Literature DB >> 36061848

Feasibility of Loop-Mediated Isothermal Amplification for Rapid Detection of Methicillin-Susceptible and Methicillin-Resistant Staphylococcus aureus in Tissue Samples.

Sang-Gyun Kim1,2, Gi Won Choi2, Won Seok Choi3, Chae Seung Lim4, Woong Sik Jang5, Ji Hoon Bae3.   

Abstract

Background: To date, few studies have investigated the feasibility of the loop-mediated isothermal amplification (LAMP) assay for identifying pathogens in tissue samples. This study aimed to investigate the feasibility of LAMP for the rapid detection of methicillin-susceptible or methicillin-resistant Staphylococcus aureus (MSSA or MRSA) in tissue samples, using a bead-beating DNA extraction method.
Methods: Twenty tissue samples infected with either MSSA (n = 10) or MRSA (n = 10) were obtained from patients who underwent orthopedic surgery for suspected musculoskeletal infection between December 2019 and September 2020. DNA was extracted from the infected tissue samples using the bead-beating method. A multiplex LAMP assay was conducted to identify MSSA and MRSA infections. To recognize the Staphylococcus genus, S. aureus, and methicillin resistance, 3 sets of 6 primers for the 16S ribosomal ribonucleic acid (rRNA) and the femA and mecA genes were used, respectively. The limit of detection and sensitivity (detection rate) of the LAMP assay for diagnosing MSSA and MRSA infection were analyzed.
Results: The LAMP result was positive for samples containing 103 colony-forming unit (CFU)/mL for 16S rRNA, 104 CFU/mL for femA, and 105 CFU/mL for mecA. The limits of detection for 16S rRNA and femA were not different between MSSA and MRSA. For the 10 MSSA-positive samples, the LAMP assay showed 100% positive reactions for 16S rRNA and femA and a 100% negative reaction for mecA. For the 10 MRSA-positive samples, the LAMP assay showed 100% positive reactions for 16S rRNA and mecA but only 90% positive reactions for femA. The sensitivity (detection rate) of the LAMP assay for identifying MSSA and MRSA in infected tissue samples was 100% and 90%, respectively. Conclusions: The results of this study suggest that the LAMP assay performed with tissue DNA samples can be a useful diagnostic method for the rapid detection of musculoskeletal infections caused by MSSA and MRSA.
Copyright © 2022 by The Korean Orthopaedic Association.

Entities:  

Keywords:  Loop-mediated isothermal amplification; Methicillin-resistant Staphylococcus aureus; Methicillin-susceptible Staphylococcus aureus

Mesh:

Substances:

Year:  2022        PMID: 36061848      PMCID: PMC9393274          DOI: 10.4055/cios21277

Source DB:  PubMed          Journal:  Clin Orthop Surg        ISSN: 2005-291X


Methicillin-susceptible or methicillin-resistant Staphylococcus aureus (MSSA or MRSA) is the most common pathogen in musculoskeletal infections.1234) Although early identification of the causative bacteria is essential for the treatment of S. aureus infections, conventional culture-based methods have limitations such as low sensitivity and a delay in diagnosis.5) These limitations often cause difficulties in the selection of appropriate antibiotics and evaluation of the infection status intraoperatively. Recently, genetic diagnostic tools have been developed to overcome the limitations of conventional diagnostic methods for the early detection and identification of disease-causing bacteria.67) Polymerase chain reaction (PCR), which amplifies minute amounts of bacterial DNA, is a genetic diagnostic method.7) Previous studies on the use of PCR targeting the 16S ribosomal ribonucleic acid (rRNA) gene, which is present in all bacteria, have shown excellent results for identifying infections.8) However, PCR requires specific expensive equipment and is a technique that many orthopedic surgeons are unfamiliar with. In addition, PCR has a relatively high detection limit and requires temperature control and 4–8 hours of analysis time.9) The loop-mediated isothermal amplification (LAMP) assay is a rapid isothermal technique that does not require temperature control.10) This assay has a relatively low detection limit and requires only 1–2 hours for analysis.1011) Previous studies have shown that the LAMP assay is useful for the rapid detection of pathogens in various fluid samples (e.g., blood, pleural, or synovial fluid).1213) However, in many orthopedic operations for musculoskeletal infection, it is difficult to obtain fluid samples to identify pathogens. To date, few studies have investigated the feasibility of the LAMP assay for identifying pathogens in tissue samples. In this study, we investigated the feasibility of LAMP for the rapid detection of MSSA and MRSA in tissue samples using the bead-beating DNA extraction method. We hypothesized that the LAMP assay using infected tissue samples would show high sensitivity (detection rate) for diagnosing MSSA or MRSA infection.

