Literature DB >> 36045344

Hepatopancreas transcriptome analyses provide new insights into the molecular regulatory mechanism of fast ovary maturation in Macrobrachium nipponense.

Sufei Jiang1, Wenyi Zhang1, Yiwei Xiong1, Dan Cheng2, Jisheng Wang2, Shubo Jin1, Yongsheng Gong1, Yan Wu1, Hui Qiao3,4, Hongtuo Fu5,6.   

Abstract

BACKGROUND: Macrobrachium nipponense is an economically and ecologically important freshwater prawn that is widely farmed in China. In contrast to other species of marine shrimp, M. nipponense has a short sexual maturity period, resulting in not only high stocking densities, but also a reduced survival rate and increased risk of hypoxia. Therefore, there is an urgent need to study the molecular mechanisms underlying fast ovary maturation in this species.
RESULTS: Comparative transcriptome analysis was performed using hepatopancreatic tissue from female M. nipponense across five ovarian maturation stages to explore differentially expressed genes and pathways involved in ovarian maturation. In total, 118.01 Gb of data were generated from 15 transcriptomes. Approximately 90.46% of clean reads were mapped from the M. nipponense reference genome. A comprehensive comparative analysis between successive ovarian maturation stages generated 230-5814 differentially expressed genes. Gene Ontology (GO) enrichment was highly concentrated in the "biological process" category in all four comparison groups, and mainly focused on energy synthesis and accumulation, energy decomposition and transport. Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment results showed that, among 20 significantly enriched KEGG pathways, nine were involved in the synthesis, degradation, and metabolism of carbohydrates, lipids, and other nutrient intermediates, suggesting that the hepatopancreas has an important role in energy supply during ovarian maturation. Furthermore, the "Insect hormone biosynthesis" pathway was found to have a dominant role in the development of the ovary from immaturity to maturity, supporting the hypothesis that ecdysteroid- and juvenile hormone-signaling pathways have an important role in hepatopancreas regulation of ovarian maturation.
CONCLUSION: Taken together, this study sheds light on the role of the hepatopancreas in the molecular regulation of ovary maturation in M. nipponense. The present study provided new insights for understanding the mechanisms of reproductive regulation in crustaceans.
© 2022. The Author(s).

Entities:  

Keywords:  Hepatopancreas; Macrobrachium nipponense; Reproduction; Transcriptome analysis

Mesh:

Year:  2022        PMID: 36045344      PMCID: PMC9429573          DOI: 10.1186/s12864-022-08851-8

Source DB:  PubMed          Journal:  BMC Genomics        ISSN: 1471-2164            Impact factor:   4.547


Introduction

Macrobrachium nipponense, commonly known as the oriental river prawn, is widely distributed throughout China, except in Tibet and Qinghai province [1]. It is an economically important and popular aquacultural species because of its low susceptibility to disease and its delicious taste, with production exceeding 240,000 tons in China in 2020 [2]. The Yangtze River basin is the main area M. nipponense aquaculture, with Jiangsu province accounting for half of the M. nipponense aquaculture output in China. The short sexual maturity period of female M. nipponense leads to rapid mass self-reproduction in autumn [3]. During the breeding season, ovarian maturation of M. nipponense accelerates with increases in water temperature. By early autumn, newborn females develop to sexual maturity and lay eggs, only 45 days after hatching. This autumn reproduction produces numerous offspring, which results in the presence of multiple generations of prawns in aquaculture ponds. This can lead to reduced resilience and survival rates and increased risks of hypoxia [4]. The number of large prawns also decreases significantly during autumn reproduction, which seriously affected the economic benefits of prawn breeding. Therefore, it is of relevance to analyze the mechanisms involved in fast sexual maturation to provide insights that could help address these issues. The ovary is an important tissue in crustacean sexual maturity. Molecular studies of female M. nipponense ovary have primarily focused on transcriptome analyses of ovarian development stages [5-7]. Many genes, such as those encoding vitellogenin, vitellogenin receptor, cyclin A, opsin, gonad-inhibiting hormone, ribosomal protein L24, and cathepsin L, have been identified and demonstrated to have important roles in ovary maturation [8-14]. In addition to the ovaries, the hepatopancreas is also reported to have an important role in ovarian maturation, supplying not only energy, but also essential fatty acids and cholesterol for the synthesis of sex steroid hormones [15]. Furthermore, the hepatopancreas is an important site for the synthesis of vitellogenin. In several crustacean species, such as Carcinus maenas, Eriocheir sinensis, Marsupenaeus japonicas, Penaeus monodon, M. nipponense, and Scylla paramamosain, the hepatopancreas makes a significantly higher contribution to vitellogenin synthesis compared with the ovary [11, 16–19]. In previous studies, ovary transcriptomes of five developmental stages were constructed to detect the key pathways and genes involved in ovary maturation [6]. Many differentially expressed genes (DEGs) and enriched Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways were obtained after a series of comparative transcriptome analyses [9, 13, 14]. Based on these results, it was concluded that expression patterns of many genes involved in ovarian maturation, including those encoding vitellogenin and three cathepsin L family genes, were significantly higher in hepatopancreas than in ovary. Therefore, we hypothesized that the hepatopancreas in crustaceans had an important role in regulating ovarian maturation. However, the molecular mechanisms involved in the function of the hepatopancreas in ovarian maturation are unclear. In this study, we used high-throughput sequencing to obtain hepatopancreas transcriptomes of female M. nipponense during five ovarian maturation stages. DEGs between stages were identified and enriched to reveal the genes or pathways involved in the regulation of ovarian maturation. These data provided new insights for understanding the mechanisms of reproductive regulation in crustaceans. They also provided a theoretical basis for solving many of the issues facing M. nipponense aquaculture that result from fast sexual maturation in this species.

