Irene A Chen1, Kourosh Salehi-Ashtiani, Jack W Szostak. 1. Howard Hughes Medical Institute, Department of Molecular Biology, Massachusetts General Hospital, Harvard Medical School, Boston, Massachusetts 02114, USA.
Abstract
We are engaged in a long-term effort to synthesize chemical systems capable of Darwinian evolution, based on the encapsulation of self-replicating nucleic acids in self-replicating membrane vesicles. Here, we address the issue of the compatibility of these two replicating systems. Fatty acids form vesicles that are able to grow and divide, but vesicles composed solely of fatty acids are incompatible with the folding and activity of most ribozymes, because low concentrations of divalent cations (e.g., Mg(2+)) cause fatty acids to precipitate. Furthermore, vesicles that grow and divide must be permeable to the cations and substrates required for internal metabolism. We used a mixture of myristoleic acid and its glycerol monoester to construct vesicles that were Mg(2+)-tolerant and found that Mg(2+) cations can permeate the membrane and equilibrate within a few minutes. In vesicles encapsulating a hammerhead ribozyme, the addition of external Mg(2+) led to the activation and self-cleavage of the ribozyme molecules. Vesicles composed of these amphiphiles grew spontaneously through osmotically driven competition between vesicles, and further modification of the membrane composition allowed growth following mixed micelle addition. Our results show that membranes made from simple amphiphiles can form vesicles that are stable enough to retain encapsulated RNAs in the presence of divalent cations, yet dynamic enough to grow spontaneously and allow the passage of Mg(2+) and mononucleotides without specific macromolecular transporters. This combination of stability and dynamics is critical for building model protocells in the laboratory and may have been important for early cellular evolution.
We are engaged in a long-term effort to synthesize chemical systems capable of Darwinian evolution, based on the encapsulation of self-replicating nucleic acids in self-replicating membrane vesicles. Here, we address the issue of the compatibility of these two replicating systems. Fatty acids form vesicles that are able to grow and divide, but vesicles composed solely of fatty acids are incompatible with the folding and activity of most ribozymes, because low concentrations of divalent cations (e.g., Mg(2+)) cause fatty acids to precipitate. Furthermore, vesicles that grow and divide must be permeable to the cations and substrates required for internal metabolism. We used a mixture of myristoleic acid and its glycerol monoester to construct vesicles that were Mg(2+)-tolerant and found that Mg(2+) cations can permeate the membrane and equilibrate within a few minutes. In vesicles encapsulating a hammerhead ribozyme, the addition of external Mg(2+) led to the activation and self-cleavage of the ribozyme molecules. Vesicles composed of these amphiphiles grew spontaneously through osmotically driven competition between vesicles, and further modification of the membrane composition allowed growth following mixed micelle addition. Our results show that membranes made from simple amphiphiles can form vesicles that are stable enough to retain encapsulated RNAs in the presence of divalent cations, yet dynamic enough to grow spontaneously and allow the passage of Mg(2+) and mononucleotides without specific macromolecular transporters. This combination of stability and dynamics is critical for building model protocells in the laboratory and may have been important for early cellular evolution.
The ability to evolve through the combined effects of inherited
variation and natural selection is the unifying principle of
biology. The most elementary cellular system capable of
Darwinian evolution requires two components: a self-replicating
informational molecule, such as an RNA polymerase ribozyme
(“replicase”), and a mechanism for spatial localization such as
compartmentalization. Without compartmentalization or some
other mechanism for restricting the diffusion of the genetic
material, a superior mutant replicase would act to propagate
unrelated sequences more efficiently, while having no effect
on its own fitness. The physical proximity of related sequences,
which can be readily maintained by the random segregation of
sequences within replicating compartments, is therefore necessary for the evolution of improved replicase activity through
natural selection.[51784pb00001−51784pb00006] Membranes provide the major mechanism
for compartmentalization in modern biology and also mediate
the chemical fluxes between the cell and its environment.To construct the simplest possible protocell, the membrane
boundary should be capable of growth and division without
complex biochemical machinery and should allow the entry of
ions and small substrates by passive diffusion. To have potential
prebiotic relevance, the membrane should also be formed from
chemicals that can be synthesized abiotically. Fatty acids are
simple amphiphiles that form bilayer membrane vesicles when