METHODS

This study was conducted after obtaining approval from the Institutional Review Boards (IRB No. 2020AS0143 and IRB No. 2020GR0317). Infected tissue samples were obtained during orthopedic operations for suspected musculoskeletal infection after obtaining informed consent from patients between December 2019 and September 2020 at two hospitals (Korea University Guro Hospital and Korea University Ansan Hospital). Patients who did not agree to donate tissue samples, presented difficulty in collecting tissue samples, and/or used antibiotics within 2 weeks before surgery were excluded from this study. Two tissue samples from the same location were collected from each patient. One tissue was submitted for standard microbiological tissue culture, and the other was stored at −80℃ for the LAMP assay in the tissue bank of each hospital. Thus, 20 tissue samples with MSSA (n = 10) or MRSA (n = 10) were collected. The preoperative demographic data of the enrolled patients are summarized in Table 1.
Table 1

Sex, Age, Diagnosis, and Infection Site in Patients with Infected Tissues

SampleSexAge (yr)DiagnosisInfection site
MSSA1Female81Periprosthetic joint infectionRt knee
MSSA2Female44Chronic osteomyelitisRt knee
MSSA3Male48Diabetes mellitus footRt foot
MSSA4Male48Diabetes mellitus footLt foot
MSSA5Male26Infected epidermoid cystLt 1st toe
MSSA6Male50Diabetes mellitus footLt foot
MSSA7Male45Chronic osteomyelitisLt cuboid
MSSA8Male53Chronic osteomyelitisLt tibia
MSSA9Male31Chronic osteomyelitisRt tibia
MSSA10Male59Chronic osteomyelitisLt tibia
MRSA1Female80Diabetes mellitus footLt 2nd toe
MRSA2Female50Diabetes mellitus footRt foot
MRSA3Female66Infective myofasciitisLt thigh
MRSA4Male40Acute postoperative infectionRt tibia
MRSA5Female68Infective bursitisLt ankle
MRSA6Female79Periprosthetic joint infectionLt hip
MRSA7Male52Diabetes mellitus footLt 4th toe
MRSA8Male53Diabetes mellitus footLt 4th toe
MRSA9Male27Chronic osteomyelitisRt femur
MRSA10Female20Chronic osteomyelitisLt ankle

MSSA: methicillin-susceptible Staphylococcus aureus, MRSA: methicillin-resistant Staphylococcus aureus, Rt: right, Lt: left.

Tissue Sample Preparation and DNA Extraction

Thawed tissue samples were homogenized in 800 µL of lysis buffer (FACS lysing solution; BD Bioscience, San Jose, CA, USA) using a tissue grinding tube (Bioprep-A20, Allsheng, Hangzhou, China) and homogenizer (Bioprep-6 homogenizer, Allsheng). The tissue grinding tube contained 3- and 6-mm metal beads and 1.4-mm ceramic beads. Homogenization was performed for 10 cycles of 30 seconds at a speed of 6 m/sec (Fig. 1). Next, the homogenate was centrifuged for 30 seconds at 5,000 rpm, and 800 µL of the supernatant was decanted for DNA extraction. DNA extraction was conducted using an NX-48 bacterial DNA kit (Genolution Inc., Seoul, Korea) and Nextractor NX-48 automated extractor (Genolution Inc.). The process, from tissue sample preparation to DNA extraction, was completed within 1 hour.
Fig. 1

Tissue sample preparation for loop-mediated isothermal amplification assay. Each tissue sample was homogenized in 800 µL of lysis buffer using a tissue grinding tube and homogenizer. Homogenization was performed for 10 cycles of 30 seconds at a speed of 6 m/sec. (A) Homogenizer (Bioprep-6 homogenizer, Allsheng). (B) Tissue grinding tube containing tissue sample, lysis buffer, and ceramic and metal beads. (C) Homogenate.

