Literature DB >> 7001357

The nucleotide sequence of glycine tRNA from Mycoplasma mycoides sp. capri.

M W Kilpatrick, R T Walker.   

Abstract

Using in vitro labelling techniques, a tRNAGly from M. mycoides sp. capri PG3 has been shown to have the sequence : pGCAGGUGs4UAGUUUAAUGGCAGAACUUC AGCCUUCCm6AAGCUGAUUGUGAGGGU psi CGAUUCCCUUCACCUGCUCCAOH. The anticodon is UCC and no other tRNAGly has been detected in the crude tRNA isolated from this organism. As is the case with some mitochondrial tRNAs, where the genome size of the organelle is small, it is possible that this tRNA is used to read all four glycine codons GGN.

Entities:  

Mesh：

Substances：

Year:  1980        PMID： 7001357      PMCID： PMC324120          DOI： 10.1093/nar/8.12.2783

Source DB:  PubMed          Journal:  Nucleic Acids Res        ISSN： 0305-1048            Impact factor:   16.971


  6 in total

Review 1.  The mycoplasmas.

Authors:  S Razin
Journal:  Microbiol Rev       Date:  1978-06

2.  A different approach to RNA sequencing.

Authors:  J Stanley; S Vassilenko
Journal:  Nature       Date:  1978-07-06       Impact factor: 49.962

3.  The nucleotide sequence of formylmethionine tRNA from Mycoplasma mycoides sp. capri.

Authors:  R T Walker; U L RajBhandary
Journal:  Nucleic Acids Res       Date:  1978-01       Impact factor: 16.971

4.  Compilation of tRNA sequences.

Authors:  M Sprinzl; F Grueter; A Spelzhaus; D H Gauss
Journal:  Nucleic Acids Res       Date:  1980-01-11       Impact factor: 16.971

5.  Phylogenetic analysis of the mycoplasmas.

Authors:  C R Woese; J Maniloff; L B Zablen
Journal:  Proc Natl Acad Sci U S A       Date:  1980-01       Impact factor: 11.205

6.  An improved direct RNA sequence method; its application to Vicia faba 5.8S ribosomal RNA.

Authors:  Y Tanaka; T A Dyer; G G Brownlee
Journal:  Nucleic Acids Res       Date:  1980-03-25       Impact factor: 16.971
  6 in total
  20 in total

1.  Compilation of tRNA sequences and sequences of tRNA genes.

Authors:  M Sprinzl; N Dank; S Nock; A Schön
Journal:  Nucleic Acids Res       Date:  1991-04-25       Impact factor: 16.971

2.  Levels of tRNAs in bacterial cells as affected by amino acid usage in proteins.

Authors:  F Yamao; Y Andachi; A Muto; T Ikemura; S Osawa
Journal:  Nucleic Acids Res       Date:  1991-11-25       Impact factor: 16.971

3.  Evolution of tRNAs and tRNA genes in Acholeplasma laidlawii.

Authors:  R Tanaka; Y Andachi; A Muto
Journal:  Nucleic Acids Res       Date:  1991-12-25       Impact factor: 16.971

4.  Chorismic acid, a key metabolite in modification of tRNA.

Authors:  T G Hagervall; Y H Jönsson; C G Edmonds; J A McCloskey; G R Björk
Journal:  J Bacteriol       Date:  1990-01       Impact factor: 3.490

5.  Sequence of an isoleucine tRNA from Mycoplasma mycoides sp. Capri.

Authors:  A Schön
Journal:  Nucleic Acids Res       Date:  1987-07-10       Impact factor: 16.971

Review 6.  Molecular biology and genetics of mycoplasmas (Mollicutes).

Authors:  S Razin
Journal:  Microbiol Rev       Date:  1985-12

7.  The nucleotide sequence of 5S rRNA from Mycoplasma capricolum.

Authors:  H Hori; M Sawada; S Osawa; K Murao; H Ishikura
Journal:  Nucleic Acids Res       Date:  1981-10-24       Impact factor: 16.971

8.  Codon discrimination and anticodon structural context.

Authors:  F Lustig; T Borén; Y S Guindy; P Elias; T Samuelsson; C W Gehrke; K C Kuo; U Lagerkvist
Journal:  Proc Natl Acad Sci U S A       Date:  1989-09       Impact factor: 11.205

9.  The nucleotide sequence of a small (3S) seryl-tRNA (anticodon GCU) from beef heart mitochondria.

Authors:  P Arcari; G G Brownlee
Journal:  Nucleic Acids Res       Date:  1980-11-25       Impact factor: 16.971

10.  Apparent lack of discrimination in the reading of certain codons in Mycoplasma mycoides.

Authors:  T Samuelsson; Y S Guindy; F Lustig; T Borén; U Lagerkvist
Journal:  Proc Natl Acad Sci U S A       Date:  1987-05       Impact factor: 11.205
View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.