Literature DB >> 15752453

Diagnostic system for rapid and sensitive differential detection of pathogens.

Thomas Briese1, Gustavo Palacios, Mark Kokoris, Omar Jabado, Zhiqiang Liu, Neil Renwick, Vishal Kapoor, Inmaculada Casas, Francisco Pozo, Ron Limberger, Pilar Perez-Brena, Jingyue Ju, W Ian Lipkin.   

Abstract

Naturally emerging and deliberately released pathogens demand new detection strategies to allow early recognition and containment. We describe a diagnostic system for rapid, sensitive, multiplex discrimination of microbial gene sequences and report its application for detecting 22 respiratory pathogens in clinical samples.

Entities:  

Mesh:

Substances:

Year:  2005        PMID: 15752453      PMCID: PMC3320438          DOI: 10.3201/eid1102.040492

Source DB:  PubMed          Journal:  Emerg Infect Dis        ISSN: 1080-6040            Impact factor:   6.883


Efficient laboratory diagnosis of infectious diseases is increasingly important to clinical management and public health. Methods to directly detect nucleic acids of microbial pathogens in clinical specimens are rapid, sensitive, and may succeed when culturing the organism fails. Clinical syndromes are infrequently specific for single pathogens; thus, assays are needed that allow multiple agents to be simultaneously considered. Current multiplex assays employ gel-based formats in which products are distinguished by size, fluorescent reporter dyes that vary in color, or secondary enzyme hybridization assays. Gel-based assays are reported that detect 2–8 different targets with sensitivities of 2–100 PFU or <1–5 PFU, depending on whether amplification is carried out in a single or nested format, respectively (–). Fluorescence reporter systems achieve quantitative detection with sensitivity similar to that of nested amplification; however, their capacity to simultaneously query multiple targets is limited to the number of fluorescent emission peaks that can be unequivocally resolved. At present, up to 4 fluorescent reporter dyes can be detected simultaneously (,). Multiplex detection of up to 9 pathogens has been achieved in hybridization enzyme systems; however, the method requires cumbersome postamplification processing ().

The Study

To address the need for sensitive multiplex assays in diagnostic molecular microbiology, we created a polymerase chain reaction (PCR) platform in which microbial gene targets are coded by a library of 64 distinct Masscode tags (Qiagen Masscode technology, Qiagen, Hilden, Germany). A schematic representation of this approach is shown in Figure 1. Microbial nucleic acids (RNA, DNA, or both) are amplified by multiplex reverse transcription (RT)-PCR using primers labeled by a photocleavable link to molecular tags of different molecular weight. After removing unincorporated primers, tags are released by UV irradiation and analyzed by mass spectrometry. The identity of the microbe in the clinical sample is determined by its cognate tags.
Figure 1

Schematic representation of Mass Tag polymerase chain reaction (PCR).

Schematic representation of Mass Tag polymerase chain reaction (PCR). As a first test of this technology, we focused on respiratory disease because differential diagnosis is a common clinical challenge, with implications for outbreak control and individual case management. Multiplex primer sets were designed to identify up to 22 respiratory pathogens in a single Mass Tag PCR reaction; sensitivity was established by using synthetic DNA and RNA standards as well as titered viral stocks; the utility of Mass Tag PCR was determined in blinded analysis of previously diagnosed clinical specimens. Oligonucleotide primers were designed in conserved genomic regions to detect the broadest number of members for a given pathogen species by efficiently amplifying a 50- to 300-bp product. In some instances, we selected established primer sets; in others, we used a software program designed to cull sequence information from GenBank, perform multiple alignments, and maximize multiplex performance by selecting primers with uniform melting temperatures and minimal cross-hybridization potential (Table A1). Primers, synthesized with a 5´ C6 spacer and aminohexyl modification, were covalently conjugated by a photocleavable link to Masscode tags (Qiagen Masscode technology) (,). Masscode tags have a modular structure, including a tetrafluorophenyl ester for tag conjugation to primary amines; an o-nitrobenzyl photolabile linker for photoredox cleavage of the tag from the analyte; a mass spectrometry sensitivity enhancer, which improves the efficiency of atmospheric pressure chemical ionization of the cleaved tag; and a variable mass unit for variation of the cleaved tag mass (,–). A library of 64 different tags has been established. Forward and reverse primers in individual primer sets are labeled with distinct molecular weight tags. Thus, amplification of a microbial gene target produces a dual signal that allows assessment of specificity.
Table A1

Respiratory panel Mass Tag primers.