LAMP Assay

To recognize the S. genus, S. aureus, and methicillin resistance, we used 3 LAMP primer sets targeting the 16S rRNA and mecA and femA genes each; these were developed by Baek et al.14) and Lin et al.15) (Table 2). All LAMP primers were synthesized by Macrogen, Inc. (Seoul, Korea). LAMP assays were performed using an RNA amplification kit (Eiken Chemical Company, Tokyo, Japan). The LAMP reaction mixture was prepared with 12.5 µL of reaction buffer, 2 µL of enzyme mix, 1 µL of fluorescence detection reagent, 4 µL of distilled water, 2.5 µL of primer mix, and 3 µL of genomic DNA (final reaction volume: 25 µL). The composition of the LAMP primer mix included 2 µM of 2 outer primers (F3 and B3), 16 µM of 2 inner primers (FIP and BIP), and 5 µM of loop primers (loop B and loop F). The reaction tubes were loaded into a thermocycler (CFX-96, Bio-Rad, Korea) and incubated at 64℃ for 60 minutes.
Table 2

Sequences of Primers for the LAMP Assay Used to Detect MSSA and MRSA

Target genePrimerSequence (5′→3′)
16S rRNA*F3TGGAATTCCATGTGTAGCGG
B3AGGCGGAGTGCTTAATTGC
FIPTCGCACATCAGCGTCAGTTACA- ATGCGCAGAGATATGGAGGA
BIPAGATACCCTGGTAGTCCACGCC- CACTAAGGGGCGGAAACC
LFCCAGAAAGTCGCCTTCGCCACT
LBAAACGATGAGTGCTAAGTGTTAGG
femA F3ATGCTGGTGGTACATCAA
B3TGGTTTAATAAAGTCACCAACAT
FIPGGTCAATGCCATGATTTAATGCATA- GCATTCCGTCATTTTGCC
BIPCAGAAGATGCTGAAGATGCTGG- TCAATAATTTCAGCATTGTAACC
LFAATCATTTCCCATTGCACT
LBTGTAGTTAAATTCAA
mecA * F3TGATGCTAAAGTTCAAAAGAGT
B3GTAATCTGGAACTTGTTGACC
FIPAGGTGTGCTTACAAGTGCTAATAAT- CAACATGAAAAATGATTATGGCT
BIPTGACGTCTATCCATTTATGTATGGC- AGGTTCTTTTTTATCTTCGGTTA
LFTGAGGGTGGATAGCAGTACC
LBTGAGTAACGAAGAATAT

LAMP: loop-mediated isothermal amplification, MSSA: methicillin-susceptible Staphylococcus aureus, MRSA: methicillin-resistant Staphylococcus aureus, rRNA: ribosomal RNA.

*LAMP primers described by Baek et al. (2019).14) †LAMP primers described by Lin et al. (2017).15)

The results were determined by visual observation of the color change by naked eye in a single-blind manner. The green color change of the pH indicator was interpreted as positive for amplification of DNA. The LAMP assay was defined as positive for MSSA infection if the result was positive for 16S rRNA and femA and negative for mecA. However, it was defined as positive for MRSA infection if the result was positive for 16S rRNA, femA, and mecA (Fig. 2).
Fig. 2

Typical findings of the loop-mediated isothermal amplification (LAMP) assay for detecting methicillin-susceptible Staphylococcus aureus (A) and methicillin-resistant Staphylococcus aureus (B). (A) LAMP assay shows positive results for 16S ribosomal RNA (rRNA) and femA and a negative (Neg) result for mecA. (B) LAMP assay shows positive results for 16S rRNA, femA, and mecA. LAMP results were determined by naked-eye detection under normal light. The green color change of the pH indicator was interpreted as positive for the amplification of DNA.

Limit of Detection of LAMP Assay

To determine the limit of detection (LOD), MSSA or MRSA suspension (1.0 × 107 colony-forming units [CFU]/mL) was diluted 10 times in steps to 1.0 × 101 CFU/mL, and the LAMP assay was performed for 16S rRNA, femA, and mecA at each concentration.

Statistical Methods

Tissue samples with MSSA or MRSA were defined as positive for infection in this study. To investigate the feasibility of the LAMP assay for identifying MSSA and MRSA in tissue samples, the sensitivity (detection rate) of the assay was calculated for each bacterium. The sensitivity and specificity of the LAMP primers for the target genes were also calculated to evaluate the validity of the LAMP primers.

