Literature DB >> 18177499

A direct repeat of E-box-like elements is required for cell-autonomous circadian rhythm of clock genes.

Yasukazu Nakahata1, Mayumi Yoshida, Atsuko Takano, Haruhiko Soma, Takuro Yamamoto, Akio Yasuda, Toru Nakatsu, Toru Takumi.   

Abstract

BACKGROUND: The circadian expression of the mammalian clock genes is based on transcriptional feedback loops. Two basic helix-loop-helix (bHLH) PAS (for Period-Arnt-Sim) domain-containing transcriptional activators, CLOCK and BMAL1, are known to regulate gene expression by interacting with a promoter element termed the E-box (CACGTG). The non-canonical E-boxes or E-box-like sequences have also been reported to be necessary for circadian oscillation.
RESULTS: We report a new cis-element required for cell-autonomous circadian transcription of clock genes. This new element consists of a canonical E-box or a non-canonical E-box and an E-box-like sequence in tandem with the latter with a short interval, 6 base pairs, between them. We demonstrate that both E-box or E-box-like sequences are needed to generate cell-autonomous oscillation. We also verify that the spacing nucleotides with constant length between these 2 E-elements are crucial for robust oscillation. Furthermore, by in silico analysis we conclude that several clock and clock-controlled genes possess a direct repeat of the E-box-like elements in their promoter region.
CONCLUSION: We propose a novel possible mechanism regulated by double E-box-like elements, not to a single E-box, for circadian transcriptional oscillation. The direct repeat of the E-box-like elements identified in this study is the minimal required element for the generation of cell-autonomous transcriptional oscillation of clock and clock-controlled genes.

Entities:  

Mesh:

Substances:

Year:  2008        PMID: 18177499      PMCID: PMC2254435          DOI: 10.1186/1471-2199-9-1

Source DB:  PubMed          Journal:  BMC Mol Biol        ISSN: 1471-2199            Impact factor:   2.946


Background

Circadian rhythms, periodicities with an approximate 24-h length, are essential physiological functions in almost all organisms on the earth and are generated by endogenous biological clocks. The biological clocks consist of 3 components: input, pacemaker, and output. The endogenous period length is not exactly 24 h and must be entrained by light. In mammals, other entrainment cues such as food intake or temperature, even social cues, can reset the circadian rhythm. The central oscillator in mammals is located in the suprachiasmatic nuclei (SCN) in the anteroventral hypothalamus. Recent studies revealed that the peripheral clocks reside not only in other brain regions but also in peripheral organs and even in cultured cells [1-4]. The output of the biological clocks includes broad physiological phenomena such as locomotor activity, sleep-wake cycle, hormonal secretion, cardiovascular condition, bowel movement, and even mental states. The disturbance of the biological clocks may cause many dysfunctions from routinely experienced jet-lag or work-shift problems to sleep disturbance and cardiovascular, metabolic or mental diseases [2,5]. Recent molecular biological studies have revealed that the molecular mechanism of the biological clocks is based on the interlocked loops of transcriptional and translational feedback [6-8]. Among the transcriptional controls in mammals, 3 major clock components for canonical clock genes, i.e., E-box, RORE, and DBPE, have been reported so far [3,9]. The E-box (CACGTG), for example, in the Per1 promoter, is the most well-known regulatory element. It is considered the binding site for the heterocomplex of CLOCK/BMAL1, which is a positive regulatory element. Negative regulatory elements, PERs and CRYs, restrain the transcriptional activity [10-12]. It is widely known that not only other clock genes are regulated by the E-box but also output regulators or clock-controlled genes are regulated by it as well [13-17]. On the other hand, Bmal1, whose circadian expression exhibits a sort of anti-phase to Per2 expression, is positively regulated by Rorα and negatively regulated by Rev-erbα, through RORE [18-21]. Per2 was literally cloned as a second mammalian period gene [22,23], however, gene-knockout analysis revealed a more prominent role for mPER2 in the mammalian clock than PER1 [24]. Using the in vitro rhythm oscillation monitoring system (IV-ROMS) [3,25], instead of the canonical E-box (CACGTG), we previously identified an E-box-like sequence (CACGTT) in the Per2 promoter region in vitro [26], which is essential for the cell-autonomous transcriptional oscillation of Per2 as well as for Per2 circadian oscillations in vivo [27]. For the cell-autonomous transcriptional oscillation of Per2, not only this E-box-like sequence but also the downstream region is involved in the circadian oscillation of Per2 [26]. Here, we identified closely spaced E-box or E-box-like elements in the regulatory regions of canonical clock genes including Per2. Our comprehensive approach raised the possibility that not just a single E-box but a direct repeat of E-box-like elements is required for circadian oscillation of core clock and clock-controlled genes.

