Literature DB >> 18366732

Construction of a BAC library and mapping BAC clones to the linkage map of Barramundi, Lates calcarifer.

Chun Ming Wang1, Loong Chueng Lo, Felicia Feng, Ping Gong, Jian Li, Ze Yuan Zhu, Grace Lin, Gen Hua Yue.   

Abstract

BACKGROUND: Barramundi (Lates calcarifer) is an important farmed marine food fish species. Its first generation linkage map has been applied to map QTL for growth traits. To identify genes located in QTL responsible for specific traits, genomic large insert libraries are of crucial importance. We reported herein a bacterial artificial chromosome (BAC) library and the mapping of BAC clones to the linkage map.
RESULTS: This BAC library consisted of 49,152 clones with an average insert size of 98 kb, representing 6.9-fold haploid genome coverage. Screening the library with 24 microsatellites and 15 ESTs/genes demonstrated that the library had good genome coverage. In addition, 62 novel microsatellites each isolated from 62 BAC clones were mapped onto the first generation linkage map. A total of 86 BAC clones were anchored on the linkage map with at least one BAC clone on each linkage group.
CONCLUSION: We have constructed the first BAC library for L. calcarifer and mapped 86 BAC clones to the first generation linkage map. This BAC library and the improved linkage map with 302 DNA markers not only supply an indispensable tool to the integration of physical and linkage maps, the fine mapping of QTL and map based cloning genes located in QTL of commercial importance, but also contribute to comparative genomic studies and eventually whole genome sequencing.

Entities:  

Mesh:

Year:  2008        PMID: 18366732      PMCID: PMC2329641          DOI: 10.1186/1471-2164-9-139

Source DB:  PubMed          Journal:  BMC Genomics        ISSN: 1471-2164            Impact factor:   3.969


Background

Barramundi (Lates calcarifer), also called Asian seabass or the giant sea perch, belonging to the family Latidae is widely distributed in the coast and freshwater of the tropical Indo-west Pacific, from the Persian Gulf to India and Northern Australia [1,2]. Because of good meat quality and relatively high market value of L. calcarifer, it has become an attractive commodity of both large and small-scale aquaculture enterprises. It is commercially cultivated in Thailand, Malaysia, Singapore, Indonesia, Hong Kong, China and Australia in both brackishwater and freshwater ponds, as well as in cages in coastal waters. The global annual production of L. calcarifer was 400,000 MT according to FAO statistics. However, detailed breeding programs for genetic improvement of Asian seabass are still quite rare [3]. Identification of genomic regions and genes responsible for economically important traits could facilitate genetic improvement through marker-assisted selection [4], which is of importance for future aquaculture of L. calcarifer. Linkage and physical maps are indispensable tools needed to identify genomic regions responsible for traits of interest. The genome of L. calcarifer is very compact (only 700 Mb) consisting of 24 chromosome pairs [5]. The first linkage map for L. calcarifer containing 240 microsatellite markers and genes on 24 linkage groups [6] was applied to mapping QTL for growth traits [7]. Libraries with large genomic DNA inserts are essential for physical mapping and positional cloning, particularly for higher eukaryotes [8]. The BAC (bacterial artificial chromosome) cloning system has become an invaluable tool in genomics studies because of its ability to stably maintain large DNA fragments and its ease of manipulation [9]. Genomic inserts in BAC clones have been shown to be very stable in E. coli and thus serve as ideal templates in generating whole-genome physical maps by DNA fingerprinting, developing sequence-tagged connectors and shotgun sequencing [10-12]. These features make the BAC cloning system a popular choice for high-throughput genomics studies [13]. BAC libraries have been developed for many economically important animal species such as cattle [14], pig [15], and sheep [16] and the highly endangered giant panda [17]. Only currently, BAC libraries were produced for some commercially important fish species such as salmon [18], catfish [12], rainbow trout, carp and tilapia [19]. Here, we describe the construction and characterization of a BAC library covering 6.9 times L. calcarifer haploid genome and mapping of 86 BAC clones to the linkage map. The BAC library and the improved linkage map of L. calcarifer will facilitate the integration of physical and linkage maps, fine mapping of QTL and identification of genes located in QTL of interest, maker-assisted selection and genome research.

Results

Library construction

A BAC library of L. calcarifer was constructed using the HindIII cloning site in commercially prepared pCC1BAC vector (Epicentre, MD, USA). The BAC library consisted of a total of 49,152 clones, which were manually arrayed into 128 384-well plates.

Insert size distribution

To examine the quality of the BAC library, the sizes of 212 BAC clones randomly picked from the library were determined. All the 212 clones contained inserts. The insert size distribution of these 212 clones is shown in Figure 1 and 2. The average insert size was 98 kb, ranging from 45 to 200 kb. The insert size of over 80% of the BAC clones in this library was larger than 80 kb, and the insert size of 50% clones was smaller than 100 kb. This BAC library provides 6.9 time haploid genome equivalent based on a genome size of 700 Mb [6].
Figure 1

DNA analysis of 31 random BAC clones from the . DNA samples digested with NotI were separated on 1% agarose gel in 0.5 × TBE buffer for 16 h under the following conditions: ramp pulse time of 5–15 s at 6 V/cm, temperature at 14°C. Markers used are Lambda Ladder PFG Marker (outside lanes) and MidRange II PFG Marker (NEB, SG, Singapore). The 8 kb common band is the pCC1BAC Vector (Epicentre, WI, USA).

Figure 2

Insert size distribution of 212 . DNA samples of the 212 clones randomly picked from the L. calcarifer HindIII BAC library were analyzed and grouped. Results indicate that the average insert size is 98 kb with over 80% of the clones > 80 kb.

DNA analysis of 31 random BAC clones from the . DNA samples digested with NotI were separated on 1% agarose gel in 0.5 × TBE buffer for 16 h under the following conditions: ramp pulse time of 5–15 s at 6 V/cm, temperature at 14°C. Markers used are Lambda Ladder PFG Marker (outside lanes) and MidRange II PFG Marker (NEB, SG, Singapore). The 8 kb common band is the pCC1BAC Vector (Epicentre, WI, USA). Insert size distribution of 212 . DNA samples of the 212 clones randomly picked from the L. calcarifer HindIII BAC library were analyzed and grouped. Results indicate that the average insert size is 98 kb with over 80% of the clones > 80 kb.