the solution pH is near the apparent pKa of the membrane-incorporated fatty acid.[51784pb00007,51784pb00008] They can be synthesized under a
variety of conditions,[51784pb00009,51784pb00010] including simulated hydrothermal vent
chemistry,[51784pb00012] and have been detected in carbonaceous chondrite
meteorites.[51784pb00013,51784pb00014] Clay surfaces that catalyze RNA polymerization
also promote the self-assembly of fatty acid micelles into
vesicles, suggesting a route for enhancing RNA encapsulation
by colocalizing vesicles and RNA.[51784pb00015,51784pb00016]In addition to their chemical simplicity, fatty acid membranes
have dynamic properties that are not exhibited by phospholipid
membranes. For example, fatty acid vesicles show autocatalytic
growth,[51784pb00017,51784pb00018] and they can undergo repeated cycles of growth
and division in the laboratory.[51784pb00016] These vesicles can also exhibit
a primitive form of competition for limited resources, as vesicles
encapsulating a high concentration of RNA grow larger at the
expense of empty vesicles; this is referred to below as the
exchange pathway for growth.[51784pb00019] Under certain conditions,
growth can drive the formation of a transmembrane pH gradient,
thereby storing energy for several hours.[51784pb00020] These protocellular
behaviors are facilitated by the fast time scales of monomer−micelle−vesicle transitions and the relatively small energetic
barriers between these phases,[51784pb00021] as compared to phospholipid
membranes, which do not share these dynamic properties.The major disadvantage of using fatty acid membranes to
build protocells is their instability under the ionic conditions
necessary for catalytic RNA activity. For example, decanoic
acid vesicles aggregate at moderate concentrations of monovalent ions (∼0.2 M NaCl), and divalent cations cause aggregation
and precipitation even at quite low concentrations (<1.5 mM
MgCl2, or 1:65 ratio of cation to lipid).[51784pb00022] This is an important
problem because divalent cations are often required for the
formation of tertiary contacts in RNA folding and also commonly participate directly in the catalytic mechanism.[51784pb00023,51784pb00024]
Consequently, the activity of many ribozymes, such as the
hammerhead ribozyme, is highly dependent on divalent cation
concentration.[51784pb00025,51784pb00026] For a protocell to use RNA-based biochemistry, vesicle membranes must be stable under conditions
enabling ribozyme activity. We therefore sought to encapsulate
catalytically active RNA in simple vesicles that were stable and
capable of growth.The addition of fatty acidglycerol esters stabilizes fatty acid
vesicles in the presence of ionic solutes.[51784pb00022,51784pb00027] Although a variety
of cations can be utilized by ribozymes, we focused on Mg2+
because of its common use by ribozymes and its abundance on
the earth, particularly in seawater. We characterized the growth
properties, Mg2+ tolerance, and Mg2+ permeability of such
mixed composition vesicles. By varying the composition of
mixed vesicles, we were able to increase the tolerance of vesicles
to Mg2+ and to demonstrate that Mg2+ could rapidly enter
vesicles by passive diffusion. Remarkably, the presence of Mg2+
increased the permeability of the membrane to small, negatively
charged solutes such as nucleotides. On the other hand, vesicle
growth by the exchange pathway was slowed, and vesicle
growth following micelle addition was only possible after further
modification of the membrane composition. Finally, we encapsulated a hammerhead ribozyme in mixed vesicles and showed
that the ribozyme is active under conditions consistent with
vesicle stability and growth.
Materials and Methods
Materials. Myristoleic acid (C14:1) and glycerol 1-monomyristoleate
(i.e., monomyristolein, the glycerol ester of myristoleic acid) were
purchased from NuChek Prep (Elysian, MN). Pyrene was from Fluka
(Buchs SG, Switzerland); N-(7-nitrobenz-2-oxa-1,3-diazol-4-yl)-1,2-dihexadecanoyl-sn-glycero-3-phosphoethanolamine (NBD-PE), Lissamine rhodamine B 1,2-dihexadecanoyl-sn-glycero-3-phosphoethanolamine (Rh-DHPE), calcein, and mag-fura-2 (tetrapotassium salt) were
from Molecular Probes (Eugene, OR). GlycoBlue was purchased from
Ambion, Inc. (Austin, TX), and RNasin was from Promega (Madison,
WI). RNA labeled with fluorescein (5‘-6-FAM-AAAAAAAAAA-3‘)
was synthesized at the W. M. Keck Facility at Yale University. All
other chemicals were purchased from Sigma-Aldrich (St. Louis, MO).Preparation of Micelles and Vesicles. Micelles were prepared by
dissolving neat myristoleic acid oil in 1 equiv of NaOH solution (80
mM), as described.[51784pb00016] Vesicles 100 nm in diameter were prepared by
resuspending 1 equiv of the oil in 0.2 M bicine buffer, pH 8.5, to which
0.5 equiv of NaOH had been added (resulting in a final pH of 8.5).
Resuspension was followed by several freeze−thaw cycles and extrusion to 100 nm diameter using the Mini-Extruder system (Avanti Polar
Lipids, Inc.), as described.[51784pb00020] Mixed composition micelles and vesicles
were prepared by mixing the appropriate neat oils before resuspension.
