 50–70% decrease in the expression of neuronal CB1 receptors, a decrease thought to participate in the pathogenesis of this neurodegenerative disease [30], [31]. Based on the results that we report here, one would predict that up- or down-regulation of neuronal CB1 receptor expression should not affect the efficacy of cannabinoids at stimulating ERK signaling, whereas it might dictate their ability to modulate the activity of the prosurvival kinase AKT. Thus our study is the first to suggest that changes in cannabinoid receptor expression levels will affect only certain types of signal transductions pathways, several of which are clearly involved in the control of cell survival and death. This result has implications when considering the efficacy of cannabinoids at treating astrocytomas of increasing malignancy, but also when considering other neuropathologies associated with changes in cannabinoid receptor expression.An additional noteworthy result was the differential coupling of CB1 and CB2 receptors to AKT. Indeed, cells expressing similar ranges of CB1 and CB2 receptors (CB1-mid to CB1-high being between 0.7 and 1.3 pmol/mg, and CB2-mid to CB2-high being between 0.6 and 2.3 pmol/mg) exhibited a clearly different coupling to this prosurvival kinase. How might the same agonist acting at CB1 and CB2 differentially stimulate this kinase? CB1 and CB2 exhibit significant disparities in their amino acid sequence, particularly in their intracellular domains which interact with G proteins and effector proteins. Indeed, upon their molecular identification, it was evident that while both receptors exhibit similar pharmacological profiles, they only exhibited an overall 44% amino acid identity [32]. We preformed a sequence alignment between mouseCB1 and mouseCB2, and highlighted in red the sequence motifs located in the intracellular loops that may account for the differential interactions with G proteins and found that these regions exhibit a much diminished 29% similarity (Figure S3). In agreement with this reduced amino acid similarity in intracellular sequences, a recent study showed that the binding of the same agonist to either CB1 or CB2 receptors leads to differential activation of G-proteins [33]. Another possible explanation of how the same agonist engaging either CB1 or CB2 receptors might differentially activate a signal transduction mechanism is based on studies that were obtained with “ligand-assisted protein structure” (LAPS) analysis [34], [35]. Here the positioning of the tricyclic ring of a specific cannabinoid agonist, AM841 (a close analogue of CP-55,940), within the binding pockets of either CB1 or CB2 receptors has been shown to vary considerably, from being parallel to the transmembrane helices in CB1 to being perpendicular to the transmembrane helices in CB2
[34], [35]. Since agonists engaging the binding pocket of a GPCR will favor a specific R* activation conformation, the same agonist differentially engaging the binding pocket of either CB1 or CB2 receptors will likely lead to distinct R* conformations for these receptors, and thus differential G protein coupling. Hence, both sequence disparities in the intracellular loops and the precise positioning of a cannabinoid ligand within the binding pocket of CB1 and CB2 receptors could account for the differential activation of a specific kinase.When considering cannabinoids to treat astrocytomas, many have attempted to isolate the non-psychotropic therapeutic effects ascribed to CB2 receptor activation, while eliminating the psychotropic and addictive properties ascribed to CB1 receptor activation [14]. However, since cannabinoids have outstanding LD50 values (mainly because cannabinoid receptors are barely expressed in brains regions that control vegetative functions) [36], the treatment of tumors with high concentrations of cannabinoids should not be overlooked. In fact, stereotaxic injection of high concentrations of cannabinoids will eradicate a significant portion of C6 astrocytomas inoculated into rodent brains without affecting healthy surrounding tissue or inducing overt adverse effects [8]. Since stereotaxic injection of chemotherapeutic compounds directly into humanbrain tumor masses constitutes a routine approach for neurosurgeons, high concentrations of cannabinoids can easily be delivered by this technique [9]. There are two additional advantages to delivering high concentrations of cannabinoids directly into the tumor mass. Malignant transformation of astrocytomas is associated with an increase in cannabinoid receptor expression [14], [15] and we show here that this increase in expression precludes the use of low concentrations of cannabinoids known to activate these receptors. Conversely, local injection of high concentrations of cannabinoids will induce apoptosis in all astrocytoma subclones (independently of CB1 and CB2 receptor expression), which constitutes an asset when considering the phenotypic heterogeneity that astrocytomas adopt during malignant transformation [37], [38]. Thus, our results suggest that high concentrations of cannabinoids constitute the preferred regimen for neurosurgeons to use when treating malignant astrocytomas with this class of compounds.One outstanding question that is raised by our study is: what constitutes the molecular target that is engaged by high concentrations of cannabinoids, a target that also leads to ERK activation and induction of apoptosis in astrocytomas? One possibility is another GPCR, several of which have recently been shown to be engaged by high concentrations of cannabinoids, including CP-55,940 [39]. One obvious candidate is GPR55 [40], although this receptor can be ruled out in the context of our studies since we found no evidence for the presence of GPR55 mRNA in DBT cells (as assessed by RT-PCR and qPCR, data not shown). Thus, while the molecular identification of this target remains to be determined, its identification will most certainly raise a lot of interest for research aimed at developing novel therapeutic approaches to treat astrocytomas and other tumors.In conclusion, our study provides the first evidence for the differential activation of AKT, p38 and JNK by a highly efficacious cannabinoid agonist, CP-55,940, engaging either CB1 or CB2 receptors expressed at different levels. This shift in coupling precludes the use of cannabinoids at submicromolar concentrations as pro-apoptotic therapeutics, unless AKT is concomitantly inhibited. Our results also suggest that high concentrations of cannabinoids are preferable for efficacious treatment of malignant astrocytomas, because these concentrations bypass CB1 and CB2 receptor activation and induce apoptosis in all astrocytoma cell subpopulations.