RESULTS

LOD of LAMP Assay

The LODs of the LAMP assay for 16S rRNA, femA, and mecA of MSSA and MRSA are shown in Table 3. The LAMP results were positive for simple samples containing 103 CFU/mL for 16S rRNA, 104 CFU/mL for femA, and 105 CFU/mL for mecA (Table 3, Fig. 3). The LODs of 16S rRNA and femA were not different between MSSA and MRSA.
Table 3

Detection Limits of the LAMP Assay for 16S rRNA and femA and mecA Genes of MSSA and MRSA

GeneDetection limit (CFU/mL)
MSSAMRSA
16S rRNA103103
femA 104104
mecA NA105

LAMP: loop-mediated isothermal amplification, rRNA: ribosomal RNA, MSSA: methicillin-susceptible Staphylococcus aureus, MRSA: methicillin-resistant Staphylococcus aureus, CFU: colony-forming unit, NA: not applicable.

Fig. 3

Images of 16S ribosomal RNA (rRNA), mecA, and femA loop-mediated isothermal amplification products of methicillin-susceptible Staphylococcus aureus (A) and methicillin-resistant Staphylococcus aureus (B) isolates at serially diluted concentrations (~101 to 107 CFU/mL). The green color change of the pH indicator was interpreted as positive for the amplification of DNA. CFU: colony-forming unit.

Sensitivity (Detection Rate) of LAMP Assay for Identifying MSSA and MRSA

For the 10 MSSA-positive samples, the LAMP assay showed 100% positive reactions for 16S rRNA and femA and a 100% negative reaction for mecA (Table 4). For the 10 MRSA-positive samples, the LAMP assay showed 100% positive reactions for 16S rRNA and mecA but only 90% for femA. For the femA-negative MRSA sample, the LAMP assay showed a positive reaction for 16S rRNA and mecA (Table 4). The sensitivity (detection rate) of the LAMP assay for diagnosing MSSA and MRSA in infected tissue samples was 100% and 90%, respectively.
Table 4

Results of the LAMP Assay to Detect rRNA and femA and mecA Genes

Sample16S rRNA femA mecA
MSSA1++
MSSA2++
MSSA3++
MSSA4++
MSSA5++
MSSA6++
MSSA7++
MSSA8++
MSSA9++
MSSA10++
MRSA1+++
MRSA2+++
MRSA3+++
MRSA4+++
MRSA5+++
MRSA6+++
MRSA7+++
MRSA8++
MRSA9+++
MRSA10+++

LAMP: loop-mediated isothermal amplification, rRNA: ribosomal RNA, MSSA: methicillin-susceptible Staphylococcus aureus, MRSA: methicillin-resistant Staphylococcus aureus.

Sensitivity and Specificity of LAMP Primers for 16S rRNA, femA, and mecA

The sensitivity and specificity of LAMP primers for 16S rRNA, femA, and mecA in 10 MSSA and 10 MRSA samples are summarized in Table 5. The sensitivities of the LAMP primers for 16S rRNA and femA were 100% and 95%, respectively. The sensitivity and specificity of the LAMP primer for mecA was 100% for all the samples.
Table 5

Sensitivity and Specificity of LAMP Primers for 16S rRNA and femA and mecA Genes

Target geneSensitivitySpecificity
16S rRNA100 (20/20)NA
femA 95 (19/20)NA
mecA 100 (10/10)100 (10/10)

Values are presented as percent (number).

LAMP: loop-mediated isothermal amplification, rRNA: ribosomal RNA, NA: not applicable.