Mixed micelles were used within 10 min of preparation. Vesicles
labeled by the FRET dyes (NBD-PE and Rh-DHPE) were prepared by
mixing the dyes with fatty acid/ester in methanol, and then removing
the solvent by rotary evaporation before resuspension.[51784pb00019]Encapsulation of RNA or water-soluble fluorescent dyes was
achieved by mixing the solute with the resuspension buffer before
adding the oil. Vesicles were purified from unencapsulated solutes on
a gravity-flow size exclusion column (Sepharose 4B). The fluorescent
dyes (≤1 kD) and RNA (19 kD) used in these experiments elute at the
low molecular weight range of the resin (30 kD), while vesicles (100
nm in diameter) elute with the void volume. Purification and dilution
buffers contained a concentration of amphiphiles approximately equal
to the critical aggregate concentration, to avoid disintegration of the
vesicles.Vesicle Growth. Vesicles labeled with FRET dyes were diluted to
∼3 mM amphiphile and added to a cuvette. Growth from addition of
micelles was initiated by adding micelles from an 80 mM stock solution,
with mixing by pipetting for ∼5 s. FRET was measured using the
fluorescence ratio between donor (λem 530 nm) and acceptor (λem 586
nm) dyes, with excitation at 430 nm, as described.[51784pb00016] To convert FRET
signal into relative surface area, a standard curve was prepared for each
vesicle composition (Figures S1, S2). Growth by intermembrane transfer
of amphiphiles from empty vesicles to vesicles encapsulating tRNA
was performed as described previously,[51784pb00019] with the addition of 3.2 mM
MgCl2 to the reaction buffer containing 2 mM amphiphile. The
concentration of free Mg2+ in this solution was 2 mM, as measured by
mag-fura-2 fluorescence.Dye Leakage Assay. Extruded vesicles encapsulating calcein or 3H-UMP were added to a small volume of a stock solution of MgCl2 (100
mM) to achieve the desired concentration of Mg2+. To determine the
extent of dye leakage, vesicles were separated from free dye by size-exclusion chromatography as described above. The integrated fluorescence intensity of each peak was determined by summing the
fluorescence intensity of the fractions, as measured on a SpectraMax
Gemini EM (Molecular Devices). For vesicles of this size (∼100 nm),
the concentration of vesicles was low enough (<10 mM lipid) to avoid
effects on the fluorescence from turbidity. Levels of free dye >6%
were reliably detectable as leakage. Radioactivity was measured on a
Beckman LS 6500 scintillation counter. For time courses, the percent
of free dye in the initial time point was used as the background and
subtracted from subsequent time points. Calcein fluorescence was
measured at λex 415 nm, λem 600 nm; when appropriate, values were
corrected for self-quenching using a standard curve.[51784pb00016] Initial rates of
leakage were determined by fitting a straight line to the data for leakage
over time.Mg Assays. Free Mg2+ concentration was measured using the
fluorescent probe mag-fura-2. Mg2+ concentration was related to the
ratio of the fluorescence intensity at λex 340 nm and λex 370 nm (at
constant λem 500 nm) through a standard curve prepared with varying
concentrations of MgCl2 in 0.2 M bicine, pH 8.5. To determine Mg2+
permeability, vesicles containing encapsulated mag-fura-2 were diluted
to 4 mM amphiphile and mixed by stopped-flow with 1/25 volume of
50 mM MgCl2 (final [Mg2+] = 2 mM), as described.[51784pb00021] Because the
counter-transport of Na+, required for charge neutrality, is fast relative
to the transport of Mg2+,[51784pb00020] the Mg2+ permeability coefficient was
calculated by P = k*V/A, where k is the first-order rate constant, and
V and A are the volume and surface area of the vesicle, respectively.Characterization of Aggregates and Vesicles. Hydrodynamic
diameter was estimated by dynamic light scattering, as described.[51784pb00016] The
pyrene excimer/monomer ratio was determined from the ratio of
fluorescence intensity at λem 374 nm (monomer) and λem 470 nm
(excimer), as described.[51784pb00021] Amphiphile samples were prepared with 0.5
mol % pyrene.Hammerhead Ribozyme RNA. The transcription template for the
hammerhead ribozyme N15min7 (5‘- GGGACGCAGTTTCGCTTAGCTCATCAGAGTAAATTCCTTTCGGAATTTAC TGACTGCGT-CCCTATAGTGAGTCGTATTACAGATC-3‘) was PCR amplified
using the primers (5‘-GATCTGTAATACGACTCAC-3‘ and 5‘-GGGACGCAGTTTCGCTTAG-3‘) for 20 cycles. The PCR product was
purified using agarose gel electrophoresis, ethanol precipitated, dissolved, and stored in 10 mM Tris-Cl, pH 8.5.RNA was transcribed from double-stranded N15min7 template by
T7 RNA polymerase in a solution containing 0.5 mM NTPs, ∼20 μCi
α-32P-UTP, 40 mM Tris-HCl, pH 7.9, 6 mM MgCl2, 2 mM spermidine,
10 mM DTT, and 0.2 U/μL RNasin. The reaction also included 25
μM of two oligonucleotides complementary to the ribozyme sequence,
to block ribozyme self-cleavage during transcription (5‘-TCGCTTAGCTCATCAG-3‘ and 5‘-GGAATTTACTGACTGC-3‘).[51784pb00028] Transcribed RNA was purified by denaturing PAGE, ethanol precipitated,
dissolved in water, and stored at −80 °C.Hammerhead Ribozyme Assay. Cleavage reactions were begun
by the addition of MgCl2. The reaction was stopped at each time point
by removing an aliquot and adding 1.1−2.3 volumes of 10 mM Tris-Cl, pH 7.5, containing 3−14 mM EDTA. For encapsulated reactions,
the amphiphile concentration was ∼15 mM and the RNA concentration
was 40−300 nM (less than one molecule per vesicle on average).
