Literature DB >> 16704825

MassTag polymerase chain reaction for differential diagnosis of viral hemorrhagic fever.

Gustavo Palacios1, Thomas Briese, Vishal Kapoor, Omar Jabado, Zhiqiang Liu, Marietjie Venter, Junhui Zhai, Neil Renwick, Allen Grolla, Thomas W Geisbert, Christian Drosten, Jonathan Towner, Jingyue Ju, Janusz Paweska, Stuart T Nichol, Robert Swanepoel, Heinz Feldmann, Peter B Jahrling, W Ian Lipkin.   

Abstract

Viral hemorrhagic fevers are associated with high rates of illness and death. Although therapeutic options are limited, early differential diagnosis has implications for containment and may aid in clinical management. We describe a diagnostic system for rapid, multiplex polymerase chain reaction identification of 10 different causes of viral hemorrhagic fevers.

Entities:  

Mesh:

Year:  2006        PMID: 16704825      PMCID: PMC3294712          DOI: 10.3201/eid1204.051515

Source DB:  PubMed          Journal:  Emerg Infect Dis        ISSN: 1080-6040            Impact factor:   6.883


Increasing international travel, trafficking in wildlife, political instability, and terrorism have made emerging infectious diseases a global concern. Viral hemorrhagic fevers (VHF) warrant specific emphasis because of their high rates of illness and death, and the potential for rapid dissemination by human-to-human transmission. The term "viral hemorrhagic fever" characterizes a severe multisystem syndrome associated with fever, shock, and bleeding diathesis caused by infection with any of several RNA viruses, including Ebola virus and Marburg virus (MARV) (family Filoviridae); Lassa virus (LASV) and the South American hemorrhagic fever viruses Guanarito virus, Junín virus, Machupo virus, and Sabiá virus (Arenaviridae); Rift Valley fever virus (RVFV), Crimean-Congo hemorrhagic fever virus (CCHFV), and hantaviruses (Bunyaviridae); and Kyasanur Forest disease virus (KFDV), Omsk hemorrhagic fever virus, yellow fever virus (YFV), and dengue viruses (Flaviviridae) (,). Although clinical management of VHF is primarily supportive, early diagnosis is needed to contain the contagion and implement public health measures, especially if agents are encountered out of their natural geographic context. Vaccines have been developed for YFV, RVFV, Junín virus, KFDV, and hantaviruses (–), but only YFV vaccine is widely available. Early treatment with immune plasma was effective in Junín virus infection (). The nucleoside analog ribavirin may be helpful if given early in the course of Lassa fever (), Crimean-Congo hemorrhagic fever (), or hemorrhagic fever with renal syndrome () and is recommended in postexposure prophylaxis and early treatment of arenavirus and bunyavirus infections (). Methods for direct detection of nucleic acids of microbial pathogens in clinical specimens are rapid, sensitive, and obviate the need for high-level biocontainment. Numerous systems are described for nucleic acid detection of VHF agents; however, none are multiplex (). Although geographic location or travel history of suspected patients usually restricts the number of agents to be considered, diagnosis of VHF may be difficult in case of an intentional release (). Symptoms of VHF are initially nonspecific and may include fever, headache, myalgia, and gastrointestinal or upper respiratory tract complaints (); thus, assays that allow simultaneous consideration of multiple agents are needed. We recently described the application of MassTag polymerase chain reaction (PCR) in the context of differential diagnosis of respiratory disease (). MassTag PCR is a multiplex assay in which microbial gene targets are coded by a library of 64 distinct mass tags. Nucleic acids (RNA or DNA) are amplified by multiplex (reverse transcription–) PCR using up to 64 primers, each labeled by a photo-cleavable link with a different molecular weight tag. After separation of the amplification products from unincorporated primers and release of the mass tags from the amplicons by UV irradiation, tag identity is analyzed by mass spectrometry. The identity of the microbe in the clinical sample is determined by the presence of its 2 cognate tags, 1 from each primer.