Material and methods

Sample preparation

Healthy adult female M. nipponense at different stages of ovarian maturation [N = 100, body weight (BW) ± SD: 2.24 ± 0.52 g] for transcriptome analysis were obtained from Dapu Scientific Experimental Base, Freshwater Fisheries Research Center (Wuxi, China). All prawns were kept in a recirculating aquarium system for 1 week. Ovarian staging was defined according to a previous study [12]. The ovaries were assigned to maturation classes by color: OI (transparent, undeveloped stage), OII (yellow, developing stage), OIII (light green, nearly-ripe stage), OIV (dark green, ripe stage), and OV (gray, spent stage). Eighteen prawns were randomly selected from each of the five ovarian maturation stages, with three repetitions per stage. The hepatopancreas from each prawn at each ovarian maturation stages was dissected into liquid nitrogen and stored at − 80 °C for further study.

The cDNA library construction and sequencing

Hepatopancreatic tissues from 15 samples from each stage were homogenized with RNAiso Plus Reagent (TaKaRa, Japan) to extract total RNA. The frozen samples were quickly transferred to a mortar precooled with liquid nitrogen and ground to powder. Then, additional RNAiso Plus was added and the mix ground again. The homogenate was transferred into a centrifuge tube and centrifuged at 12,000 ≥ g at 4 °C for 5 min. The supernatant was transferred into a new centrifuge tube and purified with chloroform and isopropyl alcohol. The resulting supernatant was transferred into a new centrifuge tube and centrifuged with 12,000×g at 4 °C for 10 min. The precipitate was dried and dissolved with RNA-free water. The purity and concentration of RNA were detected by a Nanodrop 2000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). The RNA integrity was evaluated by an Agilent 2100 (Agilent Technologies, Santa Clara, CA, USA). Three μg RNA per sample was used to construct the cDNA library by using a NEBNext Ultra RNA Library Prep Kit for Illumina (NEB, Ipswich, MA, USA) according to the manufacturer”s protocol. The RNA was purified and broken into small random fragments using poly-T oligo-attached magnetic beads (Life Technologies, Carlsbad, CA, USA). The first-strand cDNA was synthesized with random hexamers using mRNA as template and the second-strand cDNA was then synthesized by adding buffer, dNTPs, RNase H, and DNA polymerase I. The cDNA fragments in the library with a length of 150–200 bp were screened and purified using an Ampure XP system (Beckman Coulter, Beverly, MA, USA). The purified double-stranded cDNA was then repaired at the end, a-tailed, and sequenced. AMPure XP Beads were used for fragment size selection. Finally, a cDNA library was obtained by PCR enrichment. Qubit 2.0 was used for preliminary quantifications. Agilent 2100 was used to detect the library insert size. The prepared libraries were then sequenced on an Illumina HiSeq X Ten by Genepioneer Biotechnologies Company (Nanjing, China).