Vesicles were disrupted by the addition of 0.3% Triton X-100, and the
RNA was precipitated in 0.3 M sodium acetate, pH 7, 73% ethanol,
with 10 μg of GlycoBlue. Pellets were resuspended in formamide
loading buffer and resolved by denaturing PAGE. Cleavage products
were quantitated by phosphorimage analysis of the dried gel. The extent
of cleavage observed before addition of MgCl2 (t = 0) was subtracted
from subsequent time points.Fluorescence Microscopy. Vesicles were prepared by mixing MA:GMM:dodecane (2:1:0.3) oil with buffer consisting of 0.2 M bicine,
pH 8.5, 3 mM MgCl2, and 40 nM N15min7 (final amphiphile
concentration = 20 mM). Vesicle suspensions were allowed to
equilibrate for at least 1 h before staining with 10 mM Rhodamine 6G
(λmax,ex = 528 nm; λmax,em = 551 nm) for microscopy. Conventional
epifluorescence images were collected using a Zeiss Axioplan 2
microscope (100× objective lens; rhodamine filter). Confocal images
were collected using a Leica TCS SP confocal laser scanning
microscope equipped with Ar, Ar−Kr, and He−Ne lasers (100×
objective lens; 514 nm laser line).
Results and Discussion
Effect of Mg on the Stability and Permeability of Simple
Vesicles. We assessed the stability of vesicles composed of
myristoleic acid (MA) and glycerol monomyristoleate (GMM)
in the presence of Mg2+ by monitoring the retention of
encapsulated dye and macroscopic turbidity changes. Pure MA
vesicles showed low Mg2+ tolerance, but vesicles of mixed
composition, MA:GMM (2:1), showed increased stability in the
presence of Mg2+, as previously reported on the basis of light
microscopy.[51784pb00022] An intermediate composition of MA:GMM (4:1) showed intermediate stability (Table 1). Higher proportions
of GMM led to the appearance of oil droplets mixed with
vesicles.
Table 1
MgCl2 Tolerance of Simple Vesicles
MA:GMM
ratio
[MgCl2]
tolerated,
assayed by
dye leakagea
(mM)
[MgCl2] at
turbidity
changeb
(mM)
1:0
0.5
1
4:1
2
3
2:1
4
6
Dye leakage was assessed <1 h after addition of MgCl2, and onset of
leakage defined the maximum [MgCl2] tolerated. Turbidity change was
visible as a sudden increase in the opacity of the solution.
MgCl2 Tolerance of Simple VesiclesDye leakage was assessed <1 h after addition of MgCl2, and onset of
leakage defined the maximum [MgCl2] tolerated. Turbidity change was
visible as a sudden increase in the opacity of the solution.To determine whether vesicles exposed to relatively high
concentrations of MgCl2 are only transiently destabilized by the
sudden addition of MgCl2, we followed the leakage of encapsulated calcein over time. Dye leakage continued to increase
over the course of at least 1 day (Figure 1A,B), indicating that
the vesicles remained permeabilized throughout the experiment.
The initial rate of dye leakage from MA:GMM (2:1) vesicles
increased by a factor of 27 in the presence of 4 mM Mg2+. To
determine whether this enhanced permeability was due to large-scale membrane destabilization by Mg2+, we encapsulated a
fluorescently labeled RNA decamer in vesicles exposed to 4
mM Mg2+. We expected that large-scale membrane defects
would cause RNA leakage at a rate similar to small molecule
leakage, but no RNA leakage was detected after 19 h (Figure
1C). 3H-UMP showed a 4-fold permeability enhancement in
the presence of 4 mM Mg2+ (Figure 1D). Thus, exposure to
Mg2+ increased the permeability of an RNA mononucleotide
but not of RNA itself, perhaps by neutralizing the negative
charge and/or stabilizing the interaction between the solute and
small-scale transient defects in the membrane.[51784pb00029] Even so, more
than 95% of encapsulated calcein was retained in MA:GMM
(2:1) vesicles for at least 3 h. This is much longer than the
hammerhead ribozyme cleavage reactions described below,
which were completed within a few minutes.
Figure 1
Leakage from MA:GMM vesicles (2:1) in 0.2 M bicine, pH 8.5, 4 mM MgCl2. (A) Vesicles were initially purified away from
unencapsulated calcein, and dye leakage was measured over time with (blue)
or without (black) the addition of 4 mM MgCl2. (B) Calcein leakage assayed
by size-exclusion chromatography after 22 h in the presence of 4 mM
MgCl2. (C) RNA leakage assayed by size-exclusion chromatography after
19 h, with (red) or without (black) the addition of 4 mM MgCl2. (D) Vesicles
encapsulating 0.1 mM 5‘-UMP and a trace amount of 3H-UMP were initially
purified, and then leakage of 3H-UMP was measured over time, with (red)
or without (black) the addition of 4 mM MgCl2.