Results

Our previous study demonstrated that an E-box-like sequence (CACGTT) and its downstream region are essential for transcriptional oscillation of Per2, a crucial component of molecular clocks [26]. Comparing with other mammalian genome sequences, within the conserved regions among mammalian (human, rhesus, rat, mouse, and opossum) genomes, we found that an E-box-like sequence followed by another non-canonical E-box with 6-base pairs (bp) between the two (Fig. 1A). In addition to Per2, we found a similar E-box or E-box-like sequence followed by another E-box-like sequence with an intervening space of 6 bp in Per1 and Per3, which are other mammalian period homologues, in their upstream promoter region close to the transcription start site (TSS). The E-box or E-box-like sequences distal and proximal to TSS were dubbed E1 and E2, respectively, and collectively as the "EE-element" (Fig. 1A). These sequences are well conserved among diverse mammals, such as human, rhesus, rat, and mouse, and even the opossum which is evolutionally located at the farthest branch from humans among the mammals. To examine whether these EE-elements are involved in transcriptional oscillation, we performed the IV-ROMS established in our previous study by using the following constructs: The oligonucleotides of 3 (hPer1, hPer2, and hPer3) EE-elements were inserted upstream of the SV40 promoter in a luciferase (luc) plasmid, and the constructed plasmids were used to transfect mouse NIH3T3 cells. All 3 EE-elements gave significant oscillation of luciferase activity but the amplitudes were different among the genes (Fig. 1B). The hPer2 EE-element displayed the most robust oscillation, whereas the hPer1 EE-element gave the lowest amplitude, which correlated with the patterns derived from luc-constructs containing the longer promoter regions [26]. The amplitude in circadian oscillation seemed to correlate with the number of mismatches in the E2 sequence. In fact, a mutant hPer3 EE-element, in which the GAG at the end of the E2 sequence was replaced with canonical GTG, exhibited a higher amplitude than the wild-type hPer3 EE-element (see Additional file 1).
Figure 1

The "EE-element" possesses transcriptional activity displaying a circadian rhythm. (A) Sequence alignments of the promoter region, containing each EE-element of Per1, Per2 and Per3 gene, among human, rhesus, rat, mouse and opossum (The NCBI accession numbers are indicated in Additional file 6). The core sequences (E1 and E2) within the EE-element are shown in capital letters. Numbers at both sides of alignments indicate the position from the transcription start site (TSS). (B) EE-element-driven luciferase bioluminescence by IV-ROMS. Black lines indicate bioluminescence after serum shock; and gray lines show the negative control (replacement with same medium). Abscissa presents "day"; and ordinate, "relative luciferase intensity". First peak values of the curves were set to 1.

The "EE-element" possesses transcriptional activity displaying a circadian rhythm. (A) Sequence alignments of the promoter region, containing each EE-element of Per1, Per2 and Per3 gene, among human, rhesus, rat, mouse and opossum (The NCBI accession numbers are indicated in Additional file 6). The core sequences (E1 and E2) within the EE-element are shown in capital letters. Numbers at both sides of alignments indicate the position from the transcription start site (TSS). (B) EE-element-driven luciferase bioluminescence by IV-ROMS. Black lines indicate bioluminescence after serum shock; and gray lines show the negative control (replacement with same medium). Abscissa presents "day"; and ordinate, "relative luciferase intensity". First peak values of the curves were set to 1. To investigate whether both E1 and E2 were necessary for generating the cell-autonomous oscillation, we again performed IV-ROMS with the use of the mutant hPer2 EE-element constructs. Not only the double E-box-like mutations (E1mE2m) but also the single E-box-like mutation (E1m or E2m) resulted in drastically reduced circadian transcription or led to an almost complete loss of transactivation (Fig. 2). A longer Per2 promoter (~2 kb) with double E-element mutants showed that the amplitude was heavily reduced, with circadian transcription hardly being observed (see Additional file 2). These results are similar to those obtained with mutations of 2 ROREs in the Bmal1 promoter [21] and suggest that these 2 E-box-like elements function in Per2 transactivation.
Figure 2

Effects of EE-element mutants on circadian expression of luciferase. (A) Wild-type (upper, gray letters) and mutant (bottom, black letters) sequences of hPer2 E1 and E2 and their flanking sequences are shown. Underlines indicate sequences changed from the wild-type one. The core sequence within the EE-element is shown in capital letters. (B) EE-element-driven luciferase bioluminescence by IV-ROMS. Gray lines indicate bioluminescence of wild-type hPer2 EE-element; and black lines, those of mutants. The abscissa presents "day", and the ordinate indicates "relative luciferase intensity". First peak values of the curves were set to 1.

Effects of EE-element mutants on circadian expression of luciferase. (A) Wild-type (upper, gray letters) and mutant (bottom, black letters) sequences of hPer2 E1 and E2 and their flanking sequences are shown. Underlines indicate sequences changed from the wild-type one. The core sequence within the EE-element is shown in capital letters. (B) EE-element-driven luciferase bioluminescence by IV-ROMS. Gray lines indicate bioluminescence of wild-type hPer2 EE-element; and black lines, those of mutants. The abscissa presents "day", and the ordinate indicates "relative luciferase intensity". First peak values of the curves were set to 1. To see whether endogenous clock transcription factors, BMAL1 and CLOCK, could bind to the EE-element, we investigated the binding of endogenous BMAL1 and CLOCK to hPer2 double-stranded DNA fragment immobilized on streptoavidin beads (Fig. 3). For this experiment, we raised specific antibodies against BMAL1 (see Additional file 3). Mouse liver lysates were prepared at 4-h intervals and immunoblotted with antibodies against BMAL1 or CLOCK (indicated as PC in Fig. 3A). When the lysates were incubated with the bead-bound Per2 oligonucleotides and electrophoresis performed, followed by immunoblotting, bands corresponding to BMAL1 and CLOCK were detected (Fig. 3A). The shifted bands seen correspond to phosphorylated BMAL1; and its phosphorylation level peaked around at CT (circadian time) 12, which is consistent with our previous data obtained with the Per2 promoter [26]. In contrast, the oligonucleotides with the same length but having scrambled sequences bound neither BMAL1 nor CLOCK proteins. The amounts of BMAL1 and CLOCK pulled down with mutant E1m or with the double-mutant E1mE2m were drastically reduced or almost undetectable compared with those pulled-down by the wild-type EE-element (Fig. 3B). This result suggests that the endogenous BMAL1 and CLOCK proteins bound to the E1 element but not to E2. On the other hand, when we used the E2m oligonucleotide, precipitated BMAL1 and CLOCK proteins were substantially detected. These results suggest that the binding of CLOCK/BMAL1 to E1 and that of unknown factors to E2 are necessary for cell-autonomous circadian transcription.
Figure 3