The Study

To facilitate rapid differential diagnosis of VHF agents, we established the Greene MassTag Panel VHF version 1.0, which comprises the following targets: Ebola Zaire virus (ZEBOV), Ebola Sudan virus (SEBOV), MARV, LASV, RVFV, CCHFV, Hantaan virus (HNTV), Seoul virus (SEOV), YFV, and KFDV. Oligonucleotide primers were designed in conserved genomic regions to detect the broadest number of members for a given pathogen species. We developed a software program that culls sequence information from GenBank, performs multiple alignments with ClustalW, and designs primers optimized for multiplex PCR. The program uses a greedy algorithm to identify conserved sequences and create the minimum set of primers for amplification of all sequences in the alignment. Primers are selected within standard design constraints whenever possible (melting temperature 55°C–65°C, guanine-cytosine content 40%–60%, no hairpins); degenerate positions are introduced in cases where template divergence requires more flexibility. Although degeneracy is not tolerated in the five 3´ nucleotides, MassTag PCR allows up to 4 nonneighboring variable positions per primer. Primers are checked by the basic local alignment search tool for potential hybridization to sequenced vertebrate genomes (Table 1).
Table 1

Greene MassTag panel VHF version 1.0*

TargetMassTagNameSequenceGene
ZEBOV718 (fwd)EboZA-U234AACACCGGGTCTTAATTCTTATATCAAL
646 (rev)EboZA-L319GGTGGTAAAATTCCCATAGTAGTTCTTT
SEBOV503 (fwd)EboSU-U416CGAGCCTAACGTTTTGGGCL
630 (rev)EboSU-L489GCTCCAGGAATTGTTCGGGTA
MARV654 (fwd)MARV-U12816CCCCTCCATATCTTAGACAACATATTGTGL
395 (rev)MARV-L12994CCCAACACTCCTGGTTCACAGC
LASV†558 (fwd)Las4-U92ACTGCATTYTCATACTTYCTRGAATCNP
686 (rev)Las4-L257CCRGGYTTGACCAGTGCTGT
RVFV658 (fwd)RVF-U578GGATTGACCTGTGCCTGTTGCN
495 (rev)RVF-L660GCATTAGAAATGTCCTCTTTTGCTGC
CCHFV499 (fwd)CCHV-U4AGAAACACGTGCCGCTTACGCCCAN
710 (rev)CCHV-L120CCATTTCCYTTYTTRAACTCYTCAAACCA
HNTV479 (fwd)HAN-U179AYACAGCAGCAGTTAGCCTCCTN
702 (rev)HAN-L245GCT GCC GTA RGT AGT CCC TGTT
SEOV455 (fwd)SEO-U243CAGGATTGCAGCAGGGAAGAN
602 (rev)SEOUL-L309ATGATCACCAGGYTCTACCCC
YFV467 (fwd)YF-U186GCTGGGAGCGCGGTATCNS5
670 (rev)YF-L249GGAAGCCCAATGGTCCTCAT
KFDV483 (fwd)KYF-U170TGGAAGCCTGGCTGAAAGAGNS5
614 (rev)KYF-L233TCATCCCCACTGACCAGCAT

*ZEBOV, Ebola Zaire virus; SEBOV, Ebola Sudan virus; MARV, Marburg virus; LASV, Lassa virus; RVFV, Rift Valley fever virus; CCHV, Crimean-Congo hemorrhagic fever virus; HNTV, Hantaan virus; SEOV, Seoul virus; YFV, yellow fever virus; KFDV, Kyasanur Forest disease virus; fwd, forward; rev, reverse.
†Primers were designed on Lassa lineage IV sequences () and the recently identified outlier sequence Lassa AV (AF256121).