Target – Masscode FWD/REVName FWDSequenceName REVSequenceRef.
FLUAV-M 618/690AM-U151CATGGAATGGCTAAAGACAAGACCAM-L397AAGTGCACCAGCAGAATAACTGAG (8)
FLUAV-N1 499/439NA1-U1078ATGGTAATGGTGTTTGGATAGGAAGNA1-L1352AATGCTGCTCCCACTAGTCCAG (8)
FLUAV-N2 658/730NA2-U560AAGCATGGCTGCATGTTTGTGNA2-L858ACCAGGATATCGAGGATAACAGGA (8)
FLUAV-HA1 650/590HA1-U583GGTGTTCATCACCCGTCTAACATHA1-L895GTGTTTGACACTTCGCGTCACAT (8)
FLUAV-HA2 662/539H2A208U27GCTATGCAAACTAAACGGAATYCCTCCH2A559L26TATTGTTGTACGATCCTTTGGCAACC
FLUAV-HA3-1 586/475HA3-U115GCTACTGAGCTGGTTCAGAGTTCHA3-L375GAAGTCTTCATTGATAAACTCCAG (8)
FLUAV-HA5 646/395HA5hum-u71TTACTGTTACACATGCCCAAGACAHA5hum-L147AGGYTTCACTCCATTTAGATCGCA
FLUBV 698/598
BHA-U188
AGACCAGAGGGAAACTATGCCC
BHA-L347
CTGTCGTGCATTATAGGAAAGCAC
(8)
HCoV-SARS 527/666CIID-28891FAAGCCTCGCCAAAAACGTACCIID-29100RAAGTCAGCCATGTTCCCGAA
HCoV-229E 670/558Taq-Co22-418FGGCGCAAGAATTCAGAACCATaq-Co22-636RTAAGAGCCGCAGCAACTGC
HCoV-OC43 686/548
Taq-Co43-270F
TGTGCCTATTGCACCAGGAGT
Taq-Co43-508R
CCCGATCGACAATGTCAGC

RSV A 467/455RSA-U1137AGATCAACTTCTGTCATCCAGCAARSV-L1192GCACATCATAATTAGGAGTATCAAT (9)
RSV B 483/479
RSB-U1248
AAGATGCAAATCATAAATTCACAGGA
RSV-1318
TGATATCCAGCATCTTTAAGTATCTTTATAGTG
(9)
HMPV-1 718/654MPV01.2AACCGTGTACTAAGTGATGCACTCMPV02.2CATTGTTTGACCGGCCCCATAA (10)
HMPV-2 718/654
MV-Can-U918
AAGTCCAAAGGCAGGRCTGTTATC
MV-Can-L992
CCTGAAGCATTRCCAAGAACAACAC

HPIV-1 566/357HPIV1-U82TACTTTTGACACATTTAGTTCCAGGAGHPIV1-L167CGGTACTTCTTTGACCAGGTATAATTG
HPIV-2 463/590HPIV2-U908GGACTTGGAACAAGATGGCCTHPIV2-L984AGCATGAGAGCYTTTAATTTCTGGA
HPIV-3 423/539HPIV3-U590GCTTTCAGACAAGATGGAACAGTGHPIV3-L668GCATKATTGACCCAATCTGATCC
HPIV 4A 622/606HPIV4A-U191AACAGAAGGAAATGATGGTGGAACHPIV4A-L269TGCTGTGGATGTATGGGCAG
HPIV 4B 622/606
HPIV4B-U194
AGAAGAAAACAACGATGAGACAAGG
HPIV4B-L306
GTTTCCCTGGTTCACTCTCTTCA