RNA-seq analysis

Raw data were filtered to obtain high quality clean data by removing adapters and low quality reads. The generated cleaned reads were then aligned to the M. nipponense reference genome (NCBI Accession No.: ASM1510439v1, https://ftp.cngb.org/pub/CNSA/data2/CNP0001186/CNS0254395/CNA0014632/) using Tophat2 to obtain the mapped data. The aligned reads from each sample were assembled by Stringtie (http://ccb.jhu.edu/software/stringtie). The expression levels of genes were calculated by reads per kilobase per million mapped reads (RPKM) [20]. Differential expression analysis, functional annotation, and functional enrichment were performed according to the gene expression levels in different samples. DEGs were determined by DESeq (www.bioconductor.org/packages/release/bioc/html/DESeq2.html), using a fold-change (FC) ≥2 and false discovery rate (FDR) < 0.05 as screening criteria.

GO and KEGG enrichment analysis of DEGs

Gene ontology (GO) enrichment (www.geeontology.org) and KEGG enrichment (https://www.kegg.jp/kegg/kegg1.html) were performed to find the GO terms and KEGG pathways that were significantly enriched in HE-I versus HE-II, HE-II versus HE-III, HE-III versus HE-IV, and HE-IV versus HE-V compared with the whole genome (E-value ≤10− 5).

Validation of RNA-Seq and further investigation of candidate genes

Nine DEGs were selected from the significantly enriched KEGG pathways to verify the RNA-seq results by qPCR. We also analyzed the expression profiles of these nine genes in five ovarian maturation stages. RNA isolation from tissue and cDNA synthesis were performed using an RNAiso Plus kit and a reverse transcriptase M-MLV kit (TaKaRa) according to the manufacturer’s protocols. The EIF gene of M. nipponense was used as an internal control gene [21] and the qPCR reaction system and procedures were consistent with our previous study [22]. Expression levels were calculated by the 2− ΔΔCT method [23] and the data were analyzed using one-way ANOVA and two-tailed Student’s t-test in SPSS 23.0. Data are presented as the mean ± standard deviation and differences were significant at P < 0.05. The amino acid sequences of two candidate genes were used to generate the phylogenetic trees with MEGA5.0 based on the neighbor joining (NJ) method and bootstrapping replications were 1000.

Results

Overview of hepatopancreas transcriptomes in different ovarian maturation stages

In total, 15 hepatopancreas transcriptomes were constructed for sequencing, generating 118.01 Gb of data. The clean reads of each sample were no less than 6.74 Gb of data. The average clean reads and clean data were 393,382,795 and 118,014,838,500, respectively; each set of sample data are detailed in Table 1. The average Q20 and Q30 percentage content was 97.54 and 93.21%, respectively. The average GC content of each sample was 41.40% (Table 2). Approximately 85.41–92.57% of clean reads mapped to the reference genome of M. nipponense, with an average mapping rate of 90.46%.
Table 1

Sequencing data statistics of 15 hepatopancreas transcriptomes

SampleClean readsClean data (bp)GC (%)Q20 (%)Q30 (%)Mapped readsMapping ratio (%)
HE-I-124,978,5237,493,556,90042.6797.2792.5944,412,15888.90
HE-I-231,115,8779,334,763,10042.1797.6193.2856,461,68790.73
HE-I-323,763,1137,128,933,90040.4397.3792.7542,457,92489.34
HE-II-126,105,8487,831,754,40042.2897.8093.7047,776,85091.51
HE-II-222,463,9456,739,183,50040.8397.8393.7540,983,49991.22
HE-II-330,265,5699,079,670,70041.5497.7293.4455,379,75391.49
HE-III-125,465,2417,639,572,30041.6297.7893.6146,945,22592.18
HE-III-225,596,1257,678,837,50041.4697.7993.6946,573,43790.98
HE-III-324,360,4547,308,136,20043.8197.8894.0044,798,10791.95
HE-IV-127,951,2738,385,381,90043.8997.7493.5851,525,22292.17
HE-IV-225,887,1567,766,146,80043.7797.7793.6647,927,37192.57
HE-IV-323,058,4626,917,538,60042.7597.7393.6042,271,78691.66
HE-V-124,816,7437,445,022,90036.0796.9392.0944,339,09189.33
HE-V-230,601,9579,180,587,10039.4997.0492.3653,538,35887.48
HE-V-326,952,5098,085,752,70038.1596.8092.0146,039,08585.41
total/average393,382,795118,014,838,50041.4097.5493.21711,429,55390.46
Table 2