Materials and Methods
Drugs
Tritium-labeled and unlabeled CP 55,940 ((−)-cis-3-[2-hydroxy-4-(1,1-dimethylheptyl)phenyl]-trans-4-(3-hydroxypropyl) cyclohexanol), SR141716A (5- (4-chlorophenyl)-1-(2,4-dichlorophenyl)-4-methyl-N-(1-piperidyl)-1H-pyrazole-3-carboxamide), and SR144528 (5- (4-chloro-3- methyl- phenyl)-1- [(4- methylphenyl)methyl]- N-(1,3,3- trimethylnorbornan- 2- yl)- pyrazole- 3- carboxamide) were provided by the National Institute of Drug Abuse Drug Supply Program (RTI, Research Triangle Park, NC). PD 98059 and Inhibitor X were from CalBiochem (San Diego, CA).
Generation of DBT Subclones Expressing mCB1 and mCB2
mCB1 and mCB2 were PCR-cloned from an existing construct using the following primers, respectively: forward, 5′-gcgaattcatgaagtcgatcttagacggccttgc-3′ and reverse, 5′-gcggatcctcacagagcctcggcagacgtgtctg-3′; forward, 5′-gcgaattcatggagggatgccgggagacagaagtg-3′ and reverse, 5′-gcggatcctaggtggttttcacatcagcctctg-3′. Please note that these receptors are not linked to any molecular tag, because such additions often affect the coupling of GCPRs to their signal transduction pathways. Amplicons were digested with EcoR I and BamH I, and ligated into the corresponding multiple cloning site of the pIRES2-EGFP vector (BD Biosciences Clontech, Mountain View, CA). The murine delayed brain tumor (DBT) cell line, which was originally developed using the Schmidt-Ruppin strain of Rous sarcoma virus inoculated into an adult CDF1 mouse brain [41], was expanded at 37°C with 5% CO2 in 10 cm Falcon dishes (BD Biosciences, San Jose, CA) containing 10 ml of culture media: DMEM+GlutaMAX™-I (Gibco, Carlsbad, CA) supplemented with fetal bovine serum (FBS, 10%), HEPES (10 mM) and penicillin/streptomycin (100 units/ml and 100 µg/ml, respectively). Once cells reached ∼70% confluence, they were transfected with either pIRES2-EGFP-mCB1 or pIRES2-EGFP-mCB2 using SuperFect (QIAGEN, Valencia, CA) according to the manufacturer's instructions. Three days after transfection, the resulting positive cells (∼5% of fluorescent green cells) were isolated using fluorescence assisted cell sorting (FACS, BD FACS Vantage SE) (Figure S4). These enriched cells were put back into culture for an additional 7 days of selection and expanded in media containing G418 (10 ml per 10 cm culture dishes). Cells that survived were isolated again by FACS, and similarly reselected and expanded for three additional rounds to ensure for the stability of each clone. In the final round, we used FACS to isolate single eGFP-positive cells and seeded them into Costar 96-well plates (0.2 ml per well, changing the media every 3–5 days). Three to six weeks later, all single-cell subclones that had expanded were harvested. Please note that both the fluorescence emitted by these single-cell subclones and the receptor expression levels were stable for at least 20 passages, showing that the shuttled plasmid had been stably incorporated in these cells.
