Warning: Undefined array key "mm" in /www/wwwroot/www.ai-bt.com/si.php on line 10 Deprecated: trim(): Passing null to parameter #1 ($string) of type string is deprecated in /www/wwwroot/www.ai-bt.com/si.php on line 10 The sequence of 5S ribosomal RNA of the crustacean Artemia salina.

Literature DB >> 7312626

The sequence of 5S ribosomal RNA of the crustacean Artemia salina.

L Diels, R De Baere, A Vandenberghe, R De Wachter.

Abstract

The primary structure of the 5 S rRNA isolated from the cryptobiotic cysts of the brine shrimp Artemia salina is pACCAACGGCCAUACCACGUUGAAAGUACCCAGUCUCGUCAGAUCCUGGAAGUCACACAACGUCGGGCCCGGUCAGUACUUGGAUGGGUGACCGCCUGGGAACACCGGGUGCUGUUGGCAU (OH).

Entities: Species

Mesh：

Substances：
RNA, Ribosomal

Year: 1981 PMID： 7312626 PMCID： PMC327504 DOI： 10.1093/nar/9.19.5141

Source DB: PubMed Journal: Nucleic Acids Res ISSN： 0305-1048 Impact factor: 16.971

17 in total

1. Sequence of Drosophila 5S RNA synthesized by cultured cells and by the insect at different developmental stages. Homogeneity of the product and homologies with other 5S RNA's at the level of primary and secondary structure.

Authors: J Benhamou; R Jourdan; B R Jordan
Journal: J Mol Evol Date: 1977-05-13 Impact factor: 2.395

2. Direct chemical method for sequencing RNA.

Authors: D A Peattie
Journal: Proc Natl Acad Sci U S A Date: 1979-04 Impact factor: 11.205

3. An RNA sequencing method based on a two-dimensional combination of gel electrophoresis and thin-layer chromatography [proceedings].

Authors: L Diels; R De Wachter
Journal: Arch Int Physiol Biochim Date: 1980-02

4. The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum.

Authors: H Hori; S Osawa; M Iwabuchi
Journal: Nucleic Acids Res Date: 1980-12-11 Impact factor: 16.971

5. High-pressure liquid chromatography analysis of oligo- and monoribonucleotide mixtures, with special reference to ribosomal RNA constituents.

Authors: A Vandenberghe; L Nelles; R De Wachter
Journal: Anal Biochem Date: 1980-09-15 Impact factor: 3.365

Review 6. Collection of published 5S and 5.8S RNA sequences and their precursors.

Authors: V A Erdmann
Journal: Nucleic Acids Res Date: 1981-01-10 Impact factor: 16.971

7. Sequence homology at the 3'-ends of alfalfa mosaic virus RNAs.

Authors: L Pinck; M Pinck
Journal: FEBS Lett Date: 1979-11-01 Impact factor: 4.124

8. A different approach to RNA sequencing.

Authors: J Stanley; S Vassilenko
Journal: Nature Date: 1978-07-06 Impact factor: 49.962

9. Sequence and heterogeneity in the 5S RNA gene cluster of Drosophila melanogaster.

Authors: C Tschudi; V Pirrotta
Journal: Nucleic Acids Res Date: 1980-02-11 Impact factor: 16.971

10. An improved direct RNA sequence method; its application to Vicia faba 5.8S ribosomal RNA.

Authors: Y Tanaka; T A Dyer; G G Brownlee
Journal: Nucleic Acids Res Date: 1980-03-25 Impact factor: 16.971

12 in total

1. The 5S rRNA-histone repeat in the crustacean Artemia: structure, polymorphism and variation of the 5S rRNA segment in different populations.

Authors: J Cruces; M Díaz-Guerra; I Gil; J Renart
Journal: Nucleic Acids Res Date: 1989-08-11 Impact factor: 16.971

2. In vivo transcription from multiple spacer rRNA gene promoters during early development and evolution of the intergenic spacer in the brine shrimp Artemia.

Authors: H T Koller; K A Frondorf; P D Maschner; J C Vaughn
Journal: Nucleic Acids Res Date: 1987-07-10 Impact factor: 16.971

The sequence of 5S ribosomal RNA of the crustacean Artemia salina.

1. Sequence of Drosophila 5S RNA synthesized by cultured cells and by the insect at different developmental stages. Homogeneity of the product and homologies with other 5S RNA's at the level of primary and secondary structure.

2. Direct chemical method for sequencing RNA.

3. An RNA sequencing method based on a two-dimensional combination of gel electrophoresis and thin-layer chromatography [proceedings].

4. The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum.

5. High-pressure liquid chromatography analysis of oligo- and monoribonucleotide mixtures, with special reference to ribosomal RNA constituents.

Review 6. Collection of published 5S and 5.8S RNA sequences and their precursors.

7. Sequence homology at the 3'-ends of alfalfa mosaic virus RNAs.

8. A different approach to RNA sequencing.

9. Sequence and heterogeneity in the 5S RNA gene cluster of Drosophila melanogaster.

10. An improved direct RNA sequence method; its application to Vicia faba 5.8S ribosomal RNA.

1. The 5S rRNA-histone repeat in the crustacean Artemia: structure, polymorphism and variation of the 5S rRNA segment in different populations.

2. In vivo transcription from multiple spacer rRNA gene promoters during early development and evolution of the intergenic spacer in the brine shrimp Artemia.

3. Collection of published 5S, 5.8S and 4.5S ribosomal RNA sequences.

4. Nucleotide sequence of the 5S RNA gene and flanking regions interspersed with histone genes in Artemia.

5. Evolution of multicellular animals as deduced from 5S rRNA sequences: a possible early emergence of the Mesozoa.

6. Nucleotide sequences of 5S ribosomal RNA from four oomycete and chytrid water molds.

7. Collection of published 5S and 5.8S ribosomal RNA sequences.

8. Nucleotide sequence and thermal property of 5S rRNA from the elder aphid. Acyrthosiphon magnoliae.

9. Collection of published 5S and 5.8S ribosomal RNA sequences.

10. Sequences of three molluscan 5 S ribosomal RNAs confirm the validity of a dynamic secondary structure model.