Measles 578/562MEA-U1103CAAGCATCATGATYGCCATTCCTGGMEA-L1183CCTGAATCYCTGCCTATGATGGGTTT
Adenovirus 503/630ADV2HEX2FCCCMTTYAACCACCACCGADVHEX1RACATCCTTBCKGAAGTTCCA (11)
Enterovirus 702/4955UTR-U447TCCTCCGGCCCCTGAATGCGGCTAATCC5UTR-L541GAAACACGGWCACCCAAAGTASTCG
HHV-1 443/706HSV-U27CCCGGATGCGGTCCAGACGATTATHSV-L121CCCGCGGAGGTTGTACAAAAAGCT
HHV-3 515/471VZV-U138ACGTGGATCGTCGGATCAGTTGTVZV-L196TCGCTATGTGCTAAAACACGCGG
Legionella pneumophila 678/582LegPneu-U149GCATWGATGTTARTCCGGAAGCALegPneu-L223CGGTTAAAGCCAATTGAGCG
Chlamydia pneumoniae 519/383CLPM1CATGGTGTCATTCGCCAAGTCLPM2CGTGTCGTCCAGCCATTTTA (12)
Streptococcus pneumonia 714/694SPPLY-U532AGCGATAGCTTTCTCCAAGTGGSPPLY-L606CTTAGCCAACAAATCGTTTACCG
Haemophilus influenzae 734/726HINF-U82AAGCTCCTTGMATTTTTTGTATTAGAAHinf-L158GCTGAATTGGCTTRGATACCGAG
Mycoplasma pneumoniae 602/614MTPM1CCAACCAAACAACAACGTTCAMTPM2ACCTTGACTGGAGGCCGTTA (12)
Gene target standards were cloned by PCR into pCR2.1-TOPO (Invitrogen, Carlsbad, CA, USA) by using DNA template (bacterial and DNA viral targets) or cDNA template (RNA viral targets) obtained by reverse transcription of extracts from infected cultured cells or by assembly of overlapping synthetic polynucleotides. Assays were initially established by using plasmid standards diluted in 2.5-µg/mL human placenta DNA (Sigma, St. Louis, MO, USA) and subjected to PCR amplification with a multiplex PCR kit (Qiagen), primers at 0.5 µmol/L each, and the following cycling protocol: an annealing step with a temperature reduction in 1°C increments from 65°C to 51°C during the first 15 cycles and then continuing with a cycling profile of 94°C for 20 s, 50°C for 20 s, and 72°C for 30 s in an MJ PTC200 thermal cycler (MJ Research, Waltham, MA, USA). Amplification products were separated from unused primers by using QIAquick 96 PCR purification cartridges (Qiagen, with modified binding and wash buffers). Masscode tags were decoupled from amplified products through UV light-induced photolysis in a flow cell and analyzed in a single quadrapole mass spectrometer using positive-mode atmospheric pressure chemical ionization (Agilent Technologies, Palo Alto, CA, USA). A detection threshold of 100 DNA copies was determined for 19 of 22 cloned targets by using a 22-plex assay (Table 1).
Table 1

Sensitivity of pathogen detection by Mass Tag polymerase chain reaction determined by using plasmid and synthetic RNA standards*

Pathogen or proteinDetection threshold (DNA copies/RNA copies)
Influenza A matrix100/1,000
Influenza A N1100/NA
Influenza A N2100/NA
Influenza A H1100/NA
Influenza A H2100/NA
Influenza A H3100/NA
Influenza A H5100/NA
Influenza B H500/1,000
RSV group A100/1,000
RSV group B100/500
Metapneumovirus100/1,000
CoV-SARS100/500
CoV-OC43100/500
CoV-229E100/500
HPIV-1100/1,000
HPIV-2100/1,000
HPIV-3100/500
Chlamydia pneumoniae 100/NA
Mycoplasma pneumoniae 100/NA
Legionella pneumophila 100/NA
Enterovirus (genus)500/1,000
Adenovirus (genus)5,000/NA

*NA, not assessed; RSV, respiratory syncytial virus; CoV, coronavirus; SARS, severe acute respiratory syndrome; HPIV, human parainfluenza virus.

