| Literature DB >> 8127707 |
G E Muscat1, L Mynett-Johnson, D Dowhan, M Downes, R Griggs.
Abstract
Thyroid hormones are major determinants of skeletal muscle differentiation in vivo. Triiodo-L-thyronine treatment promotes terminal muscle differentiation and results in increased MyoD gene transcription in myogenic cell lines; furthermore myoD and fast myosin heavy chain gene expression are activated in rodent slow twitch muscle fibers (Molecular Endocrinology 6: 1185-1194, 1992; Development 118: 1137-1147, 1993). We have identified a T3 response element (TRE) in the mouse MyoD promoter between nucleotide positions -337 and -309 (5' CTGAGGTCAGTACAGGCTGGAGGAGTAGA 3'). This sequence conferred an appropriate T3 response to an enhancerless SV40 promoter. In vitro binding studies showed that the thyroid hormone receptor alpha (TR alpha) formed a heterodimeric complex, with either the retinoid X receptor alpha or gamma 1 isoforms (RXR alpha, RXR gamm), on the MyoD TRE that was specifically competed by other well characterised TREs and not by other response elements. Analyses of this heterodimer with a battery of steroid hormone response elements indicated that the complex was efficiently competed by a direct repeat of the AGGTCA motif separated by 4 nucleotides as predicted by the 3-4-5 rule. EMSA experiments demonstrated that the nuclear factor(s) present in muscle cells that bound to the myoD TRE were constitutively expressed during myogenesis; this complex was competed by the myosin heavy chain, DR-4 and PAL-0 TREs in a sequence specific fashion. Western blot analysis indicated that TR alpha 1 was constitutively expressed during C2C12 differentiation. Mutagenesis of the myoD TRE indicated that the sequence of the direct repeats (AGGTCA) and the 4 nucleotide gap were necessary for efficient binding to the TR alpha/RXR alpha heterodimeric complex. In conclusion our data suggest that the TRE in the helix loop helix gene, myoD, is a target for the direct heterodimeric binding of TR alpha and RXR alpha/gamma. These results provide a molecular mechanism/model for the effects of triiodo-L-thyronine on in vitro myogenesis; the activation of myoD gene expression in the slow twitch fibres and the cascade of myogenic events regulated by thyroid hormone.Entities:
Mesh:
Substances:
Year: 1994 PMID: 8127707 PMCID: PMC307847 DOI: 10.1093/nar/22.4.583
Source DB: PubMed Journal: Nucleic Acids Res ISSN: 0305-1048 Impact factor: 16.971