BAC library screening

To further assess the quality of this BAC library, 24 microsatellite markers randomly selected from each of the 24 linkage groups were used for hierarchical screening. PCR-screenings with the 24 microsatellite markers resulted in the number of positive clones varying from 3 to 15 with an average of 6.6 (Table 1) (see example of the PCR screening in Figure 3). PCR screening with these 15 ESTs/genes (PVALB-1, 5-HT, PROL-A, 14KDA-AP, AMY-A, MX, AP, LECT2, LYSO-G, IGF-1, TUB1A, TUB2B, GT7, CYP19A2 and AFPII) revealed that the number of positive BAC clones varied from 3 to 14 with an average of 7.3 (Table 2). The actual average number of positive BAC clones detected by screening with microsatellites and ESTs/genes was near to theoretically calculated number of genome coverage (i.e. 6.9 time coverage of the haploid genome). At least 3 positive BAC clones for each of the ESTs/genes were identified from the library.
Table 1

Screening of the BAC library with 24 microsatellites located on each of the 24 linkage groups of L. calcarifer

Linkage groupLocusGenBank accession noForward primer (5'-3')Reverse primer (5'-3')PCR Ta (°C)Positive clone number
LG1Lca318DQ290175TCCCACCCCAGTCCAGAAATACCAGAGCCTGAAACACAGTAGG556
LG2Lca064AY998856AGGCATATGCACCTCACAAGAGTGCCCACGGTTTATTTATCTGTCATTATC5515
LG3Lca137DQ290039CGCCTTAAATCTCTACGCTCTGGTCGCATGCTGTAATTAAGGTGGTA555
LG4Lca171DQ290065ATTGCGTTACCAAGAGGTGAATGTCTTTGAAGGCTGAAAACTG558
LG5Lca098AY998880CAAAGGGGCCACTGCACATAATCTCCAGCTCACCCAGGTTCACT555
LG6Lca062AY998854AGGATGGCACGCTGAAACTATCGATAAGCTTGTACAGGGGCTGAGTGC553
LG7Lca130DQ290035GAGGCTCCCAATCCCAACAAGGAGGCAGACGAGGAAGGAA5513
LG8Lca086AY998873AAATGGCCTTCCTGTCCCTTCAGGTGTTCCCTTGTTCTGCCACAGTG554
LG9Lca301DQ290166GCCAGTGTGAGGGACAGAGAGGGCCTTGTTTTGCTTTTG559
LG10Lca002AF007943GCCGCTTGTTTACCAGTAAATCCATTTGAGGATTAACAGC555
LG11Lca058AY998850AAACAGGCAGCCAGATAGACAGAGAAGAGGTGGTGGGACTAATTTGAGA5513
LG12Lca074AY998863CATCATTTACACTCTGTTTGCCTCATGACAGACAGGTGTTTTAGCCTATTTG556
LG13Lca253DQ290129TGGGGACTTGACTTCCTTTTATGTACCGAGGTTGGATGGTTTTCT553
LG14Lca147DQ290047TGCCCCTAATGTATTCTTTCCACTGCTCCCACCTCTCATTCATTATTC555
LG15Lca069AY998859GCCTTTCTGTTTTCTGATTTATCTTCATAACACCCCGAAATACTGCTACTACAG554
LG16Lca367DQ290206TGTATTACAATGCCCGTGGTCATTAAGCCTTTGGTGTCTCAGTGTG5510
LG17Lca021AF404083GTGCCACCTGCCTGACCGCCATGACTGATTGCTGAGA554
LG18Lca193DQ290082CCTCTGCCTTTTCATCTATATTGCCACATCGCACAAATGGACTGA559
LG19Lca220DQ290104ATGGCTGTGAAAAGACTGGTATCTCGCCCCTCACTCAACAGAG555
LG20Lca181DQ290073CACTGGGTGGCGTTTGTATTAGCCAAGAATTGGGATTTTGCTGTGC558
LG21Lca255DQ290131AGAGACACTTTATACGGGGACATCGTAAACTGAAGCAAGCCAAACCT557
LG22Lca040AF404099TGAGGAAGCATCAGCTGTAATCACAGGACGCAAACACTGAAAT553
LG23Lca411DQ290221GTGGTGCAGCGGTTGCTCTCCCGACTCATGCTGCTTTTCGTAAT555
LG24Lca231DQ290112GGCCAGGTTAATCAAGACACTAGACTGCAATCAAACACA553

Ta: annealing temperature for PCR.

Figure 3

Hierarchical PCR screening of the superpools and pools of the BAC library of . A First round PCR screening in 11 superpools representing the entire library or 128 384-well microtiter plates. Lanes 1–11: superpools 1–11 and lane 12: genomic DNA as positive control. Each superpool contains DNA of 12 plates or 4,608 individual BAC clones. In five superpools (3, 4, 8, 9 and 10), PCR product was amplified by the marker Lca064. B Second round PCR screening in 48 pools from the superpool number 3. Three pools (6, 35 and 41) showed a signal amplified by the marker Lca064. C Third round PCR screening in a 96-well plate from the pool number 6. Three positive clones (26, 29 and 86) were detected in the plate by the marker Lca064.

