Literature DB >> 19495413

Improved resolution haplogroup G phylogeny in the Y chromosome, revealed by a set of newly characterized SNPs.

Lynn M Sims1, Dennis Garvey, Jack Ballantyne.   

Abstract

BACKGROUND: Y-SNP haplogroup G (hgG), defined by Y-SNP marker M201, is relatively uncommon in the United States general population, with only 8 additional sub-markers characterized. Many of the previously described eight sub-markers are either very rare (2-4%) or do not distinguish between major populations within this hg. In fact, prior to the current study, only 2% of our reference Caucasian population belonged to hgG and all of these individuals were in sub-haplogroup G2a, defined by P15. Additional Y-SNPs are needed in order to differentiate between individuals within this haplogroup. PRINCIPAL
FINDINGS: In this work we have investigated whether we could differentiate between a population of 63 hgG individuals using previously uncharacterized Y-SNPs. We have designed assays to test these individuals using all known hgG SNPs (n = 9) and an additional 16 unreported/undefined Y-SNPS. Using a combination of DNA sequence and genetic genealogy databases, we have uncovered a total of 15 new hgG SNPs that had been previously reported but not phylogenetically characterized. Ten of the new Y-SNPs are phylogenetically equivalent to M201, one is equivalent to P15 and, interestingly, four create new, separate haplogroups. Three of the latter are more common than many of the previously defined Y-SNPs. Y-STR data from these individuals show that DYS385*12 is present in (70%) of G2a3b1-U13 individuals while only 4% of non-G2a3b1-U13 individuals posses the DYS385*12 allele.
CONCLUSIONS: This study uncovered several previously undefined Y-SNPs by using data from several database sources. The new Y-SNPs revealed in this paper will be of importance to those with research interests in population biology and human evolution.

Entities:  

Mesh:

Substances:

Year:  2009        PMID: 19495413      PMCID: PMC2686153          DOI: 10.1371/journal.pone.0005792

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Single nucleotide polymorphisms (SNPs) are the smallest and most abundant type of human DNA polymorphisms [1]. SNPs have been extensively used in the study of human evolutionary and migratory patterns [2] and are increasingly being used in genome-wide association studies [3]. Y-SNPs, in particular, are of interest due to their paternal inheritance, lack of recombination, abundance, and low mutation rate and are currently being investigated for characterizing male population structure and ethnogeographic origin in forensic science [4]–[10]. These unique polymorphisms within the non-recombining region (NRY) of the Y-chromosome (mainly SNPs) have created population specific paternal lineages (commonly called haplogroups) that have persisted throughout human history. Large scale parsimonious phylogenetic trees representing world wide Y chromosomal variation have been constructed and comprise the major haplogroups A-T [11]–[13]. The rules for naming haplogroups have been designed to adjust for new SNPs that are continuously being identified and characterized to be added to the tree and potentially reshaping it as in the most recently published y-chromosomal haplogroup tree [13]. Although some are rare (e.g. [14]), some can still be useful for individual identification especially if found at higher frequencies in certain defined populations. Many of these polymorphisms have proven highly informative in tracing human prehistoric migrations and generating new hypotheses on human colonization and migrations [15]. This study recruited 54 hgG men from the pool available in Ysearch.org (http://www.ysearch.org) in addition to 9 that we possessed in-house. We have uncovered a total of 15 new hgG SNPs, four of which create new sub-haplogroups with the hgG clade. Additionally, we have also discovered that the Y-STR DYS385*12 is present in (70%) of the new hg G2a3b1-U13 individuals and only 4% of non-G2a3b1-U13 individuals.

Results

Phylogenetic trees were constructed to show the evolutionary relationships between the previously characterized hgG SNPs and 15 newly characterized hgG SNPs (Figure 1A and 1B). The population frequencies of Haplogroup G individuals in sub hgG groups without (Figure 1A) and with the newly characterized Y-SNPs are also shown (Figure 1B). Eleven of the new Y-SNPs were phylogenetically indistinct from the current G-M201 and G2a-P15 markers. However, four newly characterized SNPs (U8, U16, U1, U13) permitted the definition of four new sub-clades of hg G (G2a3*, G2a3a, G2a3b*, G2a3b1) which, in our population sample, increased the number of observable hg G genotypes by 80% (from five to nine). To ascertain the extent to which the new markers are useful for differentiating hgG individuals, the probability of discrimination (DP) obtained by typing individuals with and without the four new informative markers was calculated [16]. The DP was increased 72%, from 0.40 to 0.69, in our Caucasian sample set.
Figure 1

Phylogenetic Trees Indicating the Frequencies of Haplogroup G Individuals with (B) and without (A) the Newly Characterized Y-SNPs.

