| Literature DB >> 8297796 |
M Downes1, R Griggs, A Atkins, E N Olson, G E Muscat.
Abstract
Thyroid hormones are positive regulators of muscle development in vivo. Triiodo-L-thyronine (T3) treatment of myogenic cell lines results in the precocious expression of myogenin, a muscle specific, helix-loop-helix factor that can trans-activate muscle specific gene expression (G. Carnac et al., Mol. Endocrinol., 6: 1185-1194, 1992). We have identified a T3 response element (TRE) in the mouse myogenin (MM) promoter between nucleotide positions -526 and -494 (5' GTGGTAGGTCTTTAGGGGTCTCATGGGACTGACA 3'). This sequence conferred appropriate hormonal regulation to an enhancerless SV40 promoter. Electrophoretic mobility shift analysis experiments showed that thyroid hormone receptor alpha (TR alpha) and retinoid X receptor alpha (RXR alpha) formed a heterodimeric complex on the MM TRE that was specifically competed by classical TREs and not by other response elements. Analyses of this heterodimer with a battery of steroid hormone response elements indicated that the complex was efficiently competed by a direct repeat of the AGGTCA motif separated by 4 nucleotides, as predicted by the 3-4-5 rule. Electrophoretic mobility shift analysis experiments showed that the myogenin, growth hormone, and myosin heavy chain TREs interacted with an identical nuclear factor(s) in muscle cells that was constitutively expressed during myogenesis. Mutagenesis of the MM TRE indicated that the sequence of the direct repeats (AGGTCA) and the 4-nucleotide gap were necessary for efficient binding to the TR alpha/RXR alpha heterodimeric complex. In conclusion, our data suggest that the MM TRE is a target for direct cross-talk between two different hormonal signals (T3 and 9-cis-retinoic acid) at the receptor level.(ABSTRACT TRUNCATED AT 250 WORDS)Entities:
Mesh:
Substances:
Year: 1993 PMID: 8297796
Source DB: PubMed Journal: Cell Growth Differ ISSN: 1044-9523