Table 2

Screening of the BAC library with 15 genes/ESTs of L. calcarifer

LocusGenBank accession noPrimer (5'-3', forward)Primer (5'-3', reverse)PCR Ta (°C)PCR product length (bp)Positive clone number
PVALB-1AY688372ATCGTCCGTCCGTTTCCCATAAAATGACCTTTCACCTCCCTCCAGACC552615
5-HTEU136181CTGCTCGGCGCGCTCATTCCATCCTGCACCTGTGCG602008
PROL-AEU136180GTGCAGAGCCGTCSCCATCATTCAGGAAGCTGTCRATCTTGTG555005
14KDA-APEU136179CCGGGGACAGACAACTCGCTTTCAGAGAACAGGTTGGTGAGCTCCAGTTGGTGTTC555004
AMY-AAY007592GGTCGCTTTCCGTAATGTGGTCAAACCGGGCATGCCAGTGTTCA552509
MXAy821518TCATTGATAAAGTGACAGCATTCACCAATATCCTTGAGTTTCTTGACA554007
APAJ888375GACGCCCTCCTCTCCTCTCATTTCGACAGCCATCTCTGAACATA557004
LECT2EU136177TTTTTGATCTGAAGATGAGACGTGTCATCGATCAGATCCCGAGCAGGTCAATC5510003
LYSO-GEU136178AGAGTCCAGGGCTGGAAATCCCTCAGAAACTTTAGTTGTGAAC556009
IGF-1EU136176CAGTGGCATTTATGTGATGTCCCTCGACTTGAGTTTTTCTG555033
TUB1AEU136175GGCACTACACAATCGGCAAAGAGATCAGCAGGGAGGTAAAGCCAGAGC5514411
TUB2BEU136174GTACAGACGGGGGAAGGGGACCATTTCCGCACCCTCAAACTCACCACA5516013
GT7EU136172CAGGGTGATCACGCAGTGCGGCAATCCGACAGCCAGAG551566
CYP19A2AY684259GCTCACCGCCTATAGCCAAAGAAGGCCGAGTCCTGCCAAGAAA555058
AFPIIEU136173TCCCTCCTGTGAAATTGGTTGGAGGGACGCTGGCACAGACTG57150014

Ta: annealing temperature for PCR.

Screening of the BAC library with 24 microsatellites located on each of the 24 linkage groups of L. calcarifer Ta: annealing temperature for PCR. Screening of the BAC library with 15 genes/ESTs of L. calcarifer Ta: annealing temperature for PCR. Hierarchical PCR screening of the superpools and pools of the BAC library of . A First round PCR screening in 11 superpools representing the entire library or 128 384-well microtiter plates. Lanes 1–11: superpools 1–11 and lane 12: genomic DNA as positive control. Each superpool contains DNA of 12 plates or 4,608 individual BAC clones. In five superpools (3, 4, 8, 9 and 10), PCR product was amplified by the marker Lca064. B Second round PCR screening in 48 pools from the superpool number 3. Three pools (6, 35 and 41) showed a signal amplified by the marker Lca064. C Third round PCR screening in a 96-well plate from the pool number 6. Three positive clones (26, 29 and 86) were detected in the plate by the marker Lca064.

Microsatellite isolation from BAC clones and linkage mapping

In order to map BAC clones to the linkage map for future integrating linkage and physical maps, we isolated microsatellites from 300 BAC clones through enrichment of microsatellites. 864 clones collected from the microsatellite-enriched library were sequenced in both directions. 451 clones contained microsatellites (CA > 7 or GA > 7), yielding 229 unique sequences containing microsatellites. Among the 229 sequences, 218 had enough flanking regions for primer design. Primers were designed for 218 microsatellites, among which 63 within 63 BAC clones were informative in the mapping panel used for linkage mapping. 62 were mapped to 24 LG (Figure 4, 5, 6 and 7) while one marker LcaB044 remained unlinked, making the total number of mapped markers on the L. calcarifer linkage map to be 302. At least one BAC based marker was mapped on each LG. Thus, together with 24 microsatellites located in different BAC clones and used for screening the BAC library, a total of 86 BAC based markers have been anchored on the linkage map with at least one on each LG. The male maps of LG14 and LG18, which were split to two LG on the first generation map respectively [6] due to the limited number of markers, were merged to one LG respectively by integrating new microsatellites located in single BAC clones (Figure 6). Details about primer sequences, GenBank accession number, annealing temperature for PCR, PCR product size and locations of the 63 markers located in different BAC clones are summarized in Table 3.
Figure 4

A microsatellite linkage map of . F: linkage map for female. M: linkage map for male. Markers underlined represent microsatellites selected from each LG for screening the BAC library. Markers in italic (initiated with LcaB) represent microsatellites isolated from BAC clones and newly mapped to the map.

Figure 5

A microsatellite linkage map of . See detailed explanation in Figure 4

Figure 6

A microsatellite linkage map of . See detailed explanation in Figure 4

Figure 7

A microsatellite linkage map of . See detailed explanation in Figure 4

Table 3

Microsatellites isolated from BAC clones and mapped on the linkage map of L. calcarifer