*NA, not assessed; RSV, respiratory syncytial virus; CoV, coronavirus; SARS, severe acute respiratory syndrome; HPIV, human parainfluenza virus. Many respiratory pathogens have RNA genomes; thus, where indicated, assay sensitivity was determined by using synthetic RNA standards or RNA extracts of viral stocks. Synthetic RNA standards were generated by using T7 polymerase and linearized plasmid DNA. After quantitation by UV spectrometry, RNA was serially diluted in 2.5-µg/mL yeast tRNA (Sigma), reverse transcribed with random hexamers by using Superscript II (Invitrogen, Carlsbad, CA, USA), and used as template for Mass Tag PCR. As anticipated, sensitivity was reduced by the use of RNA instead of DNA templates (Table 1). The sensitivity of Mass Tag PCR to detect live virus was tested by using RNA extracted from serial dilutions of titered stocks of coronaviruses (severe acute respiratory syndrome [SARS] and OC43) and parainfluenzaviruses (HPIV 2 and 3). A 100-µL volume of each dilution was analyzed. RNA extracted from a 1-TCID50/mL dilution, representing 0.025 TCID50 per PCR reaction, was consistently positive in Mass Tag PCR. RNA extracted from banked sputum, nasal swabs, and pulmonary washes of persons with respiratory infection was tested by using an assay panel comprising 30 gene targets that represented 22 respiratory pathogens. Infection in each of these persons had been previously diagnosed through virus isolation, conventional nested RT-PCR, or both. Reverse transcription was performed using random hexamers, and Mass Tag PCR results were consistent in all cases with the established diagnosis. Infections with respiratory syncytial virus, human parainfluenza virus, SARS coronavirus, adenovirus, enterovirus, metapneumovirus, and influenza virus were correctly identified (Table 2 and Figure 2). A panel comprising gene targets representing 17 pathogens related to central nervous system infectious disease (influenza A virus matrix gene; influenza B virus; human coronaviruses 229E, OC43, and SARS; enterovirus; adenovirus; human herpesvirus-1 and -3; West Nile virus; St. Louis encephalitis virus; measles virus; HIV-1 and -2; and Streptococcus pneumoniae, Haemophilus influenzae, and Nesseria meningitidis) was applied to RNA obtained from banked samples of cerebrospinal fluid and brain tissue that had been previously characterized by conventional diagnostic RT-PCR. Two of 3 cases of West Nile virus encephalitis were correctly identified. Eleven of 12 cases of enteroviral meningitis were detected representing serotypes CV-B2, CV-B3, CV-B5, E-6, E-11, E-13, E-18, and E-30 (data not shown).
Table 2

Multiplex pathogen detection by Mass Tag polymerase chain reaction using Masscode-labeled primers in a 30-plex assay with clinical specimens with previously identified pathogens*

PathogenNo. positive/no. tested†
RSV A2/2
RSV B3/3
HPIV-11/1
HPIV-32/2
HPIV-42/2
CoV-SARS4/4
Metapneumovirus2/3
Influenza B1/3
Influenza A2/6
Adenovirus2/2
Enterovirus2/2

*RSV, respiratory syncytial virus; HPIV, human parainfluenza virus; CoV, coronavirus; SARS, severe acute respiratory syndrome.
†No. positive and consistent with previous diagnosis/number tested (with respective previous diagnosis).

Figure 2

Analysis of clinical specimens. RNA extracts from clinical specimens containing known pathogens were reverse transcribed into cDNA (Superscript RT system, Invitrogen, Carlsbad, CA; 20-µL volume). Five microliters of the reaction were subjected to Mass Tag PCR by using primers coupled to Masscode tags (Qiagen Masscode technology, Qiagen, Hilden, Germany). Detection of (A) influenza virus A (H1N1), (B) respiratory syncytial virus (RSV) group B, (C) human coronavirus SARS (HCoV-SARS), (D) human parainfluenza virus (HPIV) types 1 and (E) 3, and (F) enterovirus (EV) by using a 30-plex assay, including 60 primers targeting influenza A virus matrix gene (FLUAV-M), and for typing N1, N2, H1, H2, H3, and H5 sequences, as well as influenza B virus (FLUBV), RSV groups A and B, HCoV-229E, -OC43, and -SARS, HPIV types 1, 2, 3, and 4 (groups A and B combined; 4 primers), human metapneumovirus (HMPV, 4 primers), measles virus (MEV), EV (degenerate primer pair targeting all serogroups), human adenoviruses (HAdV, degenerate primer pair targeting all serogroups), human herpesvirus 1 (HHV-1, herpes simplex virus), human herpesvirus 3 (HHV-3; varicella-zoster virus), Mycoplasma pneumoniae, Chlamydia pneumoniae, Legionella pneumophila, Streptococcus pneumoniae, Haemophilus influenzae. The bar indicates an arbitrary cut-off threshold of 2.7 (4 times average background determined with random human DNA).

