Warning: Undefined array key "mm" in /www/wwwroot/www.ai-bt.com/si.php on line 10 Deprecated: trim(): Passing null to parameter #1 ($string) of type string is deprecated in /www/wwwroot/www.ai-bt.com/si.php on line 10 The nucleotide sequence of 5S rRNA from Mycoplasma capricolum.

Literature DB >> 7301591

The nucleotide sequence of 5S rRNA from Mycoplasma capricolum.

H Hori, M Sawada, S Osawa, K Murao, H Ishikura.

Abstract

The nucleotide sequence of 5S rRNA from Mycoplasma capricolum is UUGGUGGUAUAGCAUAGAGGUCACACCUGUUCCCAUGCCGAACACAGAAGUUAAGCUCUAUUACGGUGAAGAUAUUACU GAUGUGAGAAAAUAGCAAGCUGCCAGUUOH. The length is 107 nucleotides long, and the shortest in all the 5S rRNAs so far known. The sequence is more similar to those of the gram-positive bacteria than those of the gram-negative bacteria.

Entities: Species

Mesh：

Substances：
RNA, Ribosomal

Year: 1981 PMID： 7301591 PMCID： PMC327528 DOI： 10.1093/nar/9.20.5407

Source DB: PubMed Journal: Nucleic Acids Res ISSN： 0305-1048 Impact factor: 16.971

18 in total

1. A fragment of 23S RNA containing a nucleotide sequence complementary to a region of 5S RNA.

Authors: W Herr; H F Noller
Journal: FEBS Lett Date: 1975-05-01 Impact factor: 4.124

2. Isolation and analysis of the deoxyribonucleic acid of Mycoplasma mycoides var. Capri.

Authors: A S JONES; R T WALKER
Journal: Nature Date: 1963-05-11 Impact factor: 49.962

Review 3. Physiology of mycoplasmas.

Authors: S Razin
Journal: Adv Microb Physiol Date: 1973 Impact factor: 3.517

4. Genome size and evolution.

Authors: D C Wallace; H J Morowitz
Journal: Chromosoma Date: 1973 Impact factor: 4.316

5. Characterization of some caprine mycoplasmas, with proposals for new species, mycoplasma capricolum and mycoplasma putrefaciens.

Authors: J G Tully; M F Barile; D G Edward; T S Theodore; H Erno
Journal: J Gen Microbiol Date: 1974-11

Review 6. Cell biology of the mycoplasmas.

Authors: J Maniloff; H J Morowitz
Journal: Bacteriol Rev Date: 1972-09

7. Nucleotide sequence of 5S-ribosomal RNA from Escherichia coli.

Authors: G G Brownlee; F Sanger; B G Barrell
Journal: Nature Date: 1967-08-12 Impact factor: 49.962

8. The first nucleotide sequence of an organelle transfer RNA: chloroplastic tRNAphe.

Authors: S H Chang; C K Brum; M Siberklang; U L RajBhandary; L I Hecker; W E Barnett
Journal: Cell Date: 1976-12 Impact factor: 41.582

9. Studies on the sequence of the 3'-terminal region of turnip-yellow-mosaic-virus RNA.

Authors: M Silberklang; A Prochiantz; A L Haenni; U L Rajbhandary
Journal: Eur J Biochem Date: 1977-02

10. The primary structure of Bacillus subtilis and Bacillus stearothermophilus 5 S ribonucleic acids.

Authors: C A Marotta; F Varricchio; I Smith; S M Weissman
Journal: J Biol Chem Date: 1976-05-25 Impact factor: 5.157

19 in total

1. A small RNA of Mycoplasma capricolum that resembles eukaryotic U6 small nuclear RNA.

Authors: C Ushida; A Muto
Journal: Nucleic Acids Res Date: 1993-06-11 Impact factor: 16.971

2. Evolution of tRNAs and tRNA genes in Acholeplasma laidlawii.

Authors: R Tanaka; Y Andachi; A Muto
Journal: Nucleic Acids Res Date: 1991-12-25 Impact factor: 16.971

3. Construction of the mycoplasma evolutionary tree from 5S rRNA sequence data.

Authors: M J Rogers; J Simmons; R T Walker; W G Weisburg; C R Woese; R S Tanner; I M Robinson; D A Stahl; G Olsen; R H Leach
Journal: Proc Natl Acad Sci U S A Date: 1985-02 Impact factor: 11.205

4. Collection of published 5S, 5.8S and 4.5S ribosomal RNA sequences.

Authors: V A Erdmann; J Wolters; E Huysmans; R De Wachter
Journal: Nucleic Acids Res Date: 1985 Impact factor: 16.971

Review 5. Collection of published 5S and 5.8S RNA sequences and their precursors.

Authors: V A Erdmann
Journal: Nucleic Acids Res Date: 1982-01-22 Impact factor: 16.971

6. Collection of published 5S and 5.8S ribosomal RNA sequences.

Authors: V A Erdmann; J Wolters; E Huysmans; A Vandenberghe; R De Wachter
Journal: Nucleic Acids Res Date: 1984 Impact factor: 16.971

Review 7. Molecular biology and genetics of mycoplasmas (Mollicutes).

Authors: S Razin
Journal: Microbiol Rev Date: 1985-12

8. Collection of published 5S and 5.8S ribosomal RNA sequences.

Authors: V A Erdmann; E Huysmans; A Vandenberghe; R De Wachter
Journal: Nucleic Acids Res Date: 1983-01-11 Impact factor: 16.971

9. Generalized structures of the 5S ribosomal RNAs.

Authors: N Delihas; J Andersen
Journal: Nucleic Acids Res Date: 1982-11-25 Impact factor: 16.971

10. Unusual structural features of the 5S ribosomal RNA from Streptococcus cremoris.

Authors: H Neimark; J Andersen; N Delihas
Journal: Nucleic Acids Res Date: 1983-11-11 Impact factor: 16.971