Orginal orderLinkage groupLocusGenBank accession noMotifForward primer (5'-3')Reverse primer (5'-3')PCR Ta (°C)Product Length (bp)Location in the library (384plate-96plate-well)*
1LG1LcaB003EU072356(GT)14CCTCATACTTGCATCAACATAATAATCAAAACCGGCTTCATCT55113128-P2-A3
2LG1LcaB030EU072367(CA)27TTCTCCCCGTGCCCCTTTGTAAGCCCACTCCCCTGAGATGAGC55158128-P2-B8
3LG2LcaB128EU072400(GT)16AGTCGGCCTGTGCAATAAGATCAGCAGTTTGGGAATAATGACATA55262128-P1-E4
4LG3LcaB002EU072355(GT)10TTGGCTGTATTCCTCCTGTCTTGTTTGGCTCTTTACGCTCAATACTCA55182128-P2-A4
5LG4LcaB012EU072359(CA)9GTGGGGTGTCCTGGCTCCTCTCCCATCTCCTCCTGCTGTTTCT55329128-P2-B11
6LG4LcaB014EU072361(GT)16GCAGACCCGCTTTTTATTCATGTCCCCTCTGCTCCAGTGTT55181128-P2-C12
7LG4LcaB052EU072376(CA)10ATCATGACCCACAAGAGGAGAGTCAGGGATAGAGACTTGTGAATGA55146128-P2-A5
8LG4LcaB053EU072377(GT)18GAGGCCCCGATGAGAAAACCTGTGATGTCGGCGGAGGAGTGC55319128-P2-H11
9LG5LcaB034EU072369(CA)8TTTGCCTGAATAAAACCCTACACTAAGCCCTTTGCACAGTATTATTTC55171128-P2-C8
10LG5LcaB084EU072391(GT)14GAGCGCTCGGCTGTTTCATCCAGCCAATCTGTTTACCAGCACAC55248128-P2-C4
11LG5LcaB086EU072392(CA)12CAGATGATCTTTGACGAACTGAAATTCTTGGTGAAAAATGACAACAAA55157128-P3-C5
12LG5LcaB130EU072401(CA)26GGGGGAAAGGAAAAACTGATGTGTAATGGTAAGATTTTGGGTGTG55215128-P2-F6
13LG5LcaB177EU072409(GA)13TTTAATTTTAGCCCCGTGATTGTGTGCCAGTGGGTTTCTC55214128-P3-C1
14LG5LcaB180EU072410(TC)13AGTCTACACCGATTACACCAGTCTACTCTAACCGCACCAGAAAAG55243128-P2-C7
15LG5LcaB229EU072417(GT)14ACATCGCGTTCTCCTCTGATCCAGGGTGTGGTAGTCCTCTC55140128-P3-C8
16LG6LcaB065EU072384(GT)13GCATTGTTGGCAAAGTTGAGTATTCTTACAGTGGGCATCTGACCT55148128-P3-G1
17LG6LcaB188EU072411(GA)17TGATTTGGCTTTTAGGTGAAACATGACAAAAGAATGCCTTGCTCT55211128-P3-D7
18LG7LcaB010EU072358(CA)9TCCTCCTGGGCTGTTGTATCTTATATGGGGTGGACCTCATTTTCA55155128-P1-G10
19LG7LcaB072EU072385(GT)10CAACGTGGGTGAATCTGTGTTTGGCAGCAAATAATTCAGAGTAT55217128-P1-A11
20LG7LcaB114EU072395(AC)8TGTGCCCATGTTTACTAGATACCAGTGTGCACGCTGCATTTGT55172128-P2-F9
21LG7LcaB135EU072402(TC)18CATCCCAGGTTTTCATACCATTACTGCGGTTATTAATCCACAAAG55123128-P3-C4
22LG7LcaB151EU072404(TC)11TTGTGCGCTTCTGTTTGTTTTTCTGTAGGGCTATGCTGTTGGCTTTCT55311128-P2-D2
23LG8LcaB025EU072366(GT)13AGGGGGCAAAGGGGTCACGGAGCCGGCAGTTGCACATCTG55160128-P2-B3
24LG8LcaB083EU072390(GT)12CGCTGGCATGGCTCTAGTAGTGATAGCGGGCTAAAAGCTGCTGTG55366128-P1-H5
25LG8LcaB214EU072413(GA)12AGCGGGAGGCTGAGAAGTAAACCCCTGCCTCTTGTTCATC55239128-P1-H4
26LG9LcaB024EU072365(GT)10AGAAGGGAAAAAGAGATGGGATGTCAGGGCCGTTTTATTGCTGTAG55162128-P3-B2
27LG9LcaB045EU072373(GT)26ACAGGGAACGAATGGGGACAAAAATTGGCACGCTCATTCAAGAAC55149128-P2-D4
28LG9LcaB155EU072405(GA)24TGTGGCCTTTGTGTAAGTGAGAATCATTCCCGCAAACAACACA55197128-P3-G11
29LG10LcaB160EU072406(GT)13CTTCATCCAGCCCAGTGACAGGAATGGCCAGCTAAAACATCAAC55307128-P3-A1
30LG10LcaB201EU072412(TC)16ATTGCACCAGTCCCGAATGAGGCAGCGTGCTTGTGGAAAAA55210128-P2-D1
31LG11LcaB112EU072394(GT)7TACCTGCCTTGTTTTTGTCCTTAAAGCCTCCATACACAGCTACATTA55113128-P1-D6
32LG12LcaB041EU072371(AC)8AGGTATGTTTTTGGGGCTTTTAGTCCCCCTACCCCTGTTTTACATA55250128-P1-B5
33LG12LcaB058EU072381(AC)15AAACCAAATGCTTACACAGTTACCTTGAGAGCTATTGGGATTACACAT55160128-P1-A2
34LG13LcaB059EU072382(AC)18CCTAGCCAAGTGCAACAGTGTGAGCTGGGAAACAGGCTGAGAC55186128-P3-A12
35LG14LcaB055EU072379(AC)12AGTTGCGGTCTTGTCCAAATGGACTGGCAGAGTCAAGCAAAGTGTG55325128-P3-A3
36LG14LcaB075EU072386(GT)12TGTCGCACACCGCTGCTTTACTATCTTGCTCTCACCCTCTCCCTCTTT55131128-P2-G12
37LG14LcaB076EU072387(AC)17CGAAAACGTCGATCCAACTAAAACAGTCAGTGCGTGAAGTGTATG55135128-P3-A2
38LG14LcaB127EU072399(AC)11AGTTGCAGGGCATGCTGTGAAACTCGGCATCAAGCGTGGAAGAG50159128-P2-D6
39LG15LcaB174EU072408(GT)8(GA)15CAGCATTAAAAAGATGAGAAAAGTATTCCCCCATCTTTGTTACAGTT55242128-P2-D7
40LG16LcaB013EU072360(AC)15AGGCCAAGGCTGCTCTGTGTCCAACCTGGGATGAGGCACTAAAAG55127128-P2-B12
41LG16LcaB054EU072378(AC)8TGCAGGAGATAAGACGCTGTGGAGATCGGCAACCTGACAAA55298128-P3-F4
42LG16LcaB062EU072383(AC)15ATGAGGGGTGAACAGTTGTCCTTCTCCTCGTCCTTTTCGTTACC55218128-P3-F8
43LG16LcaB078EU072388(GT)13GTTACCATGCCAACAACCAATAGCCTGCTATAGATCCCACTG5581128-P3-A4
44LG16LcaB228EU072416(AC)21GAATAGGCCTACCTGGTGAGAGGTCCCTGCTTAGCTGCCATTATC55237128-P2-B12
45LG17LcaB023EU072364(GT)13GCAGCGAGATGAACAGTGATTATTACATGATCCTCGCCACCATC55326128-P2-G5
46LG17LcaB048EU072374(GT)20TGGAGCTTTATTTGAGTGTGACCCCCCTATGTATTCAGTATTCTG55180128-P3-C4
47LG17LcaB051EU072375(GT)19TACCCAAAGTAAACCAGCAGCACACAACTAGCAGGTTTGCACAACACA55104128-P3-H11
48LG17LcaB121EU072397(AC)16CTTTTTGTGCCCCAGATGACGGGAGCAGAGTGGAGCTTTCAGAA55238128-P1-D9
49LG18LcaB019EU072363(GT)11TTGAGTCCCCTGTGCTATGTAACACACCGCCTCCACAATTAGTGTC55199128-P1-F10
50LG18LcaB081EU072389(GT)7(GCA) (GT)3TGAGGACAGCCACCCCACTTTTGAGCCGCTATCTCATTCCCACATC55126128-P2-F10
51LG18LcaB221EU072415(TC)9AGGGGAGTGCTGCCTCAGTGTTCCCAACAGATAATGATGCTCAA55117128-P3-A8
52LG19LcaB005EU072357(AC)22AGGCGGTGCTGGGGCAGATTTACCGCAGCCTGGCTAGAGGTCT55300128-P3-H8
53LG19LcaB033EU072368(AC)15ATCCACCTTGAGGTTTCTTTATCAAACCAAGCCACTCCTATCATCTT55190128-P1-D5
54LG20LcaB219EU072414(GA)25AGTTGGCTCTTAAAGCATTTGAATTTCCCACACCGTTAGGTTTATCTG55155128-P1-H12
55LG21LcaB106EU072393(GT)7CTGGCTGCATGGAGAAAGAAGTTTGGGTTTTGAGCTCACTGACA55311128-P2-F7
56LG21LcaB116EU072396(GT)20CATGGCCTTTCTGGGAAGTTATTGCAGACGGAGCCACAAGCAAAAC55226128-P3-D6
57LG21LcaB169EU072407(AC)6(GA)20CACAAACCAGGCGATCACATATCGGTAAGCCCGCAGAAATCGACTTCA55218128-P3-E9
58LG23LcaB015EU072362(GT)11GAGCGCTCTCCCCTGGTTTCTGCAGCCGAGCACGACTG55221128-P1-G9
59LG23LcaB038EU072370(GT)19TGTGCGCACTCACATACATTAGTGAAAAATAGATGGTAAGCCTCTC55216128-P1-A3
60LG23LcaB056EU072380(AC)11ATGCCGTTTCCTGCTGCTGTCTGATGCTGTTTCTGGCTGGTGTA55141128-P2-E02
61LG23LcaB150EU072403(GA)11TCTAGCGCTCGTCCTCTCCTGAGGCCTCCTCGTTCTCTGCT55178128-P2-A11
62LG24LcaB125EU072398(GT)12AAGCACAAGATACGCCTTCCTTGTGCCCTGGGCCTCTACAT55153128-P2-C11
63UnlinkedLcaB044EU072372(GT)15CAGGACGTTTGAATACTTGTGTTTAAAAGGTGGTGGTATTAGTCAT55160128-P2-A8

