| Literature DB >> 17825108 |
Chang-Jun Zeng1, Hui-Juan Pan, Shao-Bin Gong, Jian-Qiu Yu, Qiu-Hong Wan, Sheng-Guo Fang.
Abstract
BACKGROUND: Giant panda is rare and endangered species endemic to China. The low rates of reproductive success and infectious disease resistance have severely hampered the development of captive and wild populations of the giant panda. The major histocompatibility complex (MHC) plays important roles in immune response and reproductive system such as mate choice and mother-fetus bio-compatibility. It is thus essential to understand genetic details of the giant panda MHC. Construction of a bacterial artificial chromosome (BAC) library will provide a new tool for panda genome physical mapping and thus facilitate understanding of panda MHC genes.Entities:
Mesh:
Year: 2007 PMID: 17825108 PMCID: PMC2018726 DOI: 10.1186/1471-2164-8-315
Source DB: PubMed Journal: BMC Genomics ISSN: 1471-2164 Impact factor: 3.969
Figure 1(a) Insert size analysis of randomly selected BAC clones. There are 14 BAC clones tested. The BAC DNA was completely digested with Not I enzyme and determined by pulsed field gel electrophoresis with 1–20 second switch time, 6 V/cm at 12°C for 16 hours. The MidRange II PFG markers (New England BioLabs) were used as size standard in the right flanking lane. The size of pCC1BAC vector is 8.1 kb. (b) Distribution of insert size in the giant panda BAC library. Insert sizes were evaluated by PFGE after Not I restriction enzyme digestion from 174 BAC clones.
Library screening results based on PCR amplification of 16 pairs of primers*
| Locus | Type | Primer sequences (5'→3') | PCR product size (bp) | Number of positive clones | Source |
| Notch4 | MHC class III | CGCTGTGCCTGCCTCAAT | 217 | 8 | GenBank: |
| DRA | MHC class II | AGACAAGTTCTCGCCACC | 172 | 2 | GenBank: |
| Genomic sequence | CAGCCCTCTTCCTCCTCACTC | 244 | 5 | GenBank: | |
| Genomic sequence | GCGGGCCATCTCCACTAT | 322 | 6 | GenBank: | |
| MHC class II | TCGCGTCCCCACAGCACATT | 281 | 12 | [8] | |
| MHC class II | GCTGACCATGTTGCTTACTAT | 275 | 16 | [9] | |
| MHC class I | GCTCCCACTCSMTGAGGTATT | 293 | 6 | GenBank: | |
| MHC class III | TGCTGATCCAGGTGTACGAG | 204 | 8 | GenBank: | |
| Micro-satellite | ACGGGAAGCCTGCTTCTACACTC | 164–172 | 6 | [22] | |
| Micro-satellite | CTGGCTTCAACTGCCTTTGAGAG | 169–177 | 5 | [22] | |
| Micro-satellite | TATGCCACCTGCCCAGAC | 248–256 | 4 | [23] | |
| Micro-satellite | AAGCAGTTGTTTTTGCTTAGTG | 142–150 | 3 | [23] | |
| Micro-satellite | CAGGCAGCACAGCTATACCA | 174–182 | 6 | [23] | |
| Micro-satellite | AGGAAACATGTTGCCTTTTCA | 147–149 | 4 | [23] | |
| Micro-satellite | CATAATTCCCTGGCAATGCT | 239–257 | 3 | [23] | |
| Micro-satellite | TTTTCAGGCCTCCGAAAAC | 134–140 | 5 | [23] |
*To avoid false-positive results, individual positive clones were verified by the second round PCR. All the PCR products of positive clones were sequenced three times.
Primer list used for constructing the final contig with minimum tiling path
| Primer name | Source | Primer sequences (5'→3') | Size (bp) | GenBank No. |
| GenBank: | GGGAAGATGCTCTACTCA | 223 | ||
| GenBank: | AGACAAGTTCTCGCCACC | 172 | ||
| [8] | TTCACCAACGGGACGGAG | 281 | ||
| [9] | CTTACCCTACTGACCAGC | 275 | ||
| GenBank: | GGGGACAGTGTATCCAGAG | 202 | ||
| GenBank: | CCCACTAGAGCCATCCCG | 703 | ||
| GenBank: | GAAGCCCCTGGAGTTTGG | 157 | ||
| GenBank: | GCTTCTATCCAGCTGATG | 155 | ||
| GenBank: | CTCAAACACTTCTTCATCCAG | 168 | ||
| GenBank: | TCGCTCCTGTAACCTGATG | 282 | ||
| 237D4-T7 | End sequence | AGTTCTCCATCCGGCTCT | 172 | / |
| 237D4-RP2 | End sequence | TTGGAAAGTCTGGGATGA | 274 | / |
| 826G2-T7 | End sequence | CTCCCTCAGCAATAACC | 187 | / |
| 826G2-RP2 | End sequence | TGTGACCGAGTTGGAGTA | 442 | / |
| 900H8-T7 | End sequence | GAAGTGAGGGTAGAGGAC | 249 | / |
| 206G5-T7 | End sequence | AGAGGTCACGACCAGCAC | 207 | / |
| 692B2-RP2 | End sequence | AGCACGGCCATAATAATAAA | 264 | / |
| 692B2-F8R8 | Shotgun sequences | TCCTTTAGCCCCTCTTGAGCC | 195 | / |
| 1262B6-F5R5 | Shotgun sequences | CCTCCACATTTCTCTGCTT | 273 | / |
| 186A7-T7 | End sequence | GCCTCTTGTCCAGTTCCT | 198 | / |
Figure 2DNA fingerprints of 11 positive BAC clones involved in minimum tiling path. The positive BAC clones were extracted by Qiagen large-construct kit and digested with Hind III and EcoR I, followed by separation on 1.0% agarose gel with 2.0 V/cm for 18 hours. M is mixture of λ-EcoT14 I digest and DL2000 DNA marker. The sizes in base pairs of markers are indicated on both sides.
Figure 3The minimum BAC tiling pattern of giant panda MHC class II region. A total of 11 BAC clones were involved: 504E11 (67 kb), 237D4 (84 kb), 354C3 (69 kb), 826G2 (50 kb), 606E7 (110 kb), 206G5 (73 kb), 900H8 (85 kb), 692B2 (35 kb), 1561B8 (45 kb), 1262B6 (110 kb) and 186A7 (54 kb). Ten MHC class II primerpairs (BTNL2, DRA, DRB, DQA, DOB, LMP2, DMB, DMA, COL11A2 and DAXX), eight end primerpairs marked with black triangle (237D4-T7, 237D4-RP2, 826G2-T7, 826G2-RP2, 206G5-T7, 900H8-T7, 692B2-RP2 and 186A7-T7) and two shotgun-sequence primerpairs (692B2-F8R8 and 1262B6-F5R5) marked with blank triangle were anchored to the contig. This BAC contig map of panda MHC class II region spans about 650 kb. The location of genes was determined against the human, dog, cat and other mammalian MHC class II loci. Star symbols indicate the MHC genes are probably multiple loci but this study utilizes one-locus-amplified primers.