Leakage from MA:GMM vesicles (2:1) in 0.2 M bicine, pH 8.5, 4 mM MgCl2. (A) Vesicles were initially purified away from
unencapsulated calcein, and dye leakage was measured over time with (blue)
or without (black) the addition of 4 mM MgCl2. (B) Calcein leakage assayed
by size-exclusion chromatography after 22 h in the presence of 4 mM
MgCl2. (C) RNA leakage assayed by size-exclusion chromatography after
19 h, with (red) or without (black) the addition of 4 mM MgCl2. (D) Vesicles
encapsulating 0.1 mM 5‘-UMP and a trace amount of 3H-UMP were initially
purified, and then leakage of 3H-UMP was measured over time, with (red)
or without (black) the addition of 4 mM MgCl2.Because we wished to eventually measure the activity of
encapsulated RNA, we also determined the permeability of
Mg2+ through the vesicle membrane. We encapsulated mag-fura-2,[51784pb00030] a magnesium-sensitive fluorescent dye (Figure 2A),
in MA:GMM vesicles (2:1) and added MgCl2 using a stopped-flow device. The internal concentration of Mg2+ equilibrated
within several seconds (permeability coefficient = 2 × 10-7
cm/s) to 1.4 mM, a concentration lower than the added
concentration (2 mM; Figure 2B). Because MA is partially
negatively charged at pH 8.5, it may associate with Mg2+,
thereby reducing the amount of free Mg2+ detected by the mag-fura-2 dye. Using size-exclusion chromatography, we verified
that <5% of encapsulated mag-fura-2 leaked from vesicles after
30 min of exposure to 2 mM Mg2+ (Figure 2C), consistent with
the results obtained for calcein leakage. When we mixed
phospholipid (POPC) vesicles with MgCl2, we saw no detectable
change in the internal Mg2+ concentration over several hours
(Figure 2D), demonstrating that equilibration of both Mg2+ and
mag-fura-2 across POPC membranes is quite slow.
Figure 2
Mg2+ permeability in MA:GMM vesicles (2:1). (A) Standard
curve of mag-fura-2 fluorescence ratio as a function of [Mg2+] in 0.2 M
bicine, pH 8.5. The solid line is a linear regression fit. MgCl2 was added to
a final concentration of 2 mM, by stopped-flow mixing, to MA:GMM (2:1) vesicles (B) or POPC vesicles (D) encapsulating mag-fura-2. The internal
concentration of Mg2+ at each time point was calculated from the standard
curve. The solid line (B) indicates a curve fit to a single-exponential
equation, where k = 0.11 s-1. (C) Size-exclusion chromatography shows
that no mag-fura-2 dye has leaked out of the MA:GMM vesicles after
equilibration of Mg2+.
Mg2+ permeability in MA:GMM vesicles (2:1). (A) Standard
curve of mag-fura-2 fluorescence ratio as a function of [Mg2+] in 0.2 M
bicine, pH 8.5. The solid line is a linear regression fit. MgCl2 was added to
a final concentration of 2 mM, by stopped-flow mixing, to MA:GMM (2:1) vesicles (B) or POPC vesicles (D) encapsulating mag-fura-2. The internal
concentration of Mg2+ at each time point was calculated from the standard
curve. The solid line (B) indicates a curve fit to a single-exponential
equation, where k = 0.11 s-1. (C) Size-exclusion chromatography shows
that no mag-fura-2 dye has leaked out of the MA:GMM vesicles after
equilibration of Mg2+.Growth of Mg-Tolerant Vesicles. Although the addition
of GMM to MA vesicles increased their tolerance for Mg2+,
we suspected that the increase in the stability of the vesicles
might come at the expense of dampened dynamic behaviors,
such as growth, that rely on the rapid insertion and dissociation
of molecules from the membrane. Growth of the surface area
of vesicles can be monitored using nonexchanging FRET dyes,
whose fluorescence depends on the surface density of the
dyes.[51784pb00016,51784pb00031,51784pb00032] We have previously studied the growth of osmotically swollen vesicles due to intermembrane transfer of amphiphiles from empty vesicles. While transfer was slower in
MA:GMM (2:1) membranes, the total amount of transfer was
comparable in MA:GMM (2:1) and pure fatty acid membranes.[51784pb00019]
To determine whether Mg2+ affected the intermembrane transfer
of amphiphiles, we measured the transfer between MA:GMM
(2:1) vesicles (2 mM amphiphile) in the presence of 3.2 mM
MgCl2 (2 mM free Mg2+). The rate (k = 0.05 min-1) and
amount of transfer (28%) were not substantially affected by the
presence of Mg2+.Another way to achieve vesicle growth is by the addition of
micelles, prepared at high pH, to preformed vesicles buffered
at pH 8.5. When 0.5 equiv of pure fatty acid in micelle form is
rapidly added to preformed vesicles, the surface area of
preformed vesicles grows by ∼50%, indicating a very high yield
of incorporation.[51784pb00016,51784pb00021] In contrast, 4:1 MA:GMM vesicles showed
only ∼35% growth upon addition of 0.5 equiv of micelles of
the same composition. Dynamic light scattering (DLS) indicated
that MA:GMM (4:1) micelle solutions contained particles ∼30
nm in diameter, much larger than pure fatty acid micelles
(diameter = 3 nm).[51784pb00020] Aggregation can also be detected by the
excimer/monomer ratio of the hydrophobic dye pyrene when
present at low molar ratio (∼1:200). When dissolved in small
micelles, pyrene is distributed among the separate volumes and
exists primarily as a monomer. However, lipidaggregation
allows multiple pyrene molecules to share a contiguous volume,
forming excimers with a red-shifted fluorescence emission
spectrum.[51784pb00033−51784pb00035] Consistent with the DLS data, pyrene fluorescence indicated the presence of large aggregates in MA:GMM
(4:1) micelles (Figure 3A).