Ta: annealing temperature for PCR. * 384plate-96plate-well: name of the 384-well plate, name of 96-well plate and well position in the 96-well plate.

Microsatellites isolated from BAC clones and mapped on the linkage map of L. calcarifer Ta: annealing temperature for PCR. * 384plate-96plate-well: name of the 384-well plate, name of 96-well plate and well position in the 96-well plate. A microsatellite linkage map of . F: linkage map for female. M: linkage map for male. Markers underlined represent microsatellites selected from each LG for screening the BAC library. Markers in italic (initiated with LcaB) represent microsatellites isolated from BAC clones and newly mapped to the map. A microsatellite linkage map of . See detailed explanation in Figure 4 A microsatellite linkage map of . See detailed explanation in Figure 4 A microsatellite linkage map of . See detailed explanation in Figure 4

Discussion

A critical tool for genomic studies in fish species is the availability of deep-coverage large-insert genomic libraries, such as BAC libraries that can be used for physical mapping, integration of linkage and physical maps, positional cloning, comparative genomic studies and genome sequencing [13]. We constructed the first BAC library for L. calcarifer containing 49,152 clones with an average insert size of 98 kb ranging from 45 to 200 kb, indicating that this BAC library provided 6.9 × coverage of the L. calcarifer haploid genome. We have noticed that 50% of the inserts in our BAC library were under 100 kb. It is common that insert size of 50% of BAC clones was smaller than the size of DNA fragments recovered from gels. This phenomenon has been seen in several BAC libraries, such as the BAC library of tomato [13]. The reason for this is that smaller fragments could be included in larger fragments during electrophoresis, and during ligation, the relatively smaller fragments were preferentially ligated to the vectors. PCR screening of the library with 24 markers each from one of 24 LG and 15 randomly selected ESTs/genes demonstrated that the BAC library provided good coverage of the L. calcarifer genome. Whether the BAC clones with large inserts were of hybrid origin remains to be examined. A second generation linkage map of L. calcarifer is under construction by integrating new markers including microsatellites, ESTs and candidate genes onto the first generation map. Low polymorphism of ESTs and candidate genes was a bottleneck to map them to the linkage map [6]. Using highly polymorphic microsatellites located in BAC clones harboring interesting genes and ESTs, these interesting genes and ESTs could be mapped onto the linkage map as shown in this experiment. By employing highly polymorphic microsatellites in BAC clones, we have mapped 86 BAC clones to the linkage map of L. calcarifer. At least one BAC clone has been anchored on each LG, which can be used to integrate linkage and physical maps in the future. The number of markers on the linkage map of L. calcarifer increased to 302 by mapping 62 novel microsatellites located in 62 BAC clones onto the map. The two male linkage groups (i.e. LG14 and LG18) which were split to two LG on the first generation map respectively [6] due to the limited number of markers on these LG, were merged to one LG respectively by integrating new microsatellites located in single BAC clones, which improved the quality of the linkage map of L. calcarifer. The BAC library of L. calcarifer could be also used in constructing a physical map by BAC fingerprinting [12,20], sequencing BAC ends and positional cloning of QTL of commercial interests [4] so as to facilitate selective breeding of L. calcarifer. Eventually, the BAC library can be used in whole genome shotgun sequencing when it becomes necessary.