qPCR and Radioligand Binding
Cells (106) were expanded in 10 cm dishes using 10 ml culture media. Once they reached ∼70% confluence, they were rinsed with PBS and kept for an additional 24 hrs in serum-deprived media, which is composed of DMEM+GlutaMAX™-I supplemented with fatty acid free bovine serum albumin (0.1%, BSA, Sigma-Aldrich, St. Louis, MO) and insulin-transferin-sodium selenite liquid media (1×, ITS, Sigma-Aldrich). For qPCR, media was removed and cells washed once with 10 ml PBS, then cells were scraped and total RNA isolated using RNeasy extraction kit (QIAGEN) according to the manufacturer's instructions. The following primer and TaqMan probe sequences were generated using Primer Express (Perkin-Elmer Applied Biosystems, Foster City, CA): mCB1 forward, 5′-cacaagcacgccaataacaca-3′, reverse, 5′-acagtgctcttgatgcagctttc-3′, probe, 5′-(gccagcatgcacagggccgcg)-3′; mCB2 forward, 5′-gaacatggccgtgctctatattatc-3′, reverse, 5′-gaacaggtacgagggctttctg-3′, probe, 5′-(ctgtcctcccggcggctccg)-3′. Total RNA from each sample (2.5 ng) was reverse transcribed in the same 10 µl quantitative PCR reaction mix using the Brilliant Single-Step Quantitative RT-PCR Core Reagent Kit (Stratagene, La Jolla, CA). Combined reactions were carried out on a Stratagene Mx3000P Real-Time Detection System using the following protocol: 30 min single-strand synthesis reaction at 45°C; 40-cycle, two-step PCR amplification (15 sec at 95°C followed by 1 min at 56°C). Duplicate reactions with and without reverse transcriptase were run for each sample. For radioligand binding, media was removed and cells washed once with 10 ml PBS. Cells were scraped in 1 ml buffer (50 mM Tris-HCl, 3 mM MgCl2, 1 mM EDTA, pH 7.4) and pulse homogenized 10 sec using PRO200 tissue homogenizer (PRO Scientific, Oxford, CT). Crude membrane preparations were generated by centrifugation of cell homogenates for 20 min at >10,000×g. Cell pellets were resuspended in buffer containing BSA (0.1%, fatty acid free) and 50 µg protein added to siliconized glass tubes for assay. Concentrations of [3H]CP-55,940 between 0.1 and 10 nM were used for saturation experiments, and 1 µM CP-55,940 was used to determine specific binding. After 1 hr incubation at 30°C, reactions were stopped by rapid filtration over GF/B glass fiber filters on a 24-well M-24T Brandel cell harvester (Brandel, Gaithersburg, MD) and washed 3 times with ice-cold binding buffer containing BSA. Radioactivity on filters was measured using scintillation counter.
Quantifying the Phosphorylation of ERK1/2, AKT, JNK, p38 and GSKβ
Cells were expanded in Costar 24-well plates (105 cells per well) in culture media (0.5 ml per well). Once they reached ∼70% confluence, they were rinsed with PBS and kept for an additional 24 hrs in serum-deprived media, at which time point drugs or vehicle (DMSO, 0.1%) prepared in 50 µl serum-deprived media were directly added to each well for the corresponding number of minutes. We chose to directly administer the drugs to cell culture media instead of replacing the media to avoid stress-induced increases in basal kinase phosphorylation (Figure S1). To quantify Erk phosphorylation, reactions were stopped by removing the media and adding NuPAGE® LDS sample buffer (300 µl, Invitrogen, Carlsbad, CA) supplemented with 2-mercaptoethanol (1%). An aliquot of each sample (20 µl) was loaded onto NuPAGE® 4–12% Bis-Tris pre-cast gels (Inivtrogen) and electrophoresed according to the manufacturer's instructions. Gels were electrophoretically transferred to P-nitrocellulose membrane (Millipore, Billerica, MA) and blocked in LiCOR blocking buffer (LiCOR, Lincoln, NE) for 1 hr at 25°C. Membranes were then incubated in blocking buffer containing rabbit anti-phospho-p44/42 antibody (1∶1000, Cell Signaling Technology, Inc., Danvers, MA) for 1 hr at 25°C. Membranes were washed 3 times with Tris (50 mM) buffered saline containing 0.1% Tween-20 (TBS-T). Membranes were then incubated in blocking buffer containing donkey anti-rabbit antibody conjugated to IRDye 800 (1∶7500, Rockland Immunochemicals, Inc., Gilbertsville, PA) for 1 hr at 25°C. Membranes were washed 3 times with TBS-T. The fluorescence intensity of each band was quantified using the LiCOR Odyssey. To quantify AKT, JNK, p38 and GSKβ phosphorylation, reactions were stopped by addition of NP40 cell lysis buffer (100 µl, Invitrogen). Substrate phosphorylation was quantified using a Biosource Multiplex Bead Immunoassay kit (Invitrogen) according to the manufacturer's instructions and using a Luminex 100™ instrument (Luminex, Austin, TX). Note that the basal phosphorylation state of these kinases in each subclone did not change significantly when the cells were incubated over the 30 min time-period of the incubation with vehicle only (Figure S1).