The haplogroup names are assigned base on the most recent haplogroup tree by Karafet et al. [13].

Phylogenetic Trees Indicating the Frequencies of Haplogroup G Individuals with (B) and without (A) the Newly Characterized Y-SNPs.

The haplogroup names are assigned base on the most recent haplogroup tree by Karafet et al. [13]. Examination of the allele distribution of DYS385 showed that the allele DYS385*12 was over-represented in the G2a3b1-U13 samples (7/10 samples possess the 12 allele). Only two copies of the DYS385*12 allele were found in the other 53 non-G2a3b1-U13 samples (4%). Thus the DYS385*12 is highly predictive (P = 0.70) of a G2a3b1-U13 individual if the individual is known to belong to hgG. Such Y-STR information can sometimes facilitate a speedier haplogroup assignment and differentiation than would be available from a strict hierarchy-based SNP analysis. In summary, we have characterized 15 new hgG SNPs that had been previously reported but not phylogenetically defined. Ten of the new Y-SNPs are phylogenetically indistinguishable from G-M201, one is equivalent to G2a-P15 but four create new, separate hg G sub-haplogroups. Three of the latter are more common than many of the previously defined hgG Y-SNPs.

Discussion

Y-SNP haplogroup G (hgG), defined by the Y-SNP marker G-M201, is relatively uncommon in the European American population of the United States. This haplogroup is thought to have originated in the Caucasus region of Eurasia, especially in the North Ossetians [17] and specifically, the Digora population with an average frequency of 74% [18]. Also approximately 11% of individuals in Anatolia [19] and 17% in Northern Sardenia [20] belong to hgG. In a study on Y-chromosomes in the Caucasus, it was found that the hgG genotype frequency ranges from 21%–74% in seven different populations of the north Caucasus region while it is only found within 3 populations in south Caucasus region (at frequencies of 11%, 18%, and 31%) [18]. It has been proposed that the peoples from these regions originated from West Asia rather than Europe due the high frequencies of the G, J2* and F* haplogroups [17]. Prior to this study, only 8 sub-markers had been described within haplogroup G[11], [19], [21] with the most common haplogroup being G2a*, defined by P15. Many of the previously described eight sub-markers are either very rare or do not distinguish between major populations within this haplogroup. In fact, prior to the current study, only 2% of our reference European American population was within hgG and all of the individuals were in sub-haplogroup G2a defined by the P15 polymorphism [10]. In this work we have investigated whether we could differentiate between a population of 63 hgG individuals using previously uncharacterized Y-SNPs as well as their associated 19 marker Y-STR haplotypes. Here we describe the characterization of new hgG sub-markers, four of which can further differentiate between sub-populations within this hg. The subjects were recruited from a selection of over 500 haplogroup G men available in public genetic-genealogy databases in the fall of 2006. This was especially valuable in the case of a somewhat rare European haplogroup like haplogroup G (about 2–4% of the general population) [10], [19], [22], [23]. The selection of hgG men from already SNP typed populations provided a tremendous savings in time and cost for this project. To have found this large of a sample of HgG men without the resource of the genetic genealogy community's results would have necessitated the SNP typing of approximately 1500 men. This study exemplifies the success obtainable by productive collaboration between genetics researchers and the genetic genealogy community.

Materials and Methods

This study was conducted according to the principles expressed in the Declaration of Helsinki. The study was approved by the Institutional Review Board of the University of Central Florida. All participants provided written informed consent for the collection of samples and subsequent analysis.