*ZEBOV, Ebola Zaire virus; SEBOV, Ebola Sudan virus; MARV, Marburg virus; LASV, Lassa virus; RVFV, Rift Valley fever virus; CCHV, Crimean-Congo hemorrhagic fever virus; HNTV, Hantaan virus; SEOV, Seoul virus; YFV, yellow fever virus; KFDV, Kyasanur Forest disease virus; fwd, forward; rev, reverse.
†Primers were designed on Lassa lineage IV sequences () and the recently identified outlier sequence Lassa AV (AF256121). Because only released mass tags are analyzed, staggering the size of amplification products created in multiplex reactions is unnecessary; thus, primers are selected for efficient and consistent performance irrespective of amplicon size (typically 80–200 bp). Before committing to synthesis of tagged primers, the functionality of candidate multiplex primer panels is examined in a series of amplification reactions that use prototype templates representing individual microbial targets. Primers that fail to yield a single, specific product band in agarose gel analysis are replaced. Target sequence standards for evaluation are cloned into pCR2.1-TOPO (Invitrogen, Carlsbad, CA, USA) by using PCR amplification of cDNA templates obtained by reverse transcription (RT) of extracts from infected, cultured cells or by assembly of overlapping synthetic polynucleotides. The agents assayed in the VHF panel have RNA genomes; thus, assay sensitivity was determined by using synthetic RNA standards. Synthetic RNA standards were generated from linearized target sequence plasmids by using T7 polymerase (mMessage mMachine, Invitrogen). After quantitation by UV spectrometry, RNA was serially diluted in 2.5 μg/mL yeast tRNA (Sigma, St. Louis, MO, USA), reverse transcribed with random hexamers by using Superscript II (Invitrogen), and analyzed by MassTag PCR as previously described (). QIAquick 96 PCR purification cartridges (Qiagen, Hilden, Germany, with modified binding and wash buffers) were used to remove unincorporated primers before tags were decoupled from amplification products by UV photolysis in a flow cell and analyzed in a quadrapole mass spectrometer by using positive-mode atmospheric pressure chemical ionization (APCI-MS, Agilent Technologies, Palo Alto, CA, USA). The sensitivity of the 10-plex VHF panel with synthetic RNA standards was <50 RNA copies per assay (Table 2). Sensitivity and specificity of multiplex primer panels is assessed empirically by using calibrated synthetic standards as well as tissue culture–derived viral nucleic acid for each assembled panel.
Table 2

Sensitivity of detection with synthetic RNA standards

Pathogen*Detection threshold (RNA copies)†
ZEBOV20
SEBOV20
MARV20
LASV20
RVFV20
CCHFV50
HNTV20
SEOV50
YFV20
KFDV20

*ZEBOV, Ebola Zaire virus; SEBOV, Ebola Sudan virus; MARV, Marburg virus; LASV, Lassa virus; RVFV, Rift Valley fever virus; CCHV, Crimean-Congo hemorrhagic fever virus; HNTV, Hantaan virus; SEOV, Seoul virus; YFV, yellow fever virus; KFDV, Kyasanur Forest disease virus.
†RNA copies refers to the number of molecules subjected to reverse transcription; half of the reverse transcription reaction was then used for polymerase chain reaction amplification.

*ZEBOV, Ebola Zaire virus; SEBOV, Ebola Sudan virus; MARV, Marburg virus; LASV, Lassa virus; RVFV, Rift Valley fever virus; CCHV, Crimean-Congo hemorrhagic fever virus; HNTV, Hantaan virus; SEOV, Seoul virus; YFV, yellow fever virus; KFDV, Kyasanur Forest disease virus.
†RNA copies refers to the number of molecules subjected to reverse transcription; half of the reverse transcription reaction was then used for polymerase chain reaction amplification. Tissue culture extracts were used to examine assay specificity. Random primed cDNA obtained from cultures of ZEBOV, SEBOV, MARV, YFV isolates from the Gambia and Côte d’Ivoire, RVFV, CCHFV, HTNV, SEOV, and LASV strains Josiah, NL, and AV were subjected to mass tag analysis. In all instances, only the appropriate cognate mass tags were detected (data not shown). No spurious signal was identified in assays with water or RNA controls. Performance with clinical materials was tested by using blood, sera, or oral swabs from 24 human patients of VHF previously diagnosed through virus isolation, RT-PCR, or antigen detection enzyme-linked immunosorbent assay. Differential diagnosis by blinded MassTag PCR analysis was accurate in all cases (Table 3). For the samples from the 2005 Angola Marburg outbreak the result of MassTag PCR was similar to that of diagnostic single-plex PCR. ZEBOV sample 5004, obtained on day 17 of illness when serologic test results were positive for immunoglobulin M (IgM) and IgG, was negative by viral culture but positive in MassTag PCR.
Table 3