Pull-down assays by using oligonucleotides. (A) Both BMAL1 and CLOCK proteins bind to Per2 oligonucleotide. BMAL1 is phospholrylated in a circadian manner, whereas no binding to the random oligonucleotide occurs. Mouse liver lysates at CT 16 were electrophoresed and immunoblotted with anti-BMAL1 and anti-CLOCK (PC) and immunoprecipitated by anti-CLOCK and blotted by either BMAL1 or CLOCK (IP). WT; wild-type hPer2 oligonucleotide, E1; E1 mutant oligonucleotide, E2; E2 mutant oligonucleotide, E1mE2m; E1, E2 double mutant oligonucleotide. (B) As for BMAL1, the binding to E2m is clearly observed; whereas no binding to either E1m or E1mE2m is detected. For CLOCK, the binding to E2m is observed; however, the binding to E1m is hardly seen and no binding to E1mE2m is evident.

Pull-down assays by using oligonucleotides. (A) Both BMAL1 and CLOCK proteins bind to Per2 oligonucleotide. BMAL1 is phospholrylated in a circadian manner, whereas no binding to the random oligonucleotide occurs. Mouse liver lysates at CT 16 were electrophoresed and immunoblotted with anti-BMAL1 and anti-CLOCK (PC) and immunoprecipitated by anti-CLOCK and blotted by either BMAL1 or CLOCK (IP). WT; wild-type hPer2 oligonucleotide, E1; E1 mutant oligonucleotide, E2; E2 mutant oligonucleotide, E1mE2m; E1, E2 double mutant oligonucleotide. (B) As for BMAL1, the binding to E2m is clearly observed; whereas no binding to either E1m or E1mE2m is detected. For CLOCK, the binding to E2m is observed; however, the binding to E1m is hardly seen and no binding to E1mE2m is evident. We next examined the length of the space between E1 and E2, because the spaces between two E-box-like elements were 6 bp in all of 3 Pers EE-elements (Fig. 1A). To see whether the space length was crucial for cell-autonomous circadian transcription, we constructed different spaces (4~8 bp) between E1 and E2 of the hPer2 EE-element and performed IV-ROMS (Fig. 4). sp7, in which there were 7 bp spacing nucleotides between the 2 E-elements, yielded a circadian rhythmicity of Per2 transcription but with a slightly diminished amplitude compared with the wild-type oligonucleotide. The amplitude of sp5 and sp8 (5-bp and 8-bp space, respectively) or sp4 (4-bp space) displayed almost no or no oscillation of Per2, respectively. These results demonstrate that the spacing between the 2 E-elements was critical for rhythm generation and that the 6-bp (or 7-bp) space was necessary for cell-autonomous transcriptional oscillation. Thus the EE-element for circadian rhythm may be defined as follows: 1) E1 and E2 allow 1 and 2 base mismatches, respectively, and 2) the space between the 2 E-elements is 6 or 7 bp (Table 1).
Figure 4

The space between the 2 E-box-like sequences is critical for cell-autonomous circadian transcription. (A) Wild-type (sp6; gray letters) and mutant (sp4, 5, 7, 8; solid letters) sequences of the hPer2 EE-element and their flanking sequences are shown. Underlines indicate nucleotide(s) inserted into the space of the EE-element. The core sequence within the EE-element is shown in capital letters. (B) EE-element-driven luciferase bioluminescence detected by IV-ROMS. Black lines indicate bioluminescence of mutant hPer2 EE-elements; and gray lines, those of the wild type. The abscissa presents "day"; the ordinate shows "relative luciferase intensity". First peak values of the curves were set to 1.

Table 1

The criteria for the EE-element. Criteria for the EE-element are as follow: 1) 2 E-boxes, close to each other, are needed, 2) E1 E-box allows 1 base mismatch, E2 E-box allows 2 base mismatches, 3) the spacing between 2 E-boxes is 6 or 7 bp, and 4) the element is located within 1 kb upstream region from the TSS.

