Warning: Undefined array key "mm" in /www/wwwroot/www.ai-bt.com/si.php on line 10 Deprecated: trim(): Passing null to parameter #1 ($string) of type string is deprecated in /www/wwwroot/www.ai-bt.com/si.php on line 10 The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum.

Literature DB >> 7465421

The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum.

Abstract

The nucleotide sequence of ribosomal 5S rRNA from a cellular slime mold Dictyostelium discoideum is GUAUACGGCCAUACUAGGUUGGAAACACAUCAUCCCGUUCGAUCUGAUA AGUAAAUCGACCUCAGGCCUUCCAAGUACUCUGGUUGGAGACAACAGGGGAACAUAGGGUGCUGUAUACU. A model for the secondary structure of this 5S rRNA is proposed. The sequence is more similar to those of animals (62% similarity on the average) rather than those of yeasts (56%).

Entities: Species

Mesh：

Substances：

Year: 1980 PMID： 7465421 PMCID： PMC324323 DOI： 10.1093/nar/8.23.5535

Source DB: PubMed Journal: Nucleic Acids Res ISSN： 0305-1048 Impact factor: 16.971

6 in total

1. Direct chemical method for sequencing RNA.

Authors: D A Peattie
Journal: Proc Natl Acad Sci U S A Date: 1979-04 Impact factor: 11.205

2. Characterization of ribosomes in the cellular slime mold, Dictyostelium discoideum.

Authors: M Iwabuchi; K Ito; H Ochiai
Journal: J Biochem Date: 1970-10 Impact factor: 3.387

3. Evolutionary change in 5S RNA secondary structure and a phylogenic tree of 54 5S RNA species.

Authors: H Hori; S Osawa
Journal: Proc Natl Acad Sci U S A Date: 1979-01 Impact factor: 11.205

4. Nucleotide sequence of a 5S ribosomal RNA gene in the sea urchin Lytechinus variegatus.

Authors: A L Lu; D A Steege; D W Stafford
Journal: Nucleic Acids Res Date: 1980-04-25 Impact factor: 16.971

5. The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

Authors: H Hori; S Osawa; K Murao; H Ishikura
Journal: Nucleic Acids Res Date: 1980-11-25 Impact factor: 16.971

6. Collection of published 5S and 5.8S RNA sequences and their precursors.

Authors: V A Erdmann
Journal: Nucleic Acids Res Date: 1979-01 Impact factor: 16.971

6 in total

25 in total

1. Sequence and generation of mature ribosomal RNA transcripts in Dictyostelium discoideum.

Authors: Carsten Boesler; Janis Kruse; Fredrik Söderbom; Christian Hammann
Journal: J Biol Chem Date: 2011-03-18 Impact factor: 5.157

2. Collection of published 5S, 5.8S and 4.5S ribosomal RNA sequences.

Authors: V A Erdmann; J Wolters; E Huysmans; R De Wachter
Journal: Nucleic Acids Res Date: 1985 Impact factor: 16.971

3. Phylogeny of protozoa deduced from 5S rRNA sequences.

Authors: T Kumazaki; H Hori; S Osawa
Journal: J Mol Evol Date: 1983 Impact factor: 2.395

4. Secondary structure of Bombyx mori and Dictyostelium discoideum 5S rRNA from S1 nuclease and cobra venom ribonuclease susceptibility, and computer assisted analysis.

Authors: A Troutt; T J Savin; W C Curtiss; J Celentano; J N Vournakis
Journal: Nucleic Acids Res Date: 1982-01-22 Impact factor: 16.971

5. Sequences of the 5S rRNAs of Azotobacter vinelandii, Pseudomonas aeruginosa and Pseudomonas fluorescens with some notes on 5S RNA secondary structure.

Authors: E Dams; A Vandenberghe; R De Wachter
Journal: Nucleic Acids Res Date: 1983-03-11 Impact factor: 16.971