Literature DB >> 8464731

Template controlled coupling and recombination of oligonucleotide blocks containing thiophosphoryl groups.

S M Gryaznov1, R L Letsinger.   

Abstract

Oxidation of a pair of 3'- and 5'-thiophosphoryloligonucleotides in the presence of a complementary oligonucleotide template is shown to provide an effective means for selectively linking oligonucleotide blocks. Coupling proceeds rapidly and efficiently under mild conditions in dilute aqueous solutions (microM range for oligomers, 2-15 min at 0-4 degrees C with K3Fe(CN)6 or KI3 as oxidant). This chemistry was demonstrated by polymerization of a thymidylate decamer derivative (sTTTTTTTTTTs) in the presence of poly(dA) and by coupling oligomers possessing terminal thiophosphoryl groups (ACACCCAATTs + sCTGAAAATGG and ACACCCAATs + sCTGAAAATGG) in the presence of a template (CCATTTTCAGAATTGGGTGT). Efficient linking of 5' to 3' phosphoryl groups can be achieved under conditions where virtually no coupling takes place in absence of a template. A novel feature of the chemistry is that catalyzed recombinations of oligomers containing internal -OP(O)(O-)SSP(O)(O-)O- linkages can be directed by hydrogen bonding to a complementary oligonucleotide. Convenient procedures are reported for solid phase synthesis of the requisite oligonucleotide 3'- and 5'-phosphorothioates.

Entities:  

Mesh:

Substances:

Year:  1993        PMID: 8464731      PMCID: PMC309325          DOI: 10.1093/nar/21.6.1403

Source DB:  PubMed          Journal:  Nucleic Acids Res        ISSN: 0305-1048            Impact factor:   16.971


  18 in total

1.  A new affinity reagent for the site-specific, covalent attachment of DNA to active-site nucleophiles: application to the EcoRI and RsrI restriction and modification enzymes.

Authors:  A A Purmal; Z A Shabarova; R I Gumport
Journal:  Nucleic Acids Res       Date:  1992-07-25       Impact factor: 16.971

2.  Nonenymatic ligation of double-helical DNA by alternate-strand triple helix formation.

Authors:  K J Luebke; P B Dervan
Journal:  Nucleic Acids Res       Date:  1992-06-25       Impact factor: 16.971

Review 3.  Chemical development in the design of oligonucleotide probes for binding to DNA and RNA.

Authors:  Z A Shabarova
Journal:  Biochimie       Date:  1988-10       Impact factor: 4.079

4.  Template-directed polymerization of oligoadenylates using cyanogen bromide.

Authors:  E Kanaya; H Yanagawa
Journal:  Biochemistry       Date:  1986-11-18       Impact factor: 3.162

5.  Synthesis and properties of oligonucleotides containing aminodeoxythymidine units.

Authors:  S M Gryaznov; R L Letsinger
Journal:  Nucleic Acids Res       Date:  1992-07-11       Impact factor: 16.971

6.  Studies on some interactions and reactions of oligonucleotides in aqueous solution.

Authors:  R Naylor; P T Gilham
Journal:  Biochemistry       Date:  1966-08       Impact factor: 3.162

7.  Chemical synthesis of oligodeoxynucleotide dumbbells.

Authors:  G W Ashley; D M Kushlan
Journal:  Biochemistry       Date:  1991-03-19       Impact factor: 3.162

8.  Disulfide-linked oligonucleotide phosphorothioates: novel analogues of nucleic acids.

Authors:  T Wu; L E Orgel
Journal:  J Mol Evol       Date:  1991       Impact factor: 2.395

9.  Cholesteryl-conjugated oligonucleotides: synthesis, properties, and activity as inhibitors of replication of human immunodeficiency virus in cell culture.

Authors:  R L Letsinger; G R Zhang; D K Sun; T Ikeuchi; P S Sarin
Journal:  Proc Natl Acad Sci U S A       Date:  1989-09       Impact factor: 11.205

10.  Chemical reactions within DNA duplexes. Cyanogen bromide as an effective oligodeoxyribonucleotide coupling agent.

Authors:  N I Sokolova; D T Ashirbekova; N G Dolinnaya; Z A Shabarova
Journal:  FEBS Lett       Date:  1988-05-09       Impact factor: 4.124

View more
  11 in total

1.  Protein-DNA footprinting by endcapped duplex oligodeoxyribonucleotides.

Authors:  Pei-Sze Ng; Donald E Bergstrom
Journal:  Nucleic Acids Res       Date:  2004-07-19       Impact factor: 16.971

2.  Double displacement: An improved bioorthogonal reaction strategy for templated nucleic acid detection.

Authors:  Daniel J Kleinbaum; Gregory P Miller; Eric T Kool
Journal:  Bioconjug Chem       Date:  2010-06-16       Impact factor: 4.774

3.  Oligo-2'-fluoro-2'-deoxynucleotide N3'-->P5' phosphoramidates: synthesis and properties.

Authors:  R G Schultz; S M Gryaznov
Journal:  Nucleic Acids Res       Date:  1996-08-01       Impact factor: 16.971

4.  Selective chemical autoligation on a double-stranded DNA template.

Authors:  M K Herrlein; R L Letsinger
Journal:  Nucleic Acids Res       Date:  1994-11-25       Impact factor: 16.971

5.  Enhancement of selectivity in recognition of nucleic acids via chemical autoligation.

Authors:  S M Gryaznov; R Schultz; S K Chaturvedi; R L Letsinger
Journal:  Nucleic Acids Res       Date:  1994-06-25       Impact factor: 16.971

6.  Synthesis and binding properties of conjugates between oligodeoxynucleotides and daunorubicin derivatives.

Authors:  A Garbesi; S Bonazzi; S Zanella; M L Capobianco; G Giannini; F Arcamone
Journal:  Nucleic Acids Res       Date:  1997-06-01       Impact factor: 16.971

7.  Template-directed photoligation of oligodeoxyribonucleotides via 4-thiothymidine.

Authors:  J Liu; J S Taylor
Journal:  Nucleic Acids Res       Date:  1998-07-01       Impact factor: 16.971

8.  A Novel 5'-Iodonucleoside Allows Efficient Nonenzymatic Ligation of Single-stranded and Duplex DNAs.

Authors:  Yanzheng Xu; Eric T Kool
Journal:  Tetrahedron Lett       Date:  1997-08-11       Impact factor: 2.415

9.  Investigation of the 'n-1' impurity in phosphorothioate oligodeoxynucleotides synthesized by the solid-phase beta-cyanoethyl phosphoramidite method using stepwise sulfurization.

Authors:  K L Fearon; J T Stults; B J Bergot; L M Christensen; A M Raible
Journal:  Nucleic Acids Res       Date:  1995-07-25       Impact factor: 16.971

10.  Stabilization of double-stranded oligonucleotides using backbone-linked disulfide bridges.

Authors:  H Gao; M Yang; A F Cook
Journal:  Nucleic Acids Res       Date:  1995-01-25       Impact factor: 16.971

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.