DISCUSSION

The most important finding of this study is that the LAMP assay showed high sensitivity (detection rate) for determining the presence of MSSA or MRSA in infected tissue samples. To the best of our knowledge, this is the first experimental study to investigate the feasibility of the LAMP assay for diagnosing MSSA and MRSA infections in tissue samples. To extract bacterial DNA from the infected tissue, tissue samples were homogenized using a tissue grinding tube and homogenizer, and the homogenate was centrifuged before DNA extraction. The LAMP assay detected MSSA or MRSA infection in almost all (19/20) of the tissue samples in this study. Therefore, the results imply that a sufficient amount of DNA can be extracted and amplified via the tissue preparation and bead-beating DNA extraction methods used. Increased incidence of human diseases caused by food-borne pathogens is considered a major threat for public health worldwide. Accordingly, molecular diagnostic technologies for the rapid detection of food-borne pathogens have been developed. During the past few decades, numerous PCR-based assays have been proposed for the rapid detection of food-borne pathogens. However, the disadvantages of PCR-based assays (time consumption for determination, risk of cross contamination, low detection limit, and need for expensive equipment and reagents) posed obstacles for their broader application.16) The LAMP assay, which was developed by Notomi et al.17) in 2000, has emerged as an alternative to PCR-based methods and been widely used for microbial identification and diagnosis, as well as for the surveillance of infection diseases.16) Currently, LAMP is being used for the detection and identification of causative pathogens in patients with microbial infectious diseases, as it offers advantages of high sensitivity, specificity, rapid delivery of results, and cost-effectiveness.16) Previous studies have also indicated the diagnostic value of the LAMP assay for identifying MSSA or MRSA infection in human samples. Henares et al.13) reported a LAMP assay using pleural and synovial fluid samples with sensitivity and specificity values of 83.3% and 97.8%, respectively, for S. aureus detection. Misawa et al.12) also reported a LAMP assay for identifying MRSA in blood samples that showed 92.3% sensitivity and 100% specificity. In our study, the sensitivity (detection rate) of the LAMP assay for diagnosing MSSA and MRSA in infected tissue samples was 100% and 90%, respectively. Therefore, the LAMP assay can be considered a feasible diagnostic method for the rapid detection of S. aureus in tissue samples. The LODs of LAMP primers for the 16S rRNA and femA, and mecA genes have been previously reported. Xu et al.18) reported that LAMP was positive for samples containing 104 CFU/mL for 16S rRNA, 104 CFU/mL for femA, and 105 CFU/mL for mecA. Lin et al.15) also reported LODs of LAMP assays of 104 CFU/mL for 16S rRNA and femA and 105 CFU/mL for mecA. The detection limit of the LAMP assay was reported to be 104 CFU/mL for 16S rRNA, femA, and mecA in the study by Baek et al.14) In the current study, the results of the LOD test were comparable with those from previous studies (103 CFU/mL for 16S rRNA, 104 CFU/mL for femA, and 105 CFU/mL for mecA) (Table 3). Moreover, the LAMP primers showed an excellent detection rate for the target gene (Table 5). Therefore, the LAMP primers used in this study can be considered effective for diagnosing MSSA and MRSA infections. In this study, all experimental processes, including tissue sample preparation, DNA extraction, and LAMP assay, were completed within 2 hours. Rapid detection of disease-causing bacteria in tissue samples can be helpful for the diagnosis and treatment of musculoskeletal infections. Rapid detection also makes it possible to use appropriate antibiotics in the early stages of infection. In addition, the results of LAMP assays can be used to determine the treatment plan when a clear distinction between aseptic and septic loosening is not possible after joint replacement surgery. Diagnosis of periprosthetic joint infection is still challenging, and routine diagnostic tests have demonstrated high false-negative rates.19) Although the choice of treatment for septic loosening is re-implantation after removing the prosthesis and eradicating the causative bacteria,202122) strikingly high mortality rates have been reported before re-implantation.23) Therefore, rapid and direct detection of pathogens using LAMP assays can be helpful in preventing the unnecessary removal of prostheses. Moreover, it can also help confirm the eradication of the causative bacteria before re-implantation. In this study, the LAMP primers targeted only the 16S rRNA and femA genes of MSSA and MRSA. S. aureus is the most common pathogen in musculoskeletal infections; however, various other pathogens can also cause such infections.123) Although LAMP primers targeting the 16S rRNA gene can be used to evaluate the presence of infection, they are limited in terms of identifying the causative bacteria. This is one of the major limitations of genetic diagnostic methods, such as PCR and LAMP, compared with that of culture-based methods. To overcome this limitation, multiplex LAMP assays are required for identifying various pathogens that commonly cause musculoskeletal infections simultaneously. Therefore, we are planning to evaluate the diagnostic value of the LAMP assay for identifying other bacteria such as Streptococcus, Enterococcus, and Klebsiella species in tissue samples in the future. This study has several limitations. First, the sample size was relatively small. However, it was difficult to obtain a large number of samples because infected tissue samples were collected prospectively in this study. Second, other diagnostic values such as the specificity and the positive and negative predictive values of the LAMP assay could not be evaluated because this study was conducted with tissue samples in which MSSA or MRSA was identified in tissue culture. However, this study focused on evaluating the sensitivity (detection rate) of the LAMP assay because the primary aim was to evaluate whether a sufficient amount of bacterial DNA could be extracted from infected tissue samples for this assay. Further studies will be required to confirm the false-negative rate of the LAMP assay using noninfected tissues obtained from clean surgeries. Finally, in this study, it was not possible to compare the diagnostic value of the LAMP assay with that of other diagnostic methods, such as culture and PCR analysis. In conclusion, the LAMP assay performed with tissue DNA samples can be a useful diagnostic method for the rapid detection of musculoskeletal infections caused by MSSA and MRSA. Further research is needed to evaluate the diagnostic value of the LAMP assay for identifying other pathogenic bacteria in tissue samples.
  20 in total