Summary of significantly enriched GO terms

Comparison groupTerm_IDTerm descriptionGene numberq-value
HE-I vs. HE-IIGO:0045329carnitine biosynthetic process60.00010017
GO:0006101citrate metabolic process40.00017043
GO:0006633fatty acid biosynthetic process80.00017197
GO:0006085acetyl-CoA biosynthetic process40.0005792
GO:0006334nucleosome assembly60.00152825
GO:2001295malonyl-CoA biosynthetic process30.00247781
GO:0005975carbohydrate metabolic process100.00213486
GO:0030258lipid modification30.01559932
GO:0006807nitrogen compound metabolic process30.03237204
HE-II vs. HE-IIIGO:0048477oogenesis120.00156306
GO:0006633fatty acid biosynthetic process50.00120518
GO:0016042lipid catabolic process40.02989402
GO:0005975carbohydrate metabolic process50.04897362
HE-III vs. HE-IVGO:0002011morphogenesis of an epithelial sheet30.0030563
GO:0006635fatty acid beta-oxidation50.01525708
GO:0072089stem cell proliferation40.02496115
GO:0006857oligopeptide transport30.04034019
GO:0019439aromatic compound catabolic process20.03890067
HE-IV vs. HE-VGO:0006412translation584.45E-09
GO:0000398mRNA splicing, via spliceosome691.53E-05
GO:0015992proton transmembrane transport160.00052087
GO:0032543mitochondrial translation210.00528481
GO:0051301cell division710.0047298
GO:0006364rRNA processing330.00563453
GO:0015986ATP synthesis coupled proton transport110.00516878
GO:0040035hermaphrodite genitalia development180.00848067
GO:0071902positive regulation of protein serine/threonine kinase activity80.01193306
GO:0006633fatty acid biosynthetic process190.01214723
GO:0006754ATP biosynthetic process90.01548962
GO:0008406gonad development340.02115767
GO:0006383transcription by RNA polymerase III70.02786654
GO:0042273ribosomal large subunit biogenesis70.0263184
GO:0006085acetyl-CoA biosynthetic process60.03171148
Sequencing data statistics of 15 hepatopancreas transcriptomes Summary of significantly enriched GO terms

DEG identification

Comparative transcriptome analyses in HE-I versus HE-II, HE-II versus HE-III, HE-III versus HE-IVIV and HE-IV versus HE-V were performed to identify DEGs involved in ovarian maturation (log2 ratio ≥ 1, P < 0.05). In HE-I versus HE-II, 535 DEGs were identified, with 229 upregulated and 306 downregulated. In HE-II versus HE-III and HE-III versus HE-IV, there were 230 (148 upregulated and 82 downregulated) and 481 DEGs (266 upregulated and 215 downregulated), respectively. The number of DEGs detected in HE-IV versus HE-V (5814) was nearly 10 times that in other comparisons, with 3028 upregulated and 2786 downregulated. The results of the DEG heat map analysis in HE-I versus HE-II, HE-II versus HE-III, HE-III versus HE-IV and HE-IV versus HE-V are shown in Fig. 1. All these results indicated that the expression pattern of unigenes in four comparison groups were significantly different, especially in HE-IV versus HE-V.
Fig. 1

Heatmap of a total six samples in different comparison groups. A HE-I vs. HE-II, B HE-II vs. HE-III, C HE-III vs. HE-IV, D HE-IV vs. HE-V. The expression level of DEGs descended as color changed from deep red to deep blue based on FPKM value

Heatmap of a total six samples in different comparison groups. A HE-I vs. HE-II, B HE-II vs. HE-III, C HE-III vs. HE-IV, D HE-IV vs. HE-V. The expression level of DEGs descended as color changed from deep red to deep blue based on FPKM value