E-boxspaceE-box
C A C G T G6 or 7 bpC A C G T G
0~1 mismatch0~2 mismatch
The criteria for the EE-element. Criteria for the EE-element are as follow: 1) 2 E-boxes, close to each other, are needed, 2) E1 E-box allows 1 base mismatch, E2 E-box allows 2 base mismatches, 3) the spacing between 2 E-boxes is 6 or 7 bp, and 4) the element is located within 1 kb upstream region from the TSS. The space between the 2 E-box-like sequences is critical for cell-autonomous circadian transcription. (A) Wild-type (sp6; gray letters) and mutant (sp4, 5, 7, 8; solid letters) sequences of the hPer2 EE-element and their flanking sequences are shown. Underlines indicate nucleotide(s) inserted into the space of the EE-element. The core sequence within the EE-element is shown in capital letters. (B) EE-element-driven luciferase bioluminescence detected by IV-ROMS. Black lines indicate bioluminescence of mutant hPer2 EE-elements; and gray lines, those of the wild type. The abscissa presents "day"; the ordinate shows "relative luciferase intensity". First peak values of the curves were set to 1. Previous studies [28-30] in which clock or clock-controlled genes were extensively examined at the transcriptional level by DNA microarrays revealed that a total of 1551 genes exhibited circadian oscillation. So we examined how many genes contained the EE-element that met our criteria described above in their promoter regions within 1 kb upstream from the TSS. As a consequence of in silico analysis, 30 EE-elements in 29 genes were found among 1510 genes, which sequences are available from the VISTA database (Table 2). The genes that appeared in different papers and organs were clock and clock-controlled genes, such as Nr1d1 (also known as Rev-erbα), Dbp, Avp and Tef, besides Per2. This result strongly suggests that not a single E-box but a direct repeat of E-box-like elements is essential for the generation of cell-autonomous circadian oscillation. To confirm this, by using IV-ROMS we investigated whether the EE-element in Dbp was also required for its rhythmicity. The hDbp EE-element showed circadian oscillation as well as the hPer2 one (see Additional file 4). The mutants of E1 and/or E2 in the EE-element as well as the space mutants, sp4, sp5, and sp8 displayed no rhythmicity (see Additional file 4), which is consistent with the results of Per2 described above.
Table 2

The EE-elements in clock and clock-controlled genes. Clock and clock-controlled genes containing putative EE-elements (A; [28], B; [29], C; [30]). "Phase" means peak time. Phase 2, the peak value = CT 0.1~4.0; phase 6, CT 4.1~8.0; phase 10, CT 8.1~12; phase 14, CT 12.1~16; phase 18, CT 16.1~20; phase 22, CT 20.1~24. "pos" indicates the position of the EE-element from the TSS. Underlines indicate nucleotides matched to the canonical E-box.

PaperOrganPhaseGeneposmousehuman

sequencespsequencesp
ASCN10Per2-23CACGTTTTCCACTATGTG6CACGTTTTCCACTATGTG6
ALiver14-23
BLiver14-23
BHeart10-23
CSCN10-23
CLiver14-23
ASCN18Nr1d1-878CACGTGAAGCTCTCACGTT7CACGTGAAGCCCTCACGTT7
ALiver6-878
BLiver6-878
BHeart6-878
CLiver6-878
BLiver6Dbp-606CACGCGCAAAGCCATGTG6CACGAGCAGAGCCATGTG6
BHeart10-606
CSCN6-606
BLiver10Tef-529CACGTGCAGAGCCTCGTG6CACGTGCGGCGCCTCGTG6
BLiver10-208CACCTGGCCCAGCACGTG6CACCTGGCCCCGCACGTG6
BHeart10-529
BHeart10-208
ALiver10Foxo3a-97CACGCGCACTCCCACACG6CACGCGCACTCACACACG6
BLiver10-97
CLiver10-97
ALiver103732413I11Rik-307CACGTGGTCCCAGCAGGTG7CACGTGGTCCCTGCAGGTG7
CLiver10-307
ALiver18Tfdp1-916CACGTCACCGCGCCGCGCGCACGTCACCGCGCCGCGCG7
BLiver14-916
BLiver18Tfrc-127TACGTGCGGAAGGAAGTG6TACGTGCCTCAGGAAGTG6
BHeart2-127
BLiver22Sox3-200CAGGTGAGAGAAGCCCGCG7CAGGTGCGAGAAGCCCGCG7
BHeart18-200
BHeart2MGI:1351465-387CACGGGCCCCACCTTGTG6CACGGGCCCCACCTTGTG6
CSCN6Avp-186CACGTGTGTCCCCAGATG6CACGTGTGTCCCCAGATG6
ASCN14Serpine1-179CACGTGTCCCAGCAAGTC6CACATGCCTCAGCAAGTC6
BLiver6Wwp2-33CACGTGACCCGGCCCGAG6CACGTGACCCGGCCCGAG6
CSCN18Hnrpm-42CACGTGAGCGCGCAGGCG6CACGTGGGCGCGCAGGCG6
BHeart6Snx2-41CACGTGACAGGTCCGCGAG7CACGTGACGGGTCCGCGAG7
ASCN18Spag7-238CACGAGCACTTTCTACTTG7CACGGGCACTTTCTACTTG7
ASCN10Pabpn1-438CACCTGTCGCACAACGGG6CACCTGTCACGAAACGAG6
BHeart18Zic2-415CAGGTGGAGCGGCGGGTG6CAGGTGGAGCCGCTGGTG6
ASCN18Cacna2d3-37CAAGTGAGCCGGGCGCGCG7CAAGTGAGCCGGGCGCGCG7
ASCN10Cog8-705CACGTGCAAGCGGAACTTG7GACGTGCAACCGAAACTTG7
BHeart2Col4a2-641CACCTGGCCGTGCCACCCG7CACCTGGCCGTGCCACGCG7
CSCN14Ube2s-117AACGTGCGCGTTGACGTA6AACGTGCGCGCTGACGTC6
ASCN10Igsf4a-584GACGTGCAAAGCACGCATG7GACGTGCAAAGCACGCATG7
CSCN18Plekha1-31CGCGTGCGCAGTGCGCGGG7CGCGTGCGCAGTGCGCGGG7
BHeart2Qk-352CCCGTGGGTGCGCACGCG6CCCGTGGGTGCGCACGCG6
CSCN6Rexo2-27CCCGTGGGTTTGCGACGTT7CCCGTGGGTTTGCGACGTT7
BLiver10Trfp-683CGCGTGGCGCGCTCTCGCG7CGCGTGGTGCGTTCCCGCG7
CLiver18BC014685-186CCCGTGACATTGCCGCGGG7CCCGTGACGCGGGCGCGGG7
BHeart2Ptma-23CGCGTGAGTCCCCCACTGG7CGCGTGAGTCCCCCACTGG7
The EE-elements in clock and clock-controlled genes. Clock and clock-controlled genes containing putative EE-elements (A; [28], B; [29], C; [30]). "Phase" means peak time. Phase 2, the peak value = CT 0.1~4.0; phase 6, CT 4.1~8.0; phase 10, CT 8.1~12; phase 14, CT 12.1~16; phase 18, CT 16.1~20; phase 22, CT 20.1~24. "pos" indicates the position of the EE-element from the TSS. Underlines indicate nucleotides matched to the canonical E-box.

