Literature DB >> 7465412

Solid phase phosphotriester synthesis of large oligodeoxyribonucleotides on a polyamide support.

A F Markham, M D Edge, T C Atkinson, A R Greene, G R Heathcliffe, C R Newton, D Scanlon.   

Abstract

Phosphotriester solid phase methodology on a polyamide support [(1980) Nucleic Acids Research, 8, 1081-1096] has been extended for the rapid synthesis of the tetradecanucleotide, d(AGTTGTTTGTAGTT), the octadecanucleotide, d(GTGGGTTTGGGGCAGGTC), and the heneicosanucleotide, d(GTGCTCTTATCCTCTTGGCTC). Thus, oligodeoxyribonucleotides comparable in size to those obtained by solution synthesis are readily accessible using solid phase techniques. An approach to the purification of the synthetic octadecanucleotide without recourse to high performance liquid chromatography is described.

Entities:  

Mesh：

Substances：

Year:  1980        PMID： 7465412      PMCID： PMC324294          DOI： 10.1093/nar/8.22.5193

Source DB:  PubMed          Journal:  Nucleic Acids Res        ISSN： 0305-1048            Impact factor:   16.971


  10 in total

1.  Letter: Polyamide supports for polypeptide synthesis.

Authors:  E Atherton; D L Clive; R C Sheppard
Journal:  J Am Chem Soc       Date:  1975-10-29       Impact factor: 15.419

Review 2.  Synthesis and cloning of operator DNA of the lac operon of E. coli.

Authors:  S A Narang; C P Bahl; R Wu
Journal:  Can J Biochem       Date:  1977-11

3.  Sequencing end-labeled DNA with base-specific chemical cleavages.

Authors:  A M Maxam; W Gilbert
Journal:  Methods Enzymol       Date:  1980       Impact factor: 1.600

4.  Rapid synthesis of oligodeoxyribonucleotides. IV. Improved solid phase synthesis of oligodeoxyribonucleotides through phosphotriester intermediates.

Authors:  M J Gait; M Singh; R C Sheppard; M D Edge; A R Greene; G R Heathcliffe; T C Atkinson; C R Newton; A F Markham
Journal:  Nucleic Acids Res       Date:  1980-03-11       Impact factor: 16.971

5.  Synthesis of the human insulin gene. Part II. Further improvements in the modified phosphotriester method and the synthesis of seventeen deoxyribooligonucleotide fragments constituting human insulin chains B and mini-CDNA.

Authors:  W L Sung; H M Hsiung; R Brousseau; J Michniewicz; R Wu; S A Narang
Journal:  Nucleic Acids Res       Date:  1979-12-20       Impact factor: 16.971

6.  Protected deoxyribonucleoside-3' aryl phosphodiesters as key intermediates in polynucleotide synthesis. Construction of an icosanucleotide analogous to the sequence at the ends of Rous sarcoma virus 35S RNA.

Authors:  G R Gough; C K Singleton; H L Weith; P T Gilham
Journal:  Nucleic Acids Res       Date:  1979-04       Impact factor: 16.971

7.  High-pressure liquid chromatography in polynucleotide synthesis.

Authors:  H J Fritz; R Belagaje; E L Brown; R H Fritz; R A Jones; R G Lees; H G Khorana
Journal:  Biochemistry       Date:  1978-04-04       Impact factor: 3.162

8.  Synthesis of oligonucleotides on cellulose by a phosphotriester method.

Authors:  R Crea; T Horn
Journal:  Nucleic Acids Res       Date:  1980-05-24       Impact factor: 16.971

9.  Rapid synthesis of oligodeoxyribonucleotides. II. Machine-aided solid-phase syntheses of two nonanucleotides and an octanucleotide.

Authors:  M J Gait; R C Sheppard
Journal:  Nucleic Acids Res       Date:  1977-12       Impact factor: 16.971

10.  Rapid synthesis of oligodeoxyribonucleotides on a grafted polymer support.

Authors:  V K Potapov; V P Veiko; O N Koroleva; Z A Shabarova
Journal:  Nucleic Acids Res       Date:  1979       Impact factor: 16.971
  10 in total
  14 in total

1.  Gene K of bacteriophage phi X174 codes for a protein which affects the burst size of phage production.

Authors:  S Gillam; T Atkinson; A Markham; M Smith
Journal:  J Virol       Date:  1985-02       Impact factor: 5.103

2.  Isolation and DNA sequence of a full-length cDNA clone for human X chromosome-encoded phosphoglycerate kinase.

Authors:  A M Michelson; A F Markham; S H Orkin
Journal:  Proc Natl Acad Sci U S A       Date:  1983-01       Impact factor: 11.205

3.  Synthesis of oligodeoxyribonucleotides on silica gel support.

Authors:  F Chow; T Kempe; G Palm
Journal:  Nucleic Acids Res       Date:  1981-06-25       Impact factor: 16.971

Review 4.  Recent developments in the chemical synthesis of polynucleotides.

Authors:  E Ohtsuka; M Ikehara; D Söll
Journal:  Nucleic Acids Res       Date:  1982-11-11       Impact factor: 16.971

5.  Improvements to solid phase phosphotriester synthesis of deoxyoligonucleotides.

Authors:  T P Patel; T A Millican; C C Bose; R C Titmas; G A Mock; M A Eaton
Journal:  Nucleic Acids Res       Date:  1982-09-25       Impact factor: 16.971

6.  Isolation and characterisation of a cDNA clone for human apolipoprotein CI and assignment of the gene to chromosome 19.

Authors:  F Tata; I Henry; A F Markham; S C Wallis; D Weil; K H Grzeschik; C Junien; R Williamson; S E Humphries
Journal:  Hum Genet       Date:  1985       Impact factor: 4.132

7.  Isolation of cDNA clones for the human complement protein factor B, a class III major histocompatibility complex gene product.

Authors:  D E Woods; A F Markham; A T Ricker; G Goldberger; H R Colten
Journal:  Proc Natl Acad Sci U S A       Date:  1982-09       Impact factor: 11.205

8.  Direct detection of the common Mediterranean beta-thalassemia gene with synthetic DNA probes. An alternative approach for prenatal diagnosis.

Authors:  S H Orkin; A F Markham; H H Kazazian
Journal:  J Clin Invest       Date:  1983-03       Impact factor: 14.808

9.  Identification of a point mutation in the adenosine deaminase gene responsible for immunodeficiency.

Authors:  D T Bonthron; A F Markham; D Ginsburg; S H Orkin
Journal:  J Clin Invest       Date:  1985-08       Impact factor: 14.808

10.  The construction of a synthetic Escherichia coli trp promoter and its use in the expression of a synthetic interferon gene.

Authors:  J D Windass; C R Newton; J De Maeyer-Guignard; V E Moore; A F Markham; M D Edge
Journal:  Nucleic Acids Res       Date:  1982-11-11       Impact factor: 16.971
View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.