*RSV, respiratory syncytial virus; HPIV, human parainfluenza virus; CoV, coronavirus; SARS, severe acute respiratory syndrome.
†No. positive and consistent with previous diagnosis/number tested (with respective previous diagnosis). Analysis of clinical specimens. RNA extracts from clinical specimens containing known pathogens were reverse transcribed into cDNA (Superscript RT system, Invitrogen, Carlsbad, CA; 20-µL volume). Five microliters of the reaction were subjected to Mass Tag PCR by using primers coupled to Masscode tags (Qiagen Masscode technology, Qiagen, Hilden, Germany). Detection of (A) influenza virus A (H1N1), (B) respiratory syncytial virus (RSV) group B, (C) human coronavirus SARS (HCoV-SARS), (D) human parainfluenza virus (HPIV) types 1 and (E) 3, and (F) enterovirus (EV) by using a 30-plex assay, including 60 primers targeting influenza A virus matrix gene (FLUAV-M), and for typing N1, N2, H1, H2, H3, and H5 sequences, as well as influenza B virus (FLUBV), RSV groups A and B, HCoV-229E, -OC43, and -SARS, HPIV types 1, 2, 3, and 4 (groups A and B combined; 4 primers), human metapneumovirus (HMPV, 4 primers), measles virus (MEV), EV (degenerate primer pair targeting all serogroups), human adenoviruses (HAdV, degenerate primer pair targeting all serogroups), human herpesvirus 1 (HHV-1, herpes simplex virus), human herpesvirus 3 (HHV-3; varicella-zoster virus), Mycoplasma pneumoniae, Chlamydia pneumoniae, Legionella pneumophila, Streptococcus pneumoniae, Haemophilus influenzae. The bar indicates an arbitrary cut-off threshold of 2.7 (4 times average background determined with random human DNA).

Conclusions

Our results indicate that Mass Tag PCR is a sensitive and specific tool for molecular characterization of microflora. The advantage of Mass Tag PCR is its capacity for multiplex analysis. Although the use of degenerate primers (e.g., enteroviruses and adenoviruses, Table A1 and Table 1) may reduce sensitivity, the limit of multiplexing to detect specific targets will likely be defined by the maximal primer concentration that can be accommodated in a PCR mix. Analysis requires the purification of product from unincorporated primers and mass spectroscopy. Although these steps are now performed manually, and mass spectrometers are not yet widely distributed in clinical laboratories, the increasing popularity of mass spectrometry in biomedical sciences and the advent of smaller, lower-cost instruments could facilitate wider use and integrated instrumentation. In addition to developing additional pathogen panels, our continuing work is focused on optimizing multiplexing, sensitivity, and throughput. Potential applications include differential diagnosis of infectious diseases, blood product surveillance, forensic microbiology, and biodefense.
  12 in total

1.  Multiplex detection of four pathogenic retroviruses using molecular beacons.

Authors:  J A Vet; A R Majithia; S A Marras; S Tyagi; S Dube; B J Poiesz; F R Kramer
Journal:  Proc Natl Acad Sci U S A       Date:  1999-05-25       Impact factor: 11.205

Review 2.  Molecular diagnosis of influenza.

Authors:  Joanna S Ellis; Maria C Zambon
Journal:  Rev Med Virol       Date:  2002 Nov-Dec       Impact factor: 6.989

3.  Improved Utility of Photolabile Solid Phase Synthesis Supports for the Synthesis of Oligonucleotides Containing 3'-Hydroxyl Termini.

Authors:  Hariharan Venkatesan; Marc M. Greenberg
Journal:  J Org Chem       Date:  1996-01-26       Impact factor: 4.354

4.  Detection of electrophore-labeled DNA and albumin by gas chromatography: labile amide electrophoric release tags.

Authors:  S Abdel-Baky; K Allam; R W Giese
Journal:  Anal Chem       Date:  1993-02-15       Impact factor: 6.986

5.  Multiplex PCR for typing and subtyping influenza and respiratory syncytial viruses.

Authors:  J Stockton; J S Ellis; M Saville; J P Clewley; M C Zambon
Journal:  J Clin Microbiol       Date:  1998-10       Impact factor: 5.948

6.  4-(Trifluoromethyl)-2,3,5,6-tetrafluorobenzyl bromide as a new electrophoric derivatizing reagent.

Authors:  M Saha; J Saha; R W Giese
Journal:  J Chromatogr       Date:  1993-07-09

7.  Rapid identification of nine microorganisms causing acute respiratory tract infections by single-tube multiplex reverse transcription-PCR: feasibility study.

Authors:  B Gröndahl; W Puppe; A Hoppe; I Kühne; J A Weigl; H J Schmitt
Journal:  J Clin Microbiol       Date:  1999-01       Impact factor: 5.948

8.  Oligodeoxyribonucleotides with conjugated dihydropyrroloindole oligopeptides: preparation and hybridization properties.

Authors:  E A Lukhtanov; I V Kutyavin; H B Gamper; R B Meyer
Journal:  Bioconjug Chem       Date:  1995 Jul-Aug       Impact factor: 4.774

9.  Rapid simultaneous diagnosis of infections with respiratory syncytial viruses A and B, influenza viruses A and B, and human parainfluenza virus types 1, 2, and 3 by multiplex quantitative reverse transcription-polymerase chain reaction-enzyme hybridization assay (Hexaplex).