Discussion

Among the genes identified by in silico analysis (Table 2), arginine vasopressin (Avp) is a neuropeptide physiologically synthesized in the hypothalamus in a circadian manner but pathologically expressed by small-cell lung cancer. In the latter case, upstream stimulatory factor (USF), another bHLH transcription factor, activates the vasopressin promoter via the adjacent non-canonical E-boxes in tandem with a 6-nucleotides space between them and the second E-box is important for full enhancer function of the first E-box [31]. Furthermore, hypoxia-inducible factor 1 (HIF-1), a bHLH-PAS transcription factor, has recently been reported to regulate some hypoxia-inducible genes such as vascular endothelial growth factor (VEGF) through an HIF-1 binding site and its downstream HIF-1 ancillary sequence, both of which are non-canonical E-boxes [32]. The space between these motifs in this case is 8 nucleotides and is crucial for activity of promoter. Not only mammalian genes but also fly clock genes contain a direct repeat of E-box-like elements, as discovered in this study. The Drosophila timeless promoter includes an E-box-like sequence dubbed TER1 and is considered as an EE-element together with its 7-bp downstream canonical E-box. This TER1 plays a major role in tim transcription [33]. These reports in addition to this study demonstrate that not a single E-box but an EE-element is crucial for transcriptional activation by certain bHLH transcription factors. Our results suggest that 2 dimeric complexes of transcription factors bind to the 2 E-box-like elements with a short distance between them, such as 6 nucleotides. To support this possibility, we simulated this binding of bHLH transcription factors to the EE-element on the DNA by using the crystal structure of the bHLH domain of the Myc-Max heterodimer bound to DNA (PDB ID: 1NKP) [34]. Since 1 turn of double-helix DNA is approximately 34 Å and requires 10.4 nucleotides, the distance from the beginning of E1 to the end of space, which consists of 12 nucleotides, spans 39.2 Å (34/10.4 × 12, Fig. 5A). Two binding faces form a 55.8-degree angle (360/10.4 × 12–360, Fig. 5B). The maximum dimension of the bHLH structure, which lies along the DNA, is about 32 Å (Fig. 5C). This dimension is within the 39 Å calculated above and allows the binding. When the space is 5 nucleotides, for example, the distance between 2 complexes shortens approximately 3 Å horizontally compared with the case of 6 nucleotides; however, the angle between them becomes 20.6°. This precludes the possibility that the bHLH structure binds to the EE-element, because 2 whole structures including PAS domains may collide with each other. This simulation supports our contention that 6 nucleotides between 2 E-box-like elements, not 5 nucleotides, allow the binding of bHLH transcription factors to the EE-element on the DNA.
Figure 5

Structural model for the binding of bHLH transcription factors to DNA. (A) Since 1 turn of double helix DNA is approximately 34 Å and requires 10.4 nucleotides, 1 EE-element, which consists of 12 nucleotides, spans 39.2 Å (34/10.4 × 12). (B) Two binding faces form a 55.8-degree angle (360/10.4 × 12–360). (C) The maximum dimension of the bHLH structure, which lies along the DNA, is about 32 Å, which is within the 39 Å calculated above and allows the binding. Green indicates a hetero complex of transcription factors such as BMAL1 and CLOCK; and light blue, unknown factors.

As a candidate for unknown factors that bind to E2, another type of transcription factor can be a possible candidate as well as the bHLH family transcription factor including HIF1 [35] or the bZip family transcription factor E4BP4 (also known as NFIL3) [36]. Our preliminary EMSA suggests that some proteins may bind to E2 (see Additional file 5). Alternatively, different forms of the CLOCK and BMAL1 complex can be involved in this circadian transcription. The circadian transcriptional complex includes at least CLOCK, NPAS2, BMAL1, PERs and CRYs, probably in different combinations, and these proteins can be posttranslationally modified [37]. While E1 element is sufficient for binding of CLOCK and BMAL1, it is possible that binding to E2 can occur only after CLOCK and/or BMAL1 originally binds to E1. Thus E2 can be necessary for the binding of different forms of the complex or perhaps the binding to E2 is important for complex activation. Further studies, including identification of unknown factors or the circadian transcription complex and their crystal structures, will be required to elucidate the precise mechanism of transcriptional activation via an EE-element. Structural model for the binding of bHLH transcription factors to DNA. (A) Since 1 turn of double helix DNA is approximately 34 Å and requires 10.4 nucleotides, 1 EE-element, which consists of 12 nucleotides, spans 39.2 Å (34/10.4 × 12). (B) Two binding faces form a 55.8-degree angle (360/10.4 × 12–360). (C) The maximum dimension of the bHLH structure, which lies along the DNA, is about 32 Å, which is within the 39 Å calculated above and allows the binding. Green indicates a hetero complex of transcription factors such as BMAL1 and CLOCK; and light blue, unknown factors.