MassTag polymerase chain reaction analysis of clinical specimens from viral hemorrhagic fever patients*

Previous diagnosisSample identificationSample typeYear/originMassTag result†
ZEBOV5015Serum1995/Kikwit, DRC+++, ZEBOV
ZEBOV5014Serum1995/Kikwit, DRC+++, ZEBOV
ZEBOV5004Serum1995/Kikwit, DRC+++, ZEBOV
ZEBOV6317Serum1995/Kikwit, DRC+++, ZEBOV
ZEBOV6313Serum1995/Kikwit, DRC+++, ZEBOV
MARV246-00-5Hemolyzed whole blood2000/Durba, DRC+, MARV
MARV226-00-4Hemolyzed whole blood2000/Durba, DRC++, MARV
MARV246-00-7Hemolyzed whole blood2000/Durba, DRC+, MARV
MARV98-00-2Hemolyzed whole blood2000/Durba, DRC+++, MARV
MARV461Blood2005/Uige, Angola+++, MARV
MARV462Oral swab2005/Uige, Angola+++, MARV
MARV475Blood2005/Uige, Angola++, MARV
MARV476Oral swab2005/Uige, Angola+, MARV
LASV98-04-1Serum2004/Sierra Leone+++, LASV
LASV98-04Serum2004/Sierra Leone++, LASV
LASV98-04-5Serum2004/Sierra Leone+, LASV
LASV80-04-1Serum2004/Sierra Leone+++, LASV
RVFV98002009Serum1998/Kenya+, RVFV
RVFVH6061989Serum1998/Kenya+, RVFV
RVFV98002019Serum1998/Kenya++, RVFV
RVFV77-04Serum2004/Namibia++, RVFV
CCHFV187-86Serum1986/South Africa+, CCHFV
CCHFV30-93Serum1993/South Africa+++, CCHFV
CCHFV465-88Serum1988/South Africa+++, CCHFV
CCHFV407-89Serum1989/South Africa+++, CCHFV
CCHFV215-90Serum1990/South Africa++, CCHFV

*ZEBOV, Ebola Zaire virus; MARV, Marburg virus; LASV, Lassa virus; RVFV, Rift Valley fever virus; CCHV, Crimean-Congo hemorrhagic fever virus; DRC, Democratic Republic of Congo.
†Relative ranking of results: +, signal-to-noise ratio <4; ++, signal-to-noise ratio >4 and <8; +++, signal-to-noise ratio >8.

*ZEBOV, Ebola Zaire virus; MARV, Marburg virus; LASV, Lassa virus; RVFV, Rift Valley fever virus; CCHV, Crimean-Congo hemorrhagic fever virus; DRC, Democratic Republic of Congo.
†Relative ranking of results: +, signal-to-noise ratio <4; ++, signal-to-noise ratio >4 and <8; +++, signal-to-noise ratio >8.

Conclusions

These results confirm earlier work in respiratory diseases that show that MassTag PCR offers a rapid, sensitive, specific, and economic approach to differential diagnosis of infectious diseases. Small, low-cost, or mobile APCI-MS units extend the applicability of this technique beyond selected reference laboratories. Given the capacity of the method to code for up to 32 genetic targets, we are expanding the hemorrhagic fever panel to include additional viruses (dengue and South American hemorrhagic fever viruses) and are exploring the inclusion of bacterial and parasitic agents that may result in similar clinical signs and symptoms and, thus, have to be considered in differential diagnosis.
  15 in total

Review 1.  Junin virus vaccines.