Authors:  J Fan; K J Henrickson; L L Savatski
Journal:  Clin Infect Dis       Date:  1998-06       Impact factor: 9.079

10.  Simultaneous detection of fourteen respiratory viruses in clinical specimens by two multiplex reverse transcription nested-PCR assays.

Authors:  M T Coiras; J C Aguilar; M L García; I Casas; P Pérez-Breña
Journal:  J Med Virol       Date:  2004-03       Impact factor: 2.327

View more
  76 in total

1.  Simultaneous detection of influenza A, influenza B, and respiratory syncytial viruses and subtyping of influenza A H3N2 virus and H1N1 (2009) virus by multiplex real-time PCR.

Authors:  Yu Chen; Dawei Cui; Shufa Zheng; Shigui Yang; Jia Tong; Dagan Yang; Jian Fan; Jie Zhang; Bin Lou; Xuefen Li; Xiaoling Zhuge; Bo Ye; Baode Chen; Weilin Mao; Yajun Tan; Genyun Xu; Zhenjin Chen; Nan Chen; Lanjuan Li
Journal:  J Clin Microbiol       Date:  2011-01-26       Impact factor: 5.948

Review 2.  Bioethical considerations in developing a biorepository for the Pneumonia Etiology Research for Child Health project.

Authors:  Andrea N DeLuca; Alan Regenberg; Jeremy Sugarman; David R Murdoch; Orin Levine
Journal:  Clin Infect Dis       Date:  2012-04       Impact factor: 9.079

Review 3.  Microbe hunting.

Authors:  W Ian Lipkin
Journal:  Microbiol Mol Biol Rev       Date:  2010-09       Impact factor: 11.056

Review 4.  Microbiome of the paranasal sinuses: Update and literature review.

Authors:  Jivianne T Lee; Daniel N Frank; Vijay Ramakrishnan
Journal:  Am J Rhinol Allergy       Date:  2016 Jan-Feb       Impact factor: 2.467

5.  Using a resequencing microarray as a multiple respiratory pathogen detection assay.

Authors:  Baochuan Lin; Kate M Blaney; Anthony P Malanoski; Adam G Ligler; Joel M Schnur; David Metzgar; Kevin L Russell; David A Stenger
Journal:  J Clin Microbiol       Date:  2006-11-29       Impact factor: 5.948

6.  Evaluation of a TaqMan Array Card for Detection of Central Nervous System Infections.

Authors:  Clayton O Onyango; Vladimir Loparev; Shirley Lidechi; Vinod Bhullar; D Scott Schmid; Kay Radford; Michael K Lo; Paul Rota; Barbara W Johnson; Jorge Munoz; Martina Oneko; Deron Burton; Carolyn M Black; John Neatherlin; Joel M Montgomery; Barry Fields
Journal:  J Clin Microbiol       Date:  2017-04-12       Impact factor: 5.948

7.  Multiplexed identification of blood-borne bacterial pathogens by use of a novel 16S rRNA gene PCR-ligase detection reaction-capillary electrophoresis assay.

Authors:  Maneesh R Pingle; Kathleen Granger; Philip Feinberg; Rebecca Shatsky; Bram Sterling; Mark Rundell; Eric Spitzer; Davise Larone; Linnie Golightly; Francis Barany
Journal:  J Clin Microbiol       Date:  2007-04-11       Impact factor: 5.948

8.  Genomic analysis of two novel human enterovirus C genotypes found in respiratory samples from Peru.

Authors:  Rafal Tokarz; David L Hirschberg; Stephen Sameroff; Saddef Haq; Giannina Luna; Andrew J Bennett; Maria Silva; Mariana Leguia; Matthew Kasper; Daniel G Bausch; W Ian Lipkin
Journal:  J Gen Virol       Date:  2012-10-03       Impact factor: 3.891

9.  Parvovirus B19 Infection in Children With Arterial Ischemic Stroke.

Authors:  Heather J Fullerton; Jorge M Luna; Max Wintermark; Nancy K Hills; Rafal Tokarz; Ying Li; Carol Glaser; Gabrielle A DeVeber; W Ian Lipkin; Mitchell S V Elkind
Journal:  Stroke       Date:  2017-09-01       Impact factor: 7.914

Review 10.  Detection of respiratory viruses by molecular methods.

Authors:  James B Mahony
Journal:  Clin Microbiol Rev       Date:  2008-10       Impact factor: 26.132

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.