Figure 3
Growth of mixed composition vesicles by micelle incorporation. (A) Pyrene fluorescence shifts from monomer to excimer if aggregates are present. Shown are the spectra of pyrene in pure MA micelles (green), pure MA vesicles (blue), and MA:GMM (4:1) micelles (red). (B) Growth of 2:1:0.3 MA:GMM:dodecane vesicles over time, after addition of 1 equiv of micelles, in 0.2 M bicine, pH 8.5, 1 mM MgCl2. Relative surface area
was determined using the FRET assay. The solid line indicates a curve fit
to a single-exponential equation, with k = 1.5 min-1. A similar yield was
obtained if 1 equiv of micelles was added at once or in up to five separate
aliquots.
Growth of mixed composition vesicles by micelle incorporation. (A) Pyrene fluorescence shifts from monomer to excimer if aggregates are present. Shown are the spectra of pyrene in pure MA micelles (green), pure MA vesicles (blue), and MA:GMM (4:1) micelles (red). (B) Growth of 2:1:0.3 MA:GMM:dodecane vesicles over time, after addition of 1 equiv of micelles, in 0.2 M bicine, pH 8.5, 1 mM MgCl2. Relative surface area
was determined using the FRET assay. The solid line indicates a curve fit
to a single-exponential equation, with k = 1.5 min-1. A similar yield was
obtained if 1 equiv of micelles was added at once or in up to five separate
aliquots.MA:GMM (2:1) vesicles, which had the greatest magnesium
tolerance, showed no growth when micelles of the same
composition were added, either rapidly or slowly over 4 h.
However, these vesicles were able to grow following the rapid
addition of pure fatty acid micelles. Thus, 2:1 MA:GMM
micelles (which are also large by the pyrene excimer assay and
by DLS) appeared to be unusually stable, perhaps due to the
large headgroup of GMM, which may stabilize areas of high
curvature in micellar aggregates and which would also provide
H-bond donors at high pH. To destabilize these micelles, we
added dodecane (9 mol %) to act as a hydrophobic spacer,
reducing the preferred curvature and decreasing the surface
charge density. The rapid addition of 0.5 equiv of 2:1:0.3 MA:GMM:dodecane micelles to vesicles of the same composition
resulted in ∼20% growth, and the rapid addition of 1 equiv of
micelles resulted in ∼40% growth (Figure 3B). The rate and
total amount of growth were similar in the presence or absence
of 1 mM free Mg2+.Ribozyme Activity in Simple Vesicles. We determined the
activity of a self-cleaving hammerhead ribozyme encapsulated
in MA:GMM:dodecane vesicles. The hammerhead ribozyme is
widespread in nature and also arises during in vitro selection
for self-cleaving RNAs.[51784pb00028,51784pb00036−51784pb00038] This ribozyme can catalyze both
cleavage and ligation of RNAs,[51784pb00039,51784pb00040] activities that may be
important for simple RNA-based replicating systems. Furthermore, because of its small size, the hammerhead ribozyme may
function robustly under error-prone replication conditions.[51784pb00041]
N15min7 is an artificially evolved 62 nucleotide hammerhead
ribozyme, which is cleaved into two fragments (11 and 51
nucleotides) in the presence of Mg2+.[51784pb00042]N15min7 was encapsulated in 2:1:0.3 MA:GMM:dodecane
vesicles during amphiphile resuspension. Multiple freeze−thaw
cycles, used to equilibrate vesicle formation, did not affect self-cleavage activity. The self-cleavage reaction was initiated by
adding MgCl2 (≤4 mM), and the extent of self-cleavage was
monitored as a function of time (Figure 4A,B). We found that
∼60% of the RNA was cleaved whether the ribozyme was
encapsulated or free in solution. The observed first-order rate
constant of the encapsulated reaction was reduced 4-fold as
compared to the unencapsulated reaction at both 1 and 4 mM
added MgCl2 (Table 2). As expected, the rate of the encapsulated
reaction in 4 mM added MgCl2 was ∼5-fold higher than that
in 1 mM added MgCl2.
