Warning: Undefined array key "mm" in /www/wwwroot/www.ai-bt.com/si.php on line 10 Deprecated: trim(): Passing null to parameter #1 ($string) of type string is deprecated in /www/wwwroot/www.ai-bt.com/si.php on line 10 The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

Literature DB >> 6780979

The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

Abstract

The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria.

Entities: Species

Mesh：

Substances：
RNA, Ribosomal

Year: 1980 PMID： 6780979 PMCID： PMC324311 DOI： 10.1093/nar/8.22.5423

Source DB: PubMed Journal: Nucleic Acids Res ISSN： 0305-1048 Impact factor: 16.971

9 in total

Review 1. Preparation of RNA and ribosomes from yeast.

Authors: G M Rubin
Journal: Methods Cell Biol Date: 1975 Impact factor: 1.441

2. Molecular evolution of 5S RNA.

Authors: H Hori
Journal: Mol Gen Genet Date: 1976-05-07

Review 3. Minor components in transfer RNA: their characterization, location, and function.

Authors: S Nishimura
Journal: Prog Nucleic Acid Res Mol Biol Date: 1972

4. Nucleotide sequence of 5S-ribosomal RNA from Escherichia coli.

Authors: G G Brownlee; F Sanger; B G Barrell
Journal: Nature Date: 1967-08-12 Impact factor: 49.962

5. Evolutionary change in 5S RNA secondary structure and a phylogenic tree of 54 5S RNA species.

Authors: H Hori; S Osawa
Journal: Proc Natl Acad Sci U S A Date: 1979-01 Impact factor: 11.205

6. 5S RNA secondary structure.

Authors: G E Fox; C R Woese
Journal: Nature Date: 1975-08-07 Impact factor: 49.962

7. Studies on the sequence of the 3'-terminal region of turnip-yellow-mosaic-virus RNA.

Authors: M Silberklang; A Prochiantz; A L Haenni; U L Rajbhandary
Journal: Eur J Biochem Date: 1977-02

8. The primary structure of Bacillus subtilis and Bacillus stearothermophilus 5 S ribonucleic acids.

Authors: C A Marotta; F Varricchio; I Smith; S M Weissman
Journal: J Biol Chem Date: 1976-05-25 Impact factor: 5.157

9. Nucleotide sequence of Halobacterium cutirubrum ribosomal 5 S ribonucleic acid. An altered secondary structure in halophilic organisms.

Authors: R N Nazar; A T Matheson; G Bellemare
Journal: J Biol Chem Date: 1978-08-10 Impact factor: 5.157

9 in total

13 in total

The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

Review 1. Preparation of RNA and ribosomes from yeast.

2. Molecular evolution of 5S RNA.

Review 3. Minor components in transfer RNA: their characterization, location, and function.

4. Nucleotide sequence of 5S-ribosomal RNA from Escherichia coli.

5. Evolutionary change in 5S RNA secondary structure and a phylogenic tree of 54 5S RNA species.

6. 5S RNA secondary structure.

7. Studies on the sequence of the 3'-terminal region of turnip-yellow-mosaic-virus RNA.

8. The primary structure of Bacillus subtilis and Bacillus stearothermophilus 5 S ribonucleic acids.

9. Nucleotide sequence of Halobacterium cutirubrum ribosomal 5 S ribonucleic acid. An altered secondary structure in halophilic organisms.

1. Collection of published 5S, 5.8S and 4.5S ribosomal RNA sequences.

2. Structure of 5S rRNA in actinomycetes and relatives and evolution of eubacteria.

3. The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum.

4. Collection of published 5S and 5.8S ribosomal RNA sequences.

5. Consensus structure and evolution of 5S rRNA.

6. Collection of published 5S and 5.8S ribosomal RNA sequences.

7. The nucleotide sequence of 5S rRNA from Mycoplasma capricolum.

8. Generalized structures of the 5S ribosomal RNAs.

9. Unusual structural features of the 5S ribosomal RNA from Streptococcus cremoris.

10. The 5S ribosomal RNAs of Paracoccus denitrificans and Prochloron.