Authors:  D A Enria; J G Barrera Oro
Journal:  Curr Top Microbiol Immunol       Date:  2002       Impact factor: 4.291

Review 2.  Molecular diagnostics of viral hemorrhagic fevers.

Authors:  Christian Drosten; Beate M Kümmerer; Herbert Schmitz; Stephan Günther
Journal:  Antiviral Res       Date:  2003-01       Impact factor: 5.970

3.  Crimean-Congo hemorrhagic fever in Eastern Turkey: clinical features, risk factors and efficacy of ribavirin therapy.

Authors:  Zulal Ozkurt; Ilhami Kiki; Serpil Erol; Fuat Erdem; Neziha Yilmaz; Mehmet Parlak; Mehmet Gundogdu; Mehmet A Tasyaran
Journal:  J Infect       Date:  2005-06-13       Impact factor: 6.072

Review 4.  Role of the endothelium in viral hemorrhagic fevers.

Authors:  Clarence J Peters; Sherif R Zaki
Journal:  Crit Care Med       Date:  2002-05       Impact factor: 7.598

5.  Prospective, double-blind, concurrent, placebo-controlled clinical trial of intravenous ribavirin therapy of hemorrhagic fever with renal syndrome.

Authors:  J W Huggins; C M Hsiang; T M Cosgriff; M Y Guang; J I Smith; Z O Wu; J W LeDuc; Z M Zheng; J M Meegan; Q N Wang
Journal:  J Infect Dis       Date:  1991-12       Impact factor: 5.226

6.  Field evaluation of formalin inactivated Kyasanur forest disease virus tissue culture vaccine in three districts of Karnataka state.

Authors:  C N Dandawate; G B Desai; T R Achar; K Banerjee
Journal:  Indian J Med Res       Date:  1994-04       Impact factor: 2.375

7.  Antiviral treatment of Argentine hemorrhagic fever.

Authors:  D A Enria; J I Maiztegui
Journal:  Antiviral Res       Date:  1994-01       Impact factor: 5.970

Review 8.  Hemorrhagic fever viruses as biological weapons: medical and public health management.

Authors:  Luciana Borio; Thomas Inglesby; C J Peters; Alan L Schmaljohn; James M Hughes; Peter B Jahrling; Thomas Ksiazek; Karl M Johnson; Andrea Meyerhoff; Tara O'Toole; Michael S Ascher; John Bartlett; Joel G Breman; Edward M Eitzen; Margaret Hamburg; Jerry Hauer; D A Henderson; Richard T Johnson; Gigi Kwik; Marci Layton; Scott Lillibridge; Gary J Nabel; Michael T Osterholm; Trish M Perl; Philip Russell; Kevin Tonat
Journal:  JAMA       Date:  2002-05-08       Impact factor: 56.272

9.  Genetic diversity among Lassa virus strains.

Authors:  M D Bowen; P E Rollin; T G Ksiazek; H L Hustad; D G Bausch; A H Demby; M D Bajani; C J Peters; S T Nichol
Journal:  J Virol       Date:  2000-08       Impact factor: 5.103

10.  Lassa fever. Effective therapy with ribavirin.

Authors:  J B McCormick; I J King; P A Webb; C L Scribner; R B Craven; K M Johnson; L H Elliott; R Belmont-Williams
Journal:  N Engl J Med       Date:  1986-01-02       Impact factor: 91.245

View more
  22 in total

Review 1.  Microbe hunting.

Authors:  W Ian Lipkin
Journal:  Microbiol Mol Biol Rev       Date:  2010-09       Impact factor: 11.056

2.  Rapid molecular strategy for filovirus detection and characterization.

Authors:  Junhui Zhai; Gustavo Palacios; Jonathan S Towner; Omar Jabado; Vishal Kapoor; Marietjie Venter; Allen Grolla; Thomas Briese; Janusz Paweska; Robert Swanepoel; Heinz Feldmann; Stuart T Nichol; W Ian Lipkin
Journal:  J Clin Microbiol       Date:  2006-11-01       Impact factor: 5.948