Figure 4
Self-cleavage activity of the hammerhead ribozyme N15min7. The insets show phosphorimages of the assay gels. The top band corresponds to the uncleaved ribozyme; the bottom band is the cleavage product. (A) Unencapsulated ribozyme activity in 0.2 M bicine, pH 8.5, 4 mM MgCl2.
Time points, from left to right: 0 (no MgCl2), 0.2, 0.4, 0.6, 0.8, 1.1 min.
The solid line indicates a curve fit to a single-exponential equation, y =
a(1 − e), where the extent of cleavage a = 0.66, and the observed rate
constant k = 7.9 min-1. (B) Activity of ribozymes encapsulated in 2:1:0.3
MA:GMM:dodecane vesicles (∼15 mM amphiphile), in 0.2 M bicine, pH
8.5, 4 mM MgCl2. Time points, from left to right: 0 (no MgCl2), 0.33,
0.63, 1, 1.3, 1.7, 3, 4.7 min. Curve fit: a = 0.6, and k = 1.7 min-1. (C)
Size-exclusion chromatography of MA:GMM:dodecane vesicles shows that
all radiolabeled N15min7 RNA remained encapsulated 15 min after the
addition of MgCl2.
Table 2
Hammerhead Cleavage in Vesicles
[MgCl2]
(mM)
kunencapsulated
(min-1)
kencapsulated
(min-1)
1
1.3
0.4
4
7.9
1.7
Self-cleavage activity of the hammerhead ribozyme N15min7. The insets show phosphorimages of the assay gels. The top band corresponds to the uncleaved ribozyme; the bottom band is the cleavage product. (A) Unencapsulated ribozyme activity in 0.2 M bicine, pH 8.5, 4 mM MgCl2.
Time points, from left to right: 0 (no MgCl2), 0.2, 0.4, 0.6, 0.8, 1.1 min.
The solid line indicates a curve fit to a single-exponential equation, y =
a(1 − e), where the extent of cleavage a = 0.66, and the observed rate
constant k = 7.9 min-1. (B) Activity of ribozymes encapsulated in 2:1:0.3
MA:GMM:dodecane vesicles (∼15 mM amphiphile), in 0.2 M bicine, pH
8.5, 4 mM MgCl2. Time points, from left to right: 0 (no MgCl2), 0.33,
0.63, 1, 1.3, 1.7, 3, 4.7 min. Curve fit: a = 0.6, and k = 1.7 min-1. (C)
Size-exclusion chromatography of MA:GMM:dodecane vesicles shows that
all radiolabeled N15min7 RNA remained encapsulated 15 min after the
addition of MgCl2.Hammerhead Cleavage in VesiclesThis decreased rate of self-cleavage of the encapsulated
ribozyme may be partly due to the time scale of Mg2+
permeation into GMM-MA-dodecane vesicles (k ≈ 1 min-1),
particularly in 4 mM MgCl2. However, for the encapsulated
ribozyme in 1 mM MgCl2, the rate of Mg2+ entry is faster than
the observed self-cleavage, indicating that Mg2+ entry was not
the rate-limiting step in this case. The decrease in free Mg2+
concentration (Kd ≈ 10 mM amphiphile, considering both the
inner and the outer leaflets of the bilayer), as determined by
mag-fura-2 fluorescence, accounts for about one-half of the
observed decrease in rate. To confirm that the observed self-cleavage activity reflected encapsulated ribozyme, rather than
ribozyme adsorbed to the membrane, N15min7 RNA was added
to the exterior of vesicles after extrusion but before purification.
After purification by size-exclusion chromatography, these
preparations contained <3% of the radioactivity of the encapsulated reaction, indicating that only a small amount of RNA
was adsorbed to the membrane. We also used size-exclusion
chromatography to confirm that the ribozyme still co-purified
with vesicles after the self-cleavage reaction (Figure 4C).We confirmed that the 2:1:0.3 MA:GMM:dodecane mixture
formed vesicles in the presence of Mg2+ and RNA by
fluorescence microscopy before extrusion (Figure 5). DLS of
these vesicles after extrusion indicated an average particle
diameter of 65 nm, similar to the size of extruded vesicles made
from myristoleic acid alone.[51784pb00016] Furthermore, self-cleavage of
N15min7 was neither catalyzed nor inhibited by the presence
of vesicles alone. In the absence of Mg2+, no self-cleavage was
detected after 30 min, and the self-cleavage rate of unencapsulated N15min7 upon addition of Mg2+ was not affected by
the presence of vesicles.
Figure 5
Fluorescence microscopy of 2:1:0.3 MA:GMM:dodecane vesicles containing hammerhead ribozyme in the presence of 3 mM MgCl2, prior
to extrusion. Membranes were stained using Rhodamine 6G for visualization
by (A) epifluorescence or (B) laser scanning confocal microscopy. The
images shown are from different fields of view.
