| Literature DB >> 17109760 |
Wei Liu1, Yonghui Zhao, Zhaoliang Liu, Ying Zhang, Zhengxing Lian, Ning Li.
Abstract
BACKGROUND: The giant panda, one of the most primitive carnivores, is an endangered animal. Although it has been the subject of many interesting studies during recent years, little is known about its genome. In order to promote research on this genome, a bacterial artificial chromosome (BAC) library of the giant panda was constructed in this study.Entities:
Mesh:
Year: 2006 PMID: 17109760 PMCID: PMC1664575 DOI: 10.1186/1471-2164-7-294
Source DB: PubMed Journal: BMC Genomics ISSN: 1471-2164 Impact factor: 3.969
Figure 1Characterization of the giant panda BAC library. A. Analysis of the size of BAC clones by PFG electrophoresis. M: Mid range Marker II for PFGE (Bio-labs, New England). Lanes 1–19: NotI digested DNA of randomly picked recombinant BAC clones. PFGE conditions were set with Bio-rad CHEF III: 6.0 v/cm for 12 h, linear pulse time ramping from 0.1 to 40 s. B. BAC insert size distribution in the library. Insert sizes were determined from 261 BAC clones. The horizontal axis shows the size range in kb while the vertical axis displays the number of clones corresponding to each size range. Insert sizes are reported in a cumulative histogram.
Summary of screening results of the giant panda BAC library by PCR with primers for microsatellites
| Microsatellite Sequence Name | Primer (5'-3') | Ta (°C) | Product length (bp) | Positive superpool number |
| A204 | F- CCTGCCCTATGGATTTCAGA | 63 | 321 | 10 |
| A066 | F- GATTATCCGTTGGCTTTGGA | 60 | 337 | 3 |
| B043 | F- GACCCTGTGGCTCTGTGACT | 60 | 310 | 6 |
| GPMC-1 | F- AGAGAGAGAGCGAGCACGAG | 63 | 207 | 1 |
| GPMC-21 | F- GAATGGTATGCCTGGGTGAC | 63 | 150 | 6 |
| GPMC-40 | F- TCCCTCAGCACCTTAACACC | 58 | 214 | 4 |
| GPMC-52 | F- CCGTCTCCAAGGTAACCTGA | 60 | 190 | 3 |
| GPMC-104 | F- TCTCCATCAGGTTACCACTGC | 60 | 261 | 4 |
Summary of screening results of the giant panda BAC library by PCR with primers for functional genes
| Gene | Genebank accession No. | Primers (5'-3') | Ta (°C) | PCR product size (bp) | Positive clone number |
| F- GGACATTGGCTGGAATGACT | 54 | 207 | 4 | ||
| F- CTGTTTTTCATTGACTGGACTCTG | 58 | 539 | 4 | ||
| F- CCTCTGGGGGAAAAAAAGTT | 56 | 412 | 8 | ||
| F- TGTTGCTGGAGAGCAATCTG | 54 | 197 | 7 | ||
| F- GCCAAAGGATTTGACACGAT | 56 | 202 | 6 | ||
| F- GCCCAGAATGCAAGCTAAAG | 54 | 190 | 5 | ||
| F- AACCCCAAGATGCACAACTC | 54 | 108 | 6 | ||
| F- CCAGGAAGTGGTGAGCAAGC | 66 | 419 | 4 | ||
| F- TCTGCAGAGCTCACTGAACC | 54 | 205 | 4 | ||
| F- TCTGGAGAGCGTGAATGGG | 62 | 394 | 3 | ||
| F- TGAAAAGGTCACCCGAGAAG | 54 | 219 | 5 | ||
| F- AGCGAGACAGCACCAGCAA | 64 | 263 | 5 | ||
| F- GCTGTGGCTGCTGCTGAAC | 58 | 313 | 2 | ||
| F- TCGGTTCACACGAAGGACTAC | 59 | 284 | 4 | ||
| F- GGTGCAGCAACATGCTCTTA | 54 | 188 | 4 |
Figure 2Physical locations of ten genes on G-banded ideogram of giant panda. The G-banded ideogram was drawn with software Video TesT-karyotype3.1 (Video TesT Ltd, Russia, 2003). The names of the bands have not been listed because no international standard karyotype has yet been established for the giant panda.
Chromosomal locations of ten genes in giant panda and of the homologous genes in human
| Gene | Location in giant panda chromosome (AME) | Location in human chromosome (HSA) | Expected location in giant panda chromosome (AME)* | Clone Address** |
| 2q | 2q37.3 | 2 | 221E23 | |
| 3p | 5p12 | 3 | 323D6 | |
| 4q | 2p16.3 | 4 | 331F20 | |
| 6p | 3q22.3 | 6 | 168E8 | |
| 6q | 10q11.22 | 6 | 243M3 | |
| 14q | 18q12.1 | 14 | 29N4 | |
| 15q | 11p14.1 | 16 | 212F3 | |
| 16q | 19q13.33 | 12 | 229L4 | |
| 16q | 19q13.33 | 12 | 64A12 | |
| X | Xp22.11 | X | 403N3 |
* The expected chromosome locations of the ten genes in the giant panda according to human-giant panda comparison.
** BAC clone address for FISH mapping.
Figure 3Representative scheme of chromosome locations of . a, c, e, g show G-banded metaphase chromosomes spread before FISH; b, d, f, h show the same chromosomes spread after FISH. Arrow shows the specific signals.