Candidate SNP Identification

DNA sequence traces from the NCBI Trace Archives were used to identify SNPs of an individual from haplogroup G, in silico. Most of the earliest mapping of the Y chromosome was done using the BAC library from the California Institute of Technology called CTC. This included the contigs: AC005942.2 CTC-298B15, AC002992.1 CTC-203M13, AC004617.2 CTC-264M20, AC002531.1 CTC-486O8, AC004474.1 CTC-475I1, AC006565.4 CTC-484O7, AC005820.1 CTC-494G17, and AC078938.3 CTC-480L15. The Y-SNP marker M201 in contig AC004474 was seen to be derived rather than ancestral in the reference sequence. This means that the man used in the CTC library belonged to YCC haplogroup G. The assumption was made that the contents of the NCBI Trace Archives were not likely to contain the re-sequencing of any other haplogroup G men (since G is seen in only about 3% of the males of European descent). Candidate YSNPs were chosen on the basis of appearing in only the above reference contigs and none of the traces in the Trace Archives. Those candidate SNPs were typed and characterized in a panel of 63 haplogroup G men. Additionally, all previously defined hgG Y-SNPs were compiled from various publications and a 25 member candidate list of SNPs suspected to be polymorphic inside haplogroup G was developed for assay development and subsequent population studies.

Biological Sample Donors

Buccal swabs were obtained from a total of 74 individuals including 63 human males belonging to Y-SNP hgG, one human female, one male chimp, and one human individual from each of the following hgs: A, B, C, E3a, F, H, I, J, and R1b. Fifty-four of the individuals were recruited from the list of individuals whose 37 locus Y-STR haplotypes and Y-SNP haplogroups are available in http://www.ysearch.org. All DNA samples were obtained with the individual's informed consent in accordance with the University of Central Florida's Institutional Review Board.

Genomic DNA isolation

A small piece of the buccal swab was cut and placed in a Spin-ease tube (Gibco-BRL, Grand Island, NY) and incubated overnight at 56°C in 400 µL DNA extraction buffer (100 mM NaCl, 10 mM Tris-HCl, pH 8.0, 25 mM EDTA, 0.5% SDS, and 0.1 mg/ml Proteinase K). The cut material was then removed from the tube and placed in a Spin-ease basket and the basket was then placed back in the original tube and centrifuged (Eppendorf Centrifuge 5415D) at 13,200 rpm for 5 min. The extract was then purified and isolated using 25∶24∶1 phenol/chloroform/isoamyl achohol (Fisher Scientific, Norcross, GA) followed by filtration using Microcon® 100 centrifugal filter devices (Millipore, Bedford, MA) according to the manufacturer's instructions. Samples were brought to a final volume of 50 µL in TE−4 (10 mM Tris-HCl and 0.1 mM EDTA, pH 7.5) and stored at 4°C until analysis. DNA was quantified by gel electrophoresis in a 1% Agarose gel. Samples were visualized using the ΩMega 12ic™ Gel documentation system (Ultra-Lum, Claremont, CA). Quantification was accomplished by a comparison of the fluorescence intensity of the unknown bands to a set of known quantity standards that were run simultaneously.

SNP Primer Design and PCR

Assays were developed to amplify regions flanking the SNP for use with pyrosequencing technology. Extracted female DNA was also tested to ensure male specificity. All SNPs were tested against individuals from hgs A, B, C, E, F, H, I, J, and R for haplogroup determination and ancestral vs. derived states. A male chimp was also tested to facilitate determination of the ancestral vs. derived states. PCR primers were designed using a combination of Primer3[24] and SNP Primer Design Pyrosequencing AB v.1.0.1.software. The 50 µL PCR reaction contained: 1 ng DNA, 0.2 µM each primer, 125 µM dNTPs, 1X PCR Buffer II (10 mM Tris-HCl, pH 8.3, 50 mM KCl), 2.0 mM MgCl2, 10 µg non-acetylated BSA (Sigma, St. Louis, MO) and 1.5 units of AmpliTaq® Gold Polymerase (Applied Biosystems, Foster City, CA). Cycling conditions were: (1) 95°C for 10 min, (2) 40 cycles: 95°C for 15 s, 54°C for 30 s, 72°C for 15 s, and (3) final extension at 72°C for 5 min, unless otherwise noted. Table 1 provides details of the SNP loci used and the PCR primers used.
Table 1

List of Y-SNPS, their associated database references, and location of the SNP within the product for the indicated primers.