Conclusion

Here we identified a direct repeat of E-box-like elements consisting of a canonical E-box or non-canonical E-box in tandem with an E-box-like element, having a short interval of 6 base pairs between them. Although other regions outside the EE-element seem to be active in robust circadian oscillation with high amplitude [38], the EE-element identified in this study, not a single E-box, is the minimal required element for the generation of cell-autonomous transcriptional oscillation of clock and clock-controlled genes.

Methods

Cell culture

NIT3T3 cells were grown at 37°C and 5% CO2 in Dulbecco's modified Eagle's medium (1.0 g/L glucose) with L-Gln and sodium pyruvate (DMEM, Nacalai tesque, Kyoto, Japan) supplemented with 10% fetal bovine serum (FBS; ICN Biomedicals, Inc.) and antibiotics.

Antibody

Rabbit BMAL1 polyclonal antibody was raised against glutathione S-transferase (GST) fused to the amino terminus of BMAL1 (amino acids 1–99). The antiserum was purified through GST and GST-BMAL1 columns. Also, BMAL1 and E4BP4 antibodies were kindly donated by Drs. Teruya Tamaru [39] and Toshiya Inaba [40], respectively. CLOCK antibody (S-19; sc-6927) was purchased from Santa Cruz Biotechnology, Inc.

Construction of the EE-element::SV40 promoter-luciferase plasmid

The oligonucleotide sequences used in this study are indicated in Additional file 6. Each fragment of the double-stranded oligonucleotides of the hPer genes was cloned into a modified pGL3 (R2.2) promoter vector digested with SacI-NheI. To construct the modified pGL3 (R2.2) promoter vector plasmid, we excised the SV40 promoter fragment from the pGL3 promoter vector (Promega) by digestion with BglII-NcoI and ligated it into the compatible site of pGL3 (R2.2) basic vector (Promega). To rule out the possibility that 2 E-box-like elements in multiple cloning sites of this vector possessed a binding potential for CLOCK/BMAL1, these sequences were removed.

IV-ROMS (in vitro real-time oscillation monitoring system)

NIH3T3 cells at 1.0 × 105 plated in Opti-MEM (GIBCO) supplemented with 10% FBS in 35-mm dishes were transfected with the desired plasmids by using LipofectAMINE and plus reagent (Invitrogen). Twenty-four hours after transfection, the medium was exchanged for serum-rich medium (DMEM supplemented with 50% newborn calf serum [NBS; JRH]), and 2 h later this medium was replaced with Opti-MEM supplemented with 1% FBS and 0.1 mM luciferin/10 mM HEPES (pH 7.2). Bioluminescence was measured by using IV-ROMS as described previously [25].

Oligonucleotide pull-down experiment

The oligonucleotide pull-down experiment was performed as described previously [21,26]. Mouse liver lysate was prepared at 4-h intervals by homogenizing liver in ice-cold PBS with 2 mM EDTA and 10 μg/ml aprotinin/leupeptin/pepstatin, and 1 mM PMSF as proteinase inhibitors (PIs). The pellet was sequentially incubated in hypotonic buffer (50 mM Tris-HCl pH 7.4, 2 mM MgCl2, 1 mM EDTA, 1 mM DTT, and PIs) and incubation buffer (50 mM Tris-HCl pH 7.4, 50 mM NaCl, 2 mM EDTA, 10% glycerol, 1% NP40, 1 mM DTT, 100 mM NaF, 2 mM Na3VO4, 10 mM Na4P2O7, and PIs). After centrifugation, the supernatant was transferred to a new tube and the remaining pellet was sonicated; and following centrifugation its supernatant combined with the original supernatant as the nuclear extract. The nuclear extracts were incubated with a biotinylated oligonucleotide (see Additional file 6) that had been immobilized on streptavidin-Sepharose beads (Amersham) for 1 h at 4°C. After having been washed with incubation buffer, the resultant complex was subjected to immunoblot analysis. The surgical and experimental procedures performed on mice were approved by the OBI Animal Research Committee.

In silico analysis of the EE-element

The gene list for this analysis was derived from the reports of microarray analyses [28-30]. The genes were classified by the phase of the expression peak and organ in which each gene was expressed (phase 2, the peak time = CT 0.1~4.0; phase 6, CT 4.1~8.0; phase 10, CT 8.1~12; phase 14, CT 12.1~16; phase 18, CT 16.1~20; phase 22, CT 20.1~24). The aligned sequences spanning from 1 kb upstream of the transcription start site (TSS) to the 3' untranslated region in each of human and mouse genes were obtained from the VISTA genome browser (VISTA Browser, VGB2, [41], version: Human, May 2004; Mouse, Aug. 2006), which has pre-computed alignments of whole genome assemblies. Fuzznuc (EMBOSS, [42]), a tool for nucleic acid pattern searching, was used for the first screening; each aligned sequence from VISTA was searched with the following sequence: E-box (CACGTG, 0~1 base mismatch) + 6 or 7 arbitrary bases + E-box (CACGTG, 0~2 base mismatches). The conserved EE-elements between human and mouse were listed. Subsequently, the EE-elements within 1 kb upstream region from TSS were listed in Table 2.