Fluorescence microscopy of 2:1:0.3 MA:GMM:dodecane vesicles containing hammerhead ribozyme in the presence of 3 mM MgCl2, prior
to extrusion. Membranes were stained using Rhodamine 6G for visualization
by (A) epifluorescence or (B) laser scanning confocal microscopy. The
images shown are from different fields of view.Hammerhead ribozymes vary greatly in their Mg2+ requirements. The [Mg2+]1/2 (concentration of Mg2+ corresponding to
half-maximal activity) of the N15 construct used in our studies
is ∼9 mM,[51784pb00042] and hammerhead ribozymes of biological origin
have even lower Mg2+ optima of <1 mM.[51784pb00043] Other complex
natural ribozymes that function under physiological conditions
(<1 mM) have evolved low Mg2+ requirements.[51784pb00044] For example,
the [Mg2+]1/2 for folding and catalysis of a number of self-splicing group I introns is ≤4 mM.[51784pb00045,51784pb00046] An RNA polymerase
ribozyme with a similarly low Mg2+ requirement could function
inside MA:GMM vesicles. However, currently available ribozymes with polymerase or ligase activity have much higher
Mg2+ requirements. For example, the class I ligase, discovered
by in vitro evolution in the presence of high concentrations of
Mg2+, has a [Mg2+]1/2 of 70−100 mM,[51784pb00047] as does a variant that
can catalyze limited RNA polymerization.[51784pb00048] The discrepancy
between the Mg2+ requirement of this ribozyme and the Mg2+
tolerance of the simple vesicles studied here suggests that
observing ribozyme polymerase activity inside vesicles that can
grow and divide may not be trivial in practice. Further
optimization of existing ribozymes, or isolation of new ones,
may yield RNA polymerases active at lower Mg2+ concentrations that could be compatible with the vesicles described here.
An independent reason for focusing on low to moderate Mg2+
concentrations is that high Mg2+ concentrations promote RNA
degradation.[51784pb00049] Mg2+-catalyzed RNA degradation is in fact
thought to limit the extent of polymerization obtainable by the
polymerase derived from the class I ligase.[51784pb00048]
Conclusions
We have shown that vesicles composed of chemically simple
amphiphiles can be stable, grow, and retain contents in the
presence of sufficient Mg2+ to activate encapsulated ribozymes.
Because these membranes, unlike phospholipid membranes, are
quite permeable to Mg2+, encapsulated ribozymes can be
activated by the external addition of Mg2+. Other RNA-catalyzed reactions, including RNA replication, may ultimately
be possible within similar vesicles, enabling the experimental
construction of evolvable protocells. The permeability of these
simple membranes to Mg2+ means that the internal Mg2+
concentration of a population of growing and dividing vesicles
could be maintained indefinitely, from generation to generation,
solely by passive trans-membrane diffusion in the absence of
permeases.Our experiments also illustrate that there are tradeoffs in the
search for conditions compatible with both RNA and vesicle
replication. While the addition of GMM confers stability on
MA vesicles, it also causes a decrease in the yield of growth
following micelle addition. This decrease could be partially
offset by the addition of another simple component, dodecane.
On the other hand, the yield of growth of osmotically swollen
vesicles was not affected by the addition of GMM.[51784pb00019] Indeed,
this mode of growth may be more likely to occur in natural
situations, because the source of lipid, empty vesicles, is the
same physical phase as the growing vesicles, readily permitting
their coexistence.An unexpected effect of Mg2+ was to increase the permeability of small, negatively charged solutes, including uridine
monophosphate. This effect would be advantageous to an
encapsulated replicating RNA that was polymerizing nucleic
acid monomers into longer strands of RNA. The increase in
monomer permeability might enhance polymerization, while the
polymeric product would continue to be retained.Many selective pressures are likely to have influenced the
evolution of the phospholipid membranes of modern biology,
which are much more stable to divalent cations and can maintain
pH and ionic gradients for long periods. However, the evolution
of such membranes would have required the co-evolution of
numerous ion and substrate-specific permeases, as well as the
biochemical machinery for membrane growth. Our results show
that membranes made from simple amphiphiles can be stable
enough to retain RNA, yet dynamic enough to grow and allow
the spontaneous entry of Mg2+ and mononucleotides. We are
continuing to search for membrane compositions with similar
dynamic properties, but greater tolerance to Mg2+ and possibly
Ca2+ (another abundant divalent cation on earth), as well as
ribozyme polymerases active at lower Mg2+ concentrations, with
the goal of observing RNA-catalyzed RNA synthesis within
model protocell vesicles.
Authors: Alessandro Groaz; Hossein Moghimianavval; Franco Tavella; Tobias W Giessen; Anthony G Vecchiarelli; Qiong Yang; Allen P Liu Journal: Wiley Interdiscip Rev Nanomed Nanobiotechnol Date: 2020-11-21