SNP Namers # or AC#: SNP Product Size (bp)Position (bp)Forward (5′-3′)Reverse (5′-3′)
M201 AC004474.1: G>T310199 CATGGGTAATTCGGTTGTTACC GCCCTTTGGTGGCATAGTA
P15 AC007876.2: C>T7534 GAATAGAGCCAATGCTTGAGGT TATGGGAATCACTTTTGCAACT
P16 AC068541.7: A>T8434 GTCGTTTATTTGGTGCCTGAA CTATGACCTCAGCAGAATGGA
P18 AC016698.3: C>T14180 GGTTGGGATTGTGACTCCTCT CTGGGCAAATTTACCTGTCTC
P20 AC016698.3: C>del14130 GGTTGGGATTGTGACTCCTCT CTGGGCAAATTTACCTGTCTC
M285 AC007678.3: C>G18863 GAGCCGTTGTCCCTGTGTTT TGCAGGCATCAGCTAGATTGT
M287 AC007678.3: A>T18893 GAGCCGTTGTCCCTGTGTTT TGCAGGCATCAGCTAGATTGT
M286 AC007678.3: G>A188123 GAGCCGTTGTCCCTGTGTTT TGCAGGCATCAGCTAGATTGT
M342 AC007876.2: C>T10340 AACAGGGCGTAACAAATAGGT TGGCTCTATTCATGTGAGGAA
M377 AC004474.1: A>G19593 TCGGTTGTTACCTTGAGCATT CGAAAAACCTCAGTTGATACTGG
U1 rs9785956: A>G189118 TTTCTGCTCCAAATCTGCTG CACCTGTAATCGGGAGGCTA
U2 rs9786712: G>A150123 AGCTCATCTTCACGGGTGTG ACAGGGCAAAGGAATCGTTA
U3 rs11799152: A>G15345 CTTGAACCCAAGACGAGGAG CAACAGTGGATCCCACATCA
U6 rs2740980: G>A7143 CCTCAGTCTCTCCGATTCCTT CTTTCATCTCCAACCCCCATC
U5 rs2178500: T>G6424 CTATCACCCAGAGACCCCTCA GAATCGGGTCCCATAACAAT
U7 rs7067251: G>C222124 GATCCCACAGAGTGCTCAGG CATGGGGTAAGAGAATGGGTA
U8 rs7892988: T>C7045 TATAACCAAAAATGGCACGAT GGATTAAGGTTGCCATCAGG
U12 rs9786640: A>C16243 CTATGAGCATTTGGGGGCTTA CCTTGTATCCTCCCTCCCTTT
U13 rs9786706: C>T8148 GTGGTAACAGCTCCTGGTGAG TGCTGCTTTGGTTAACTGTCC
U16 rs35474563: C>T10730 CTCATTTGACTTCCCGCTGT CTAGGACGCAGACGTCTTACC
U17 rs34742138: C>T175150 CAGTTGTGCATCAACCATTCA AACCTAGGTACTTCTTCCACTTCTC
U21 AC005820.1: C>T9853 CTGGCACCTCCTCTCACTTC TCAAGGAGCTTCCACTCACG
U20 * rs16648: AG>del11961 AGACAAAGTCGGGGTTTTGA GATCTGCCTCTTTCCCAAAAT
U23 * rs9786460: G>A18158 GGTGGGAGAATTACCTGAACC AGCTTCCTGAGTTCCCTTTTT
U33 * rs1125978: C>G9468 CCCAATGTCCCTCTTTCCTT ACCCACTTTGACCCAATCTG

SNP is listed as: ancestral>derived.

U20 and U33 were amplified at 56°C annealing temperature and U23 was amplified at 57°C for only 35 cycles.

SNP is listed as: ancestral>derived. U20 and U33 were amplified at 56°C annealing temperature and U23 was amplified at 57°C for only 35 cycles.

SNP/STR Genotyping and Phylogenetic Analysis

SNP genotyping was performed by pyrosequencing on a PSQ™ 96 MA instrument according to the manufacturer’s recommendations (Biotage, Uppsala, Sweden, http://www.biotage.com). SNP genotype data were collected and the phylogenetic relationships were depicted in a phylogenetic tree showing the corresponding frequencies for each haplogroup observed. Haplogroups were assigned based on the most recent comprehensive Y chromosomal haplogroup tree published by Karafet et al. [13]. All STR genotyping (19 locus haplotypes) was performed on a Macintosh-based ABI Prism 310 capillary electrophoresis system using two validated multiplex systems, MP I and MP II, as previously described [25], [26]. For two individuals whose STR haplotypes were not determined as just described, some Y STR data were available from http://www.ysearch.org. The probability of discrimination (DP)[16] was calculated as: DP = 1−∑p 2, where p is the observed frequency of the derived allele at each of the sub hg G haplogroups.
  27 in total