Authors' contributions

YN and MY carried out experiments and drafted the manuscript. AT discussed the results. MY, HS, and TY carried out the in silico study. AY participated in the coordination and provided financial support. TN carried out the structural design. TT participated in the experimental design and coordination and wrote the paper. All authors read and approved the final manuscript.

Additional file 1

Effect of the E2 mutant in . Wild-type (gray letters) and mutant (black letters) sequences of hPer3 EE-element and their flanking sequences are shown in upper panel. The core sequence within the EE-element is shown in capital letters. Bioluminescence monitoring of the hPer3 EE-element-Luc construct was performed by using IV-ROMS (black; mutant, gray; wild-type). The abscissa presents "day"; and the ordinate shows "relative luciferase intensity". First peak values of the curves were set to 1. Click here for file

Additional file 2

Effect of the EE-element mutant in . Bioluminescence monitoring of the Per2 promoter-Luc construct was performed by IV-ROMS (black; mutant, gray; wild-type). The abscissa presents "day"; and the ordinate indicates "relative luciferase intensity". First peak values of the curves were set to 1. Click here for file

Additional file 3

Characterization of BMAL1 antibody. (A) Western blotting. Two bands at around 70–80 kDa that correspond to BMAL1 were observed in mouse liver lysates at 4-hr intervals. CT, circadian time; arrows, BMAL1. (B) Immunoprecipitated and blotted with BMAL1 antibody. WT, liver lysate from wild-type mouse; KO, liver lysate from BMAL1-deficeient mouse. CIP, calf intestine alkaline phosphatase; arrows, BMAL1; *, a phosphorylated band. Click here for file

Additional file 4

The EE-element of . (A) Wild-type and mutant sequence of hDbp E1 and E2 and their flanking region are shown. The core sequence within the EE-element is shown in capital letters. (B) EE-element-driven luciferase bioluminescence by IV-ROMS. Gray lines indicate bioluminescence of wild type hDbp EE-element; and black lines show those of mutants. The abscissa presents "day"; and the ordinate shows "relative luciferase intensity". First peak values of the curves were set to 1. (C) Wild-type (sp6; gray letters) and mutant (sp4, 5, 7, 8; solid letters) sequences of hDBP EE-element and their flanking sequences are shown. Underlines indicate inserted nucleotides into space of the EE-element. The core sequence within the EE-element is shown in capital letters. (D) EE-element-driven luciferase bioluminescence by IV-ROMS. Black lines indicate bioluminescence of the mutant hDbp EE-elements; and the gray lines show those of wild type. The abscissa presents "day"; and the ordinate shows "relative luciferase intensity". First peak values of the curves were set to 1. Click here for file

Additional file 5

Some protein may bind to E2. Electrophoretic mobility shift assay (EMSA) shows that some protein from cellular lysates binds to E2 (left). The bands from liver lysates in E1m were attenuated with excess of E1m, but not in E2m (right). Click here for file

Additional file 6

The information of constructs and genes used in this study. Upper panel shows the construct sequences used in this study. Middle panel demonstrates the oligonucleotides used in Figure 2C. Bottom panel shows the accession numbers of Pers and Dbp used. Click here for file
  40 in total

1.  Coordinated transcription of key pathways in the mouse by the circadian clock.

Authors:  Satchidananda Panda; Marina P Antoch; Brooke H Miller; Andrew I Su; Andrew B Schook; Marty Straume; Peter G Schultz; Steve A Kay; Joseph S Takahashi; John B Hogenesch
Journal:  Cell       Date:  2002-05-03       Impact factor: 41.582

2.  Extensive and divergent circadian gene expression in liver and heart.

Authors:  Kai-Florian Storch; Ovidiu Lipan; Igor Leykin; N Viswanathan; Fred C Davis; Wing H Wong; Charles J Weitz
Journal:  Nature       Date:  2002-04-21       Impact factor: 49.962

3.  Wild-type circadian rhythmicity is dependent on closely spaced E boxes in the Drosophila timeless promoter.

Authors:  M J McDonald; M Rosbash; P Emery
Journal:  Mol Cell Biol       Date:  2001-02       Impact factor: 4.272

4.  The human and mouse Period1 genes: five well-conserved E-boxes additively contribute to the enhancement of mPer1 transcription.

Authors:  A Hida; N Koike; M Hirose; M Hattori; Y Sakaki; H Tei
Journal:  Genomics       Date:  2000-05-01       Impact factor: 5.736

5.  E-box motifs within the human vasopressin gene promoter contribute to a major enhancer in small-cell lung cancer.

Authors:  J M Coulson; C E Fiskerstrand; P J Woll; J P Quinn
Journal:  Biochem J       Date:  1999-12-15       Impact factor: 3.857

6.  Identification of hypoxia-inducible factor 1 ancillary sequence and its function in vascular endothelial growth factor gene induction by hypoxia and nitric oxide.