Conclusion

A first L. calcarifer BAC library with 6.9 × coverage of the haploid genome has been constructed and characterized. Screening the library with 24 markers and 15 ESTs/genes demonstrated good genome coverage of this library. Eighty-six BAC clones were mapped to the first generation linkage map, improving the marker density of the linkage map of L. calcarifer. This BAC library together with the improved linkage map not only supplies an indispensable tool to physical mapping, integration of physical and linkage maps, and positional cloning for genes of importance, but also contributes to comparative genomic studies and eventually genome sequencing.

Methods

Preparation of high-molecular-weight DNA

Five hundred microliters of blood was collected from a male individual of L. calcarifer with a heparinized syringe. The concentration of leucocytes was quantified to be approximately 109 cells/ml. Quantities corresponding to 2.14 × 107 cells were embedded in 40 μl of 2% InCert agarose (in PBS) for DNA extraction. The mixture was then transferred into ice-cold plug moulds (Bio-Rad, SG, Singapore). Individual plugs were released into cell lysis solution [1% lithiumdodecyl sulfate, 10 mM Tris (pH 8), 100 mM EDTA (pH 8)] that was incubated at 37°C for 1 hr with occasional swirling. The cell lysis solution was replaced with 50 ml of new cell lysis solution and incubated overnight at 37°C. The cell lysis solution was supplanted with 50 ml of 20% NDS. Two ml of proteinase K (20 mg/ml) was added to each 50 ml of 20% NDS consisting of 0.2% N-laurylsarcosine, 2 mM Tris-HCL (pH9.0), 0.14 M EDTA. The solution was incubated at 37°C overnight. Plugs were washed three times with TE50 and 0.05 M EDTA for one hour at room temperature. The plugs were put into a fresh Falcon tube, and washed twice with 50 ml TE50 and 50 μl PMSF (100 mM) at 37°C for 20 min to inactivate proteinase K. The plugs were then washed twice with 50 ml of TE50 in the Falcon tube at room temperature for 30 min to get rid of the PMSF.

Partial digestion of high molecular weight DNA and size selection

Digestion with restriction enzyme HindIII, pulse field gel electrophoresis (PFGE), isolation and purification of high molecular weight (HMW) DNA were performed using the method described previously [21]. Briefly, after displacement of the plugs by 1 × TE buffer, the agarose plugs were soaked in 800 μl of HindIII digestion buffer [0.015% bovine serum albumin (BSA), 75 mM NaCl, 12 mM Tris-HCl (pH 7.50)] and 3 U of HindIII for 16 hours at 4°C, after which, 100 μl of MgCl2 (100 mM) was added and the mixture was incubated at 37°C for one hour to partially digest the genomic DNA. The reaction was stopped by adding 150 μl of 0.5 M EDTA (pH 8.0), 15 μl 20 mg/ml proteinase K and 37.5 μl 20% NDS, and incubating at 37°C for one hour. Plugs were rinsed in TE50 in a Petri dish then transferred to a 15 ml Falcon tube. 15 ml of TE50 and 15 μl of 100 mM PMSF were added to the tube. The tube was incubated at room temperature for 20 min on rotating shaker. The tube with plug was washed twice with 15 ml TE50 at room temperature on a shaker for 30 min each. Size selection was carried out as described [22], with minor modifications. In brief, partially digested DNA was separated by PFGE in 0.5 × TBE on a CHEF-DRII apparatus (Bio-Rad, SG, Singapore) under the following conditions: 14°C, 6.0 v/cm, angle = 120°, initial switch time = 5 sec, final switch time = 15 sec, run time = 16 hours and ramping = linear. At the end of this electrophoresis step, the gel portion containing DNA of 50 kb or less in size together with the portion of the gel containing the original plugs was removed. 1% fresh agarose was added to the remaining gel followed by a second electrophoresis step using the same conditions for 18 hours. Gel slices containing size fractionated DNA were obtained by cutting horizontally at 0.5 cm intervals in the size range of 100–250 kb. Each excised gel slice was subsequently inverted and buried in 1% low-melting-point agarose gel. A third electrophoresis step using the same conditions for 18 hours was carried out to concentrate the widely spread DNA fragments in each gel slice into a sharp single band. The band of size selected genomic DNA was then excised and dialyzed in 1 × TAE at 4°C overnight.

Ligation and electroporation

Size fractionated DNA was recovered from each gel band by electroelution in Spectra/Por 7 dialysis bags (Spectrum Laboratories, CA, USA) as described [23]. Partially digested HMW DNA was then ligated to 25 ng of dephosphorylated, HindIII digested pCC1BAC (Epicentre, MD, USA) at a 1:10 molar ratio of insert to vector with 400 units of T4 ligase (NEB, MA, USA) in 50 μl reaction at 16°C overnight. Dialyzed ligation was used to transform ElectroMAX DH10B competent cells (Invitrogen, MD, USA). Electroporation was carried out using a BioRad Gene Pulser (BioRad, CA, USA) at 4 kΩ and 350 V. Cells were incubated in 1 ml SOC medium at 37°C for one hour with shaking and later spread on LB plates containing 12.5 μg/ml Chloramphenicol, 40 μg/ml X-gal and 100 μg/ml IPTG and incubated at 37°C for 24 hours to allow the blue color to develop sufficiently.