1.  Loop-mediated isothermal amplification of DNA.

Authors:  T Notomi; H Okayama; H Masubuchi; T Yonekawa; K Watanabe; N Amino; T Hase
Journal:  Nucleic Acids Res       Date:  2000-06-15       Impact factor: 16.971

2.  Routine Diagnostic Tests for Periprosthetic Joint Infection Demonstrate a High False-Negative Rate and Are Influenced by the Infecting Organism.

Authors:  Michael M Kheir; Timothy L Tan; Noam Shohat; Carol Foltz; Javad Parvizi
Journal:  J Bone Joint Surg Am       Date:  2018-12-05       Impact factor: 5.284

3.  Improvement of detection of bacterial pathogens in normally sterile body sites with a focus on orthopedic samples by use of a commercial 16S rRNA broad-range PCR and sequence analysis.

Authors:  K Grif; I Heller; W M Prodinger; K Lechleitner; C Lass-Flörl; D Orth
Journal:  J Clin Microbiol       Date:  2012-05-02       Impact factor: 5.948

Review 4.  Loop-mediated isothermal amplification (LAMP): A novel rapid detection platform for pathogens.

Authors:  Yanmei Li; Penghui Fan; Shishui Zhou; Li Zhang
Journal:  Microb Pathog       Date:  2017-03-18       Impact factor: 3.738

5.  Trends in the epidemiology of osteomyelitis: a population-based study, 1969 to 2009.

Authors:  Hilal Maradit Kremers; Macaulay E Nwojo; Jeanine E Ransom; Christina M Wood-Wentz; L Joseph Melton; Paul M Huddleston
Journal:  J Bone Joint Surg Am       Date:  2015-05-20       Impact factor: 5.284

6.  Two-Stage Exchange Protocol for Periprosthetic Joint Infection Following Total Knee Arthroplasty in 245 Knees without Prior Treatment for Infection.

Authors:  Stephen M Petis; Kevin I Perry; Tad M Mabry; Arlen D Hanssen; Daniel J Berry; Matthew P Abdel
Journal:  J Bone Joint Surg Am       Date:  2019-02-06       Impact factor: 5.284

7.  Surgical site infection in the elderly following orthopaedic surgery. Risk factors and outcomes.

Authors:  Jeanne Lee; Robert Singletary; Kenneth Schmader; Deverick J Anderson; Michael Bolognesi; Keith S Kaye
Journal:  J Bone Joint Surg Am       Date:  2006-08       Impact factor: 5.284

8.  Application of loop-mediated isothermal amplification technique to rapid and direct detection of methicillin-resistant Staphylococcus aureus (MRSA) in blood cultures.

Authors:  Yoshiki Misawa; Atsushi Yoshida; Ryoichi Saito; Honami Yoshida; Katsuko Okuzumi; Nobue Ito; Mitsumasa Okada; Kyoji Moriya; Kazuhiko Koike
Journal:  J Infect Chemother       Date:  2007-06-21       Impact factor: 2.211

9.  Identification of orthopaedic infections using broad-range polymerase chain reaction and reverse line blot hybridization.

Authors:  Dirk Jan F Moojen; Sanne N M Spijkers; Corrie S Schot; Marc W Nijhof; H Charles Vogely; André Fleer; Abraham J Verbout; René M Castelein; Wouter J A Dhert; Leo M Schouls
Journal:  J Bone Joint Surg Am       Date:  2007-06       Impact factor: 5.284

Review 10.  PCR-based diagnostics for infectious diseases: uses, limitations, and future applications in acute-care settings.

Authors:  Samuel Yang; Richard E Rothman
Journal:  Lancet Infect Dis       Date:  2004-06       Impact factor: 25.071

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.