Authors:  H Kimura; A Weisz; T Ogura; Y Hitomi; Y Kurashima; K Hashimoto; F D'Acquisto; M Makuuchi; H Esumi
Journal:  J Biol Chem       Date:  2000-10-30       Impact factor: 5.157

7.  Two distinct interleukin-3-mediated signal pathways, Ras-NFIL3 (E4BP4) and Bcl-xL, regulate the survival of murine pro-B lymphocytes.

Authors:  R Kuribara; T Kinoshita; A Miyajima; T Shinjyo; T Yoshihara; T Inukai; K Ozawa; A T Look; T Inaba
Journal:  Mol Cell Biol       Date:  1999-04       Impact factor: 4.272

8.  mCRY1 and mCRY2 are essential components of the negative limb of the circadian clock feedback loop.

Authors:  K Kume; M J Zylka; S Sriram; L P Shearman; D R Weaver; X Jin; E S Maywood; M H Hastings; S M Reppert
Journal:  Cell       Date:  1999-07-23       Impact factor: 41.582

9.  The mPer2 gene encodes a functional component of the mammalian circadian clock.

Authors:  B Zheng; D W Larkin; U Albrecht; Z S Sun; M Sage; G Eichele; C C Lee; A Bradley
Journal:  Nature       Date:  1999-07-08       Impact factor: 49.962

10.  Posttranslational mechanisms regulate the mammalian circadian clock.

Authors:  C Lee; J P Etchegaray; F R Cagampang; A S Loudon; S M Reppert
Journal:  Cell       Date:  2001-12-28       Impact factor: 41.582

View more
  33 in total

Review 1.  Genomics and systems approaches in the mammalian circadian clock.

Authors:  Julie E Baggs; John B Hogenesch
Journal:  Curr Opin Genet Dev       Date:  2010-12       Impact factor: 5.578

2.  Genome-wide profiling of the core clock protein BMAL1 targets reveals a strict relationship with metabolism.

Authors:  Fumiyuki Hatanaka; Chiaki Matsubara; Jihwan Myung; Takashi Yoritaka; Naoko Kamimura; Shuichi Tsutsumi; Akinori Kanai; Yutaka Suzuki; Paolo Sassone-Corsi; Hiroyuki Aburatani; Sumio Sugano; Toru Takumi
Journal:  Mol Cell Biol       Date:  2010-10-11       Impact factor: 4.272

3.  FAD Regulates CRYPTOCHROME Protein Stability and Circadian Clock in Mice.

Authors:  Arisa Hirano; Daniel Braas; Ying-Hui Fu; Louis J Ptáček
Journal:  Cell Rep       Date:  2017-04-11       Impact factor: 9.423

4.  Circadian rhythms identified in Caenorhabditis elegans by in vivo long-term monitoring of a bioluminescent reporter.

Authors:  María Eugenia Goya; Andrés Romanowski; Carlos S Caldart; Claire Y Bénard; Diego A Golombek
Journal:  Proc Natl Acad Sci U S A       Date:  2016-11-14       Impact factor: 11.205

Review 5.  Circadian clocks regulate cardiac arrhythmia susceptibility, repolarization, and ion channels.

Authors:  Brian P Delisle; John L Stumpf; Jennifer L Wayland; Sidney R Johnson; Makoto Ono; Dalton Hall; Don E Burgess; Elizabeth A Schroder
Journal:  Curr Opin Pharmacol       Date:  2020-11-09       Impact factor: 5.547

6.  Multiple circadian transcriptional elements cooperatively regulate cell-autonomous transcriptional oscillation of Period3, a mammalian clock gene.

Authors:  Ritsuko Matsumura; Makoto Akashi
Journal:  J Biol Chem       Date:  2017-08-15       Impact factor: 5.157

7.  Intermolecular recognition revealed by the complex structure of human CLOCK-BMAL1 basic helix-loop-helix domains with E-box DNA.

Authors:  Zixi Wang; Yaling Wu; Lanfen Li; Xiao-Dong Su
Journal:  Cell Res       Date:  2012-12-11       Impact factor: 25.617

8.  Analysis and synthesis of high-amplitude Cis-elements in the mammalian circadian clock.

Authors:  Yuichi Kumaki; Maki Ukai-Tadenuma; Ken-ichiro D Uno; Junko Nishio; Koh-hei Masumoto; Mamoru Nagano; Takashi Komori; Yasufumi Shigeyoshi; John B Hogenesch; Hiroki R Ueda
Journal:  Proc Natl Acad Sci U S A       Date:  2008-09-24       Impact factor: 11.205

9.  Retinoic acid receptors move in time with the clock in the hippocampus. Effect of a vitamin-A-deficient diet.

Authors:  Lorena S Navigatore-Fonzo; Rebeca L Golini; Ivana T Ponce; Silvia M Delgado; Maria G Plateo-Pignatari; María S Gimenez; Ana C Anzulovich
Journal:  J Nutr Biochem       Date:  2012-08-16       Impact factor: 6.048

10.  CLOCK-BMAL1 regulates circadian oscillation of ventricular arrhythmias in failing hearts through β1 adrenergic receptor.

Authors:  Zihao Zhou; Jiamin Yuan; Didi Zhu; Yanhong Chen; Zhiyong Qian; Yao Wang; Peibin Ge; Quanpeng Wang; Xiaofeng Hou; Jiangang Zou
Journal:  Am J Transl Res       Date:  2020-10-15       Impact factor: 4.060

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.