Isolation of BAC DNA and estimation of insert size

We isolated BAC DNA from 212 BAC clones randomly chosen using a QIAwell 8 Plasmid Kit (Qiagen, HRB, Germany) following the protocol of the manufacturer. Isolated BAC DNA were digested with the restriction enzyme NotI and then subjected to PFGE for 16 hours using the same PFGE conditions as those for high molecular weight DNA isolation.

Library pooling and PCR screening

White recombinant colonies were manually picked and arrayed to plates (Genetix, Hampshire, UK) of 384-well each containing of 60 μl of LB media and 25% glycerol. Plates were incubated overnight at 37°C and stored at -80°C. The frozen stocks of the primary clones in 384 well plates were recovered and transferred to 4 96-well PCR plates containing 100 μl LB medium supplemented with 15% glycerol and 12.5 μg/ml chloramphenicol, then incubated overnight at 37°C to make a copy of the BAC library. To establish a hierarchical PCR screening system, the library was divided into 11 superpools each consisting of 12 plates of 384-wells. Each superpool was divided into 48 pools each consisting of one 96-well plate of BAC clones. Cultures from 48 pools were combined to make superpool DNA for the first step PCR screening. Cultures from 48 plates of 96-well BAC clones were combined to make pool DNA for the second step PCR screening. In each pool, cultures from each well of 96 clones from a 96-well plate were used for the third step screening. For examining the genome coverage of the BAC library, twenty-four microsatellites (Lca318, Lca064, Lca137, Lca171, Lca098, Lca062, Lca130, Lca086, Lca301, Lca002, Lca058, Lca074, Lca253, Lca147, Lca069, Lca367, Lca021, Lca193, Lca220, Lca181, Lca255, Lca040, Lca411 and Lca231) located on each of the 24 linkage groups (Table 1) [6], and 15 ESTs/genes isolated from cDNA libraries or selected from GenBank were used to screen the library. These 15 ESTs/genes are: PVALB-1, 5-HT, PROL-A, 14KDA-AP, AMY-A, MX, AP, LECT2, LYSO-G, IGF-1, TUB1A, TUB2B, GT7, CYP19A2 and AFPII. Primers (Table 2) were designed in unique regions for each EST/gene using software PrimerSelect (Dnastar, WI, USA). The PCR reaction (25 μl) consisted of 2 μl cultured cells, 1 × PCR buffer (Finnzymes, Espoo, Finland) containing 1.5 mM MgCl2, 200 nM of each primer, 50 μM of each dNTP and one unit DNA polymerase (Finnzymes, Espoo, Finland). PCR was conducted on a PTC-100 PCR machine (MJ Research, CA, USA) using the following PCR program: an initial denaturation at 95°C for 2 min followed by 35 cycles 95°C for 30 sec, 55°C for 30 sec and 72°C for 1–2 min, and a final extension at 72°C for 5 min. PCR products are checked for the presence of PCR products on 2% agarose gels. Positive pools were used to determine a set of addresses corresponding to potential clones, which were subsequently validated by a third PCR analysis of individual clones. PCR products of respective microsatellites and genes/ESTs were confirmed by direct sequencing. DNA was isolated from pool of 300 BAC clones using a QIAwell 8 Plasmid Kit (Qiagen, HRB, Germany). CA- and GA-microsatellites located in the 300 BAC clones were enriched according to a previous protocol [24] with some modifications [25]. Repeat-enriched DNA fragments of 400–1200 bp in size were cloned into pGEM-T vector (Promega, CA, USA), and transformed into XL-10 blue supercompetent cells (Stratagene, CA, USA). White clones were picked and arrayed into 96-well plates for bidirectional sequencing on an ABI3730 × l DNA sequencer (ABI, CA, USA) using the BigDye V3.0 kit, M13 forward and M13 reverse primers. Redundant and overlapping sequences were grouped using Sequencher (GeneCodes, MI, USA). Unique sequences were compared to known microsatellite sequences of L. calcarifer prior to primer design in order to reduce redundancy. Genotyping and linkage mapping of these microsatellites were performed with the mapping panel described previously [6]. The graphic maps were generated using Mapchart software [26]. To identify the origin of each microsatellite from the 300 BAC clones, these clones were PCR-screened with microsatellite primers. PCR products were checked for the presence of objective bands on 2% agarose gels.

List of abbreviations

BAC-bacterial artificial chromosome; QTL-quantitative trait loci; LG-linkage group; PVALB-1-pavalbumin beta gene 1; 5-HT-5-hydroxytryptamine type 1 receptor; PROL-A-prolactin gene alpha type; 14KDA-AP-14kDa apolipoprotein gene; AMY-A-amylayse gene alpha type; AP-aminopeptidase gene; LYSO-G-lysozyme goose type; TUB1A-tublin 1 alpha type; TUB2B-tublin 2 beta type; GT7-EST containing a (GT)7 microsatellite, CYP19A2-cytochrome P450 aromatase alpha type 2 and AFPII-type II antifreeze protein.

Authors' contributions

GHY planned and started the project, and determined the final version of the manuscript. CMW designed and conducted the experiment, as well as drafted the manuscript. LLC, FF, GP, LJ, ZZY and LG are involved in screening the library with randomly selected microsatellites and genes, mapping of markers to the linkage map. All authors have read and approved the final version of the manuscript.
  21 in total

Review 1.  Genetic dissection of phenotypic diversity in farm animals.

Authors:  L Andersson
Journal:  Nat Rev Genet       Date:  2001-02       Impact factor: 53.242

2.  Construction and characterization of a sheep BAC library of three genome equivalents.

Authors:  D Vaiman; A Billault; K Tabet-Aoul; L Schibler; D Vilette; A Oustry-Vaiman; C Soravito; E P Cribiu
Journal:  Mamm Genome       Date:  1999-06       Impact factor: 2.957

3.  A microsatellite linkage map of Barramundi, Lates calcarifer.

Authors:  Chun Ming Wang; Ze Yuan Zhu; Loong Chueng Lo; Felicia Feng; Grace Lin; Wen Tong Yang; Jian Li; Gen Hua Yue
Journal:  Genetics       Date:  2006-12-18       Impact factor: 4.562

Review 4.  Chromosome landing: a paradigm for map-based gene cloning in plants with large genomes.