3.  Detection of tick-borne pathogens by MassTag polymerase chain reaction.

Authors:  Rafal Tokarz; Vishal Kapoor; James E Samuel; Donald H Bouyer; Thomas Briese; W Ian Lipkin
Journal:  Vector Borne Zoonotic Dis       Date:  2009-04       Impact factor: 2.133

4.  A novel picornavirus associated with gastroenteritis.

Authors:  Linlin Li; Joseph Victoria; Amit Kapoor; Olga Blinkova; Chunlin Wang; Farbod Babrzadeh; Carl J Mason; Prativa Pandey; Hinda Triki; Olfa Bahri; Bamidele Soji Oderinde; Marycelin Mandu Baba; David Nadeba Bukbuk; John M Besser; Joanne M Bartkus; Eric L Delwart
Journal:  J Virol       Date:  2009-09-16       Impact factor: 5.103

Review 5.  An ecological and conservation perspective on advances in the applied virology of zoonoses.

Authors:  Kurt J Vandegrift; Nina Wale; Jonathan H Epstein
Journal:  Viruses       Date:  2011-04-15       Impact factor: 5.818

Review 6.  Viral hemorrhagic fevers: advancing the level of treatment.

Authors:  Giuseppe Ippolito; Heinz Feldmann; Simone Lanini; Francesco Vairo; Antonino Di Caro; Maria Rosaria Capobianchi; Emanuele Nicastri
Journal:  BMC Med       Date:  2012-03-29       Impact factor: 8.775

7.  Multiplex MassTag-PCR for respiratory pathogens in pediatric nasopharyngeal washes negative by conventional diagnostic testing shows a high prevalence of viruses belonging to a newly recognized rhinovirus clade.

Authors:  Samuel R Dominguez; Thomas Briese; Gustavo Palacios; Jeffrey Hui; Joseph Villari; Vishal Kapoor; Rafal Tokarz; Mary P Glodé; Marsha S Anderson; Christine C Robinson; Kathryn V Holmes; W Ian Lipkin
Journal:  J Clin Virol       Date:  2008-10       Impact factor: 3.168

8.  Panmicrobial oligonucleotide array for diagnosis of infectious diseases.

Authors:  Gustavo Palacios; Phenix-lan Quan; Omar J Jabado; Sean Conlan; David L Hirschberg; Yang Liu; Junhui Zhai; Neil Renwick; Jeffrey Hui; Hedi Hegyi; Allen Grolla; James E Strong; Jonathan S Towner; Thomas W Geisbert; Peter B Jahrling; Cornelia Büchen-Osmond; Heinz Ellerbrok; Maria Paz Sanchez-Seco; Yves Lussier; Pierre Formenty; M Stuart T Nichol; Heinz Feldmann; Thomas Briese; W Ian Lipkin
Journal:  Emerg Infect Dis       Date:  2007-01       Impact factor: 6.883

9.  Serotype analysis of Streptococcus pneumoniae in lung and nasopharyngeal aspirates from children in the Gambia by MassTag PCR.

Authors:  Rafal Tokarz; Thomas Briese; Gerard Morris; Readon Ideh; Osaretin Chimah; Bernard Ebruke; Aaloki Desai; Saddef Haq; Stephen Sameroff; Stephen R C Howie; W Ian Lipkin
Journal:  J Clin Microbiol       Date:  2012-12-19       Impact factor: 5.948

10.  A framework for the study of zoonotic disease emergence and its drivers: spillover of bat pathogens as a case study.

Authors:  James L N Wood; Melissa Leach; Linda Waldman; Hayley Macgregor; Anthony R Fooks; Kate E Jones; Olivier Restif; Dina Dechmann; David T S Hayman; Kate S Baker; Alison J Peel; Alexandra O Kamins; Jakob Fahr; Yaa Ntiamoa-Baidu; Richard Suu-Ire; Robert F Breiman; Jonathan H Epstein; Hume E Field; Andrew A Cunningham
Journal:  Philos Trans R Soc Lond B Biol Sci       Date:  2012-10-19       Impact factor: 6.237

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.