1.  Primer3 on the WWW for general users and for biologist programmers.

Authors:  S Rozen; H Skaletsky
Journal:  Methods Mol Biol       Date:  2000

2.  A nomenclature system for the tree of human Y-chromosomal binary haplogroups.

Authors: 
Journal:  Genome Res       Date:  2002-02       Impact factor: 9.043

3.  Y-chromosomal SNP haplotype diversity in forensic analysis.

Authors:  M A Jobling
Journal:  Forensic Sci Int       Date:  2001-05-15       Impact factor: 2.395

4.  From surnames to the history of Y chromosomes: the Sardinian population as a paradigm.

Authors:  Gianna Zei; Antonella Lisa; Ornella Fiorani; Chiara Magri; Lluis Quintana-Murci; Ornella Semino; A Silvana Santachiara-Benerecetti
Journal:  Eur J Hum Genet       Date:  2003-10       Impact factor: 4.246

Review 5.  The human Y chromosome: an evolutionary marker comes of age.

Authors:  Mark A Jobling; Chris Tyler-Smith
Journal:  Nat Rev Genet       Date:  2003-08       Impact factor: 53.242

6.  Excavating Y-chromosome haplotype strata in Anatolia.

Authors:  Cengiz Cinnioğlu; Roy King; Toomas Kivisild; Ersi Kalfoğlu; Sevil Atasoy; Gianpiero L Cavalleri; Anita S Lillie; Charles C Roseman; Alice A Lin; Kristina Prince; Peter J Oefner; Peidong Shen; Ornella Semino; L Luca Cavalli-Sforza; Peter A Underhill
Journal:  Hum Genet       Date:  2003-10-29       Impact factor: 4.132

7.  Multiplex PCR and minisequencing of SNPs--a model with 35 Y chromosome SNPs.

Authors:  Juan J Sanchez; Claus Børsting; Charlotte Hallenberg; Anders Buchard; Alexis Hernandez; Niels Morling
Journal:  Forensic Sci Int       Date:  2003-10-14       Impact factor: 2.395

8.  New binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree.

Authors:  Tatiana M Karafet; Fernando L Mendez; Monica B Meilerman; Peter A Underhill; Stephen L Zegura; Michael F Hammer
Journal:  Genome Res       Date:  2008-04-02       Impact factor: 9.043

Review 9.  SNP alleles in human disease and evolution.

Authors:  Barkur S Shastry
Journal:  J Hum Genet       Date:  2002       Impact factor: 3.172

10.  The development of an 18-locus Y-STR system for forensic casework.

Authors:  Ashley Hall; Jack Ballantyne
Journal:  Anal Bioanal Chem       Date:  2003-06-27       Impact factor: 4.142

View more
  11 in total

Review 1.  The impact of recent events on human genetic diversity.

Authors:  Mark A Jobling
Journal:  Philos Trans R Soc Lond B Biol Sci       Date:  2012-03-19       Impact factor: 6.237

2.  In the name of the migrant father--analysis of surname origins identifies genetic admixture events undetectable from genealogical records.

Authors:  M H D Larmuseau; J Vanoverbeke; G Gielis; N Vanderheyden; H F M Larmuseau; R Decorte
Journal:  Heredity (Edinb)       Date:  2012-04-18       Impact factor: 3.821

3.  New insights into the Tyrolean Iceman's origin and phenotype as inferred by whole-genome sequencing.

Authors:  Andreas Keller; Angela Graefen; Markus Ball; Mark Matzas; Valesca Boisguerin; Frank Maixner; Petra Leidinger; Christina Backes; Rabab Khairat; Michael Forster; Björn Stade; Andre Franke; Jens Mayer; Jessica Spangler; Stephen McLaughlin; Minita Shah; Clarence Lee; Timothy T Harkins; Alexander Sartori; Andres Moreno-Estrada; Brenna Henn; Martin Sikora; Ornella Semino; Jacques Chiaroni; Siiri Rootsi; Natalie M Myres; Vicente M Cabrera; Peter A Underhill; Carlos D Bustamante; Eduard Egarter Vigl; Marco Samadelli; Giovanna Cipollini; Jan Haas; Hugo Katus; Brian D O'Connor; Marc R J Carlson; Benjamin Meder; Nikolaus Blin; Eckart Meese; Carsten M Pusch; Albert Zink
Journal:  Nat Commun       Date:  2012-02-28       Impact factor: 14.919