Authors:  S D Tanksley; M W Ganal; G B Martin
Journal:  Trends Genet       Date:  1995-02       Impact factor: 11.639

5.  Rapid isolation and characterization of microsatellites from the genome of Asian arowana (Scleropages formosus, Osteoglossidae, Pisces).

Authors:  G H Yue; F Chen; L Orban
Journal:  Mol Ecol       Date:  2000-07       Impact factor: 6.185

6.  Construction and characterization of BAC libraries for three fish species; rainbow trout, carp and tilapia.

Authors:  T Katagiri; S Asakawa; S Minagawa; N Shimizu; I Hirono; T Aoki
Journal:  Anim Genet       Date:  2001-08       Impact factor: 3.169

7.  Genomic bacterial artificial chromosome library of the Japanese flounder Paralichthys olivaceus.

Authors:  T Katagiri; S Asakawa; I Hirono; T Aoki; N Shimizu
Journal:  Mar Biotechnol (NY)       Date:  2000-11       Impact factor: 3.619

8.  A genome scan for quantitative trait loci affecting growth-related traits in an F1 family of Asian seabass (Lates calcarifer).

Authors:  Chun Ming Wang; Loong Chueng Lo; Ze Yuan Zhu; Gen Hua Yue
Journal:  BMC Genomics       Date:  2006-10-26       Impact factor: 3.969

9.  A highly redundant BAC library of Atlantic salmon (Salmo salar): an important tool for salmon projects.

Authors:  Jim Thorsen; Baoli Zhu; Eirik Frengen; Kazutoyo Osoegawa; Pieter J de Jong; Ben F Koop; William S Davidson; Bjørn Høyheim
Journal:  BMC Genomics       Date:  2005-04-04       Impact factor: 3.969

10.  A first generation BAC-based physical map of the channel catfish genome.

Authors:  Sylvie M-A Quiniou; Geoffrey C Waldbieser; Mary V Duke
Journal:  BMC Genomics       Date:  2007-02-06       Impact factor: 3.969

View more
  16 in total

1.  Identification and analysis of immune-related transcriptome in Asian seabass Lates calcarifer.

Authors:  Jun Hong Xia; Gen Hua Yue
Journal:  BMC Genomics       Date:  2010-06-04       Impact factor: 3.969

2.  Escherichia coli MW005: lambda Red-mediated recombineering and copy-number induction of oriV-equipped constructs in a single host.

Authors:  Marcel Westenberg; Sophie Bamps; Helen Soedling; Ian A Hope; Colin T Dolphin
Journal:  BMC Biotechnol       Date:  2010-03-29       Impact factor: 2.563

3.  A first generation BAC-based physical map of the Asian seabass (Lates calcarifer).

Authors:  Jun Hong Xia; Felicia Feng; Grace Lin; Chun Ming Wang; Gen Hua Yue
Journal:  PLoS One       Date:  2010-08-05       Impact factor: 3.240

4.  The FTO Gene Is Associated with Growth and Omega-3/-6 Ratio in Asian Seabass.

Authors:  Fei Sun; Rongjian Tu; Jun Hong Xia; Xiao Jun Liu; Gen Hua Yue
Journal:  Mar Biotechnol (NY)       Date:  2018-05-16       Impact factor: 3.619

5.  Consolidation of the genetic and cytogenetic maps of turbot (Scophthalmus maximus) using FISH with BAC clones.

Authors:  Xoana Taboada; Jose C Pansonato-Alves; Fausto Foresti; Paulino Martínez; Ana Viñas; Belén G Pardo; Carmen Bouza
Journal:  Chromosoma       Date:  2014-01-29       Impact factor: 4.316

6.  Second-generation genetic linkage map of catfish and its integration with the BAC-based physical map.

Authors:  Parichart Ninwichian; Eric Peatman; Hong Liu; Huseyin Kucuktas; Benjaporn Somridhivej; Shikai Liu; Ping Li; Yanliang Jiang; Zhenxia Sha; Ludmilla Kaltenboeck; Jason W Abernathy; Wenqi Wang; Fei Chen; Yoona Lee; Lilian Wong; Shaolin Wang; Jianguo Lu; Zhanjiang Liu
Journal:  G3 (Bethesda)       Date:  2012-10-01       Impact factor: 3.154

7.  A high-resolution linkage map for comparative genome analysis and QTL fine mapping in Asian seabass, Lates calcarifer.

Authors:  Chun Ming Wang; Zhi Yi Bai; Xiao Ping He; Grace Lin; Jun Hong Xia; Fei Sun; Loong Chueng Lo; Felicia Feng; Ze Yuan Zhu; Gen Hua Yue
Journal:  BMC Genomics       Date:  2011-04-02       Impact factor: 3.969

8.  BAC library resources for map-based cloning and physical map construction in barley (Hordeum vulgare L.).

Authors:  Daniela Schulte; Ruvini Ariyadasa; Bujun Shi; Delphine Fleury; Chris Saski; Michael Atkins; Pieter deJong; Cheng-Cang Wu; Andreas Graner; Peter Langridge; Nils Stein
Journal:  BMC Genomics       Date:  2011-05-19       Impact factor: 3.969

9.  Molecular parentage analysis is essential in breeding Asian seabass.

Authors:  Peng Liu; Jun Hong Xia; Grace Lin; Fei Sun; Feng Liu; Huan Sein Lim; Hong Yan Pang; Gen Hua Yue
Journal:  PLoS One       Date:  2012-12-05       Impact factor: 3.240

10.  Genome evolution in Reptilia: in silico chicken mapping of 12,000 BAC-end sequences from two reptiles and a basal bird.

Authors:  Charles Chapus; Scott V Edwards
Journal:  BMC Genomics       Date:  2009-07-14       Impact factor: 3.969

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.