Quantification of Cell Viability and Apoptosis by WST-1, Propidium Iodine (PI) and Annexin V
Cells were expanded in 24-well plates (105 cells per well) in culture media (0.5 ml per well). Once they reached ∼70% confluence, they were rinsed with PBS and kept for an additional 24 hrs in serum-deprived media, at which time drugs or vehicle (DMSO, 0.1%) prepared in 50 µl serum-deprived media were directly added to each well. After 1, 3, or 5 days, cell viability was assessed using the Cell Proliferation Reagent WST-1 (Roche, Indianapolis, IN). Briefly, WST-1 reagent (50 µl) was added to each well for 4 hrs at 37°C with 5% CO2, and then WST-1 products were read at 450 nm using Packard SpectraCount™. Apoptosis was assessed using PI and annexin V (Pacific Blue™, Invitrogen). Briefly, cells were detached using trypsin, rinsed with 25°C PBS and resuspended to a density of 106 cells per ml of annexin-binding buffer (10 mM HEPES, 140 mM NaCl, 2.5 mM CaCl2, pH 7.4). PI (100 ng) and annexin V were added to 100 µl of cell suspension and incubated at 25°C for 30 min. Additional annexin-binding buffer was added (400 µl) and samples were sorted (10,000 events) on a LSR II flow cytometer (BD Biosciences, San Jose, CA) and the data analyzed using FlowJo (Tree Star, Inc., Ashland, OR).
Data Analysis
Statistics, Bmax, kd, and EC50 values were calculated using Prism.Kinase activity in wild-type.(0.45 MB TIF)Click here for additional data file.p38 and jnk activity.(0.49 MB TIF)Click here for additional data file.Sequence alignement between mouseCB1 and mouseCB2.(0.77 MB TIF)Click here for additional data file.Scheme outlining the development of stable clones.(0.48 MB TIF)Click here for additional data file.qPCR identification of cannabinoid receptor stable subclones.(0.04 MB DOC)Click here for additional data file.
Authors: C Sánchez; M L de Ceballos; T Gomez del Pulgar; D Rueda; C Corbacho; G Velasco; I Galve-Roperh; J W Huffman; S Ramón y Cajal; M Guzmán Journal: Cancer Res Date: 2001-08-01 Impact factor: 12.701
Authors: Kang Chen; Anna Ratzliff; Lutz Hilgenberg; Attila Gulyás; Tamás F Freund; Martin Smith; Thien P Dinh; Daniele Piomelli; Ken Mackie; Ivan Soltesz Journal: Neuron Date: 2003-08-14 Impact factor: 17.173
Authors: Melisa J Wallace; Robert E Blair; Katherine W Falenski; Billy R Martin; Robert J DeLorenzo Journal: J Pharmacol Exp Ther Date: 2003-09-03 Impact factor: 4.030
Authors: Ying Pei; Richard W Mercier; Jenine K Anday; Ganesh A Thakur; Alexander M Zvonok; Dow Hurst; Patricia H Reggio; David R Janero; Alexandros Makriyannis Journal: Chem Biol Date: 2008-11-24
Authors: William R Marrs; Eric A Horne; Silvia Ortega-Gutierrez; Jose Antonio Cisneros; Cong Xu; Yi Hsing Lin; Giulio G Muccioli; Maria L Lopez-Rodriguez; Nephi Stella Journal: J Biol Chem Date: 2011-06-10 Impact factor: 5.157