4.  Distinguishing the co-ancestries of haplogroup G Y-chromosomes in the populations of Europe and the Caucasus.

Authors:  Siiri Rootsi; Natalie M Myres; Alice A Lin; Mari Järve; Roy J King; Ildus Kutuev; Vicente M Cabrera; Elza K Khusnutdinova; Kärt Varendi; Hovhannes Sahakyan; Doron M Behar; Rita Khusainova; Oleg Balanovsky; Elena Balanovska; Pavao Rudan; Levon Yepiskoposyan; Ardeshir Bahmanimehr; Shirin Farjadian; Alena Kushniarevich; Rene J Herrera; Viola Grugni; Vincenza Battaglia; Carmela Nici; Francesca Crobu; Sena Karachanak; Baharak Hooshiar Kashani; Massoud Houshmand; Mohammad H Sanati; Draga Toncheva; Antonella Lisa; Ornella Semino; Jacques Chiaroni; Julie Di Cristofaro; Richard Villems; Toomas Kivisild; Peter A Underhill
Journal:  Eur J Hum Genet       Date:  2012-05-16       Impact factor: 4.246

5.  Ancient DNA reveals male diffusion through the Neolithic Mediterranean route.

Authors:  Marie Lacan; Christine Keyser; François-Xavier Ricaut; Nicolas Brucato; Francis Duranthon; Jean Guilaine; Eric Crubézy; Bertrand Ludes
Journal:  Proc Natl Acad Sci U S A       Date:  2011-05-31       Impact factor: 11.205

Review 6.  The Y chromosome as the most popular marker in genetic genealogy benefits interdisciplinary research.

Authors:  Francesc Calafell; Maarten H D Larmuseau
Journal:  Hum Genet       Date:  2016-11-05       Impact factor: 4.132

7.  The phylogenetic and geographic structure of Y-chromosome haplogroup R1a.

Authors:  Peter A Underhill; G David Poznik; Siiri Rootsi; Mari Järve; Alice A Lin; Jianbin Wang; Ben Passarelli; Jad Kanbar; Natalie M Myres; Roy J King; Julie Di Cristofaro; Hovhannes Sahakyan; Doron M Behar; Alena Kushniarevich; Jelena Sarac; Tena Saric; Pavao Rudan; Ajai Kumar Pathak; Gyaneshwer Chaubey; Viola Grugni; Ornella Semino; Levon Yepiskoposyan; Ardeshir Bahmanimehr; Shirin Farjadian; Oleg Balanovsky; Elza K Khusnutdinova; Rene J Herrera; Jacques Chiaroni; Carlos D Bustamante; Stephen R Quake; Toomas Kivisild; Richard Villems
Journal:  Eur J Hum Genet       Date:  2014-03-26       Impact factor: 4.246

8.  Temporal differentiation across a West-European Y-chromosomal cline: genealogy as a tool in human population genetics.

Authors:  Maarten H D Larmuseau; Claudio Ottoni; Joost A M Raeymaekers; Nancy Vanderheyden; Hendrik F M Larmuseau; Ronny Decorte
Journal:  Eur J Hum Genet       Date:  2011-11-30       Impact factor: 4.246

9.  AMY-tree: an algorithm to use whole genome SNP calling for Y chromosomal phylogenetic applications.

Authors:  Anneleen Van Geystelen; Ronny Decorte; Maarten H D Larmuseau
Journal:  BMC Genomics       Date:  2013-02-13       Impact factor: 3.969

10.  Paleo-Balkan and Slavic contributions to the genetic pool of Moldavians: insights from the Y chromosome.

Authors:  Alexander Varzari; Vladimir Kharkov; Alexey G Nikitin; Florina Raicu; Kseniya Simonova; Wolfgang Stephan; Elisabeth H Weiss; Vadim Stepanov
Journal:  PLoS One       Date:  2013-01-16       Impact factor: 3.240

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.