GO enrichment of DEGs

For GO enrichment (Fig. 2), all DEGs in each comparison group were categorized into three groups: molecular functions, cellular components, and biological processes. In HE-I versus HE-II, there were 14, 10, and 23 GO terms in these groups, respectively, among which the highest classification terms were “cell” and “cell part” (203 DEGs). In HE-II versus HE-III, the enriched number of GO terms was 14, eight, and 20, respectively, and “binding” was the most-represented classification term (89 DEGs). In HE-III versus HE-IV, there were 16, 11, and 22 enriched GO terms in the three categories, respectively, and the “cell” terms in the “cellular component” category was the highest classification terms (209 DEGs). In HE-IV versus HE-V, there were 16, 13, and 23 enriched terms, respectively, and “cellular process” terms in “biological process”were the highest classification terms (2431 DEGs). In all four comparison groups, the “biological process” category had the most GO terms (Table 2; q-value < 0.05).
Fig. 2

GO enrichment analysis of DEGs in different comparison groups. A HE-I vs. HE-II, B HE-II vs. HE-III, C: HE-III vs. HE-IV, D: HE-IV vs. HE-V

GO enrichment analysis of DEGs in different comparison groups. A HE-I vs. HE-II, B HE-II vs. HE-III, C: HE-III vs. HE-IV, D: HE-IV vs. HE-V

KEGG pathway enrichment of DEGs

All the DEGs in each comparison group were also analyzed for KEGG pathway enrichment. In HE-I versus HE-II, 126 DEGs were enriched into 95 KEGG pathways. In HE-II versus HE-III, there were 49 DEGs grouped into 48 KEGG pathways. In HE-III versus HE-IV, 131 DEGs were enriched into 98 KEGG pathways, whereas in, HE-IV versus HE-V, the DEG number was 1149 and the KEGG pathway number was 137. The top 20 significantly enriched KEGG pathways in each comparison group are showed in Fig. 3. The top 20 most significantly enriched KEGG pathways (q-value < 0.05) in each comparison group are summarized in Table 3.
Fig. 3

KEGG pathway enrichment analysis of DEGs in different comparison groups. A HE-I vs. HE-II, B: HE-II vs. HE-III, C HE-III vs. HE-IV, D HE-IV vs. HE-V

Table 3

Summary of enriched significantly KEGG pathways

Comparison groupPathwaysPathway IDGene numberq-value
HE-I vs. HE-IIGlycosaminoglycan degradationmap0053180.0005225
Insect hormone biosynthesismap0098170.000394
Amino sugar and nucleotide sugar metabolismmap00520120.0007705
Lysosomemap04142160.0020308
Pyruvate metabolismmap0062070.0075439
Glycosphingolipid biosynthesis - ganglio seriesmap0060440.011246
Other glycan degradationmap0051160.02767
HE-II vs. HE-IIIInsect hormone biosynthesismap0098173.52E-07
HE-III vs. HE-IVInsect hormone biosynthesismap0098194.91E-06
Metabolism of xenobiotics by cytochrome P450map00980115.61E-05
Drug metabolism - cytochrome P450map00982100.00015748
Butanoate metabolismmap0065070.00042295
Fatty acid degradationmap00071100.00050501
Fatty acid elongationmap0006260.00047923
Drug metabolism - other enzymesmap00983100.01395453
HE-IV vs. HE-VOxidative phosphorylationmap00190573.23E-11
Ribosome biogenesis in eukaryotesmap03008471.90E-06
Ribosomemap03010614.97E-05
RNA transportmap03013700.00819226
Biosynthesis of unsaturated fatty acidsmap01040140.03374109
KEGG pathway enrichment analysis of DEGs in different comparison groups. A HE-I vs. HE-II, B: HE-II vs. HE-III, C HE-III vs. HE-IV, D HE-IV vs. HE-V Summary of enriched significantly KEGG pathways

Transcriptome validation of RNA-seq with RT-qPCR

To validate the gene expression level by RNA-seq, nine genes were randomly selected from 20 significantly enriched KEGG pathways for qPCR validation. The nine genes (bgl, bNa, ipc, CYP-2L1l-3, trp, hcd, fep3, V-pasd1, and 40rib25) are detailed in Fig. 4A. Primers were designed by Primer 5.0 and are listed in Table 4. The qPCR results showed consistent results with those from transcriptome expression data (Fig. 4B), which confirmed the accuracy by transcriptome analysis (P < 0.05).
Fig. 4

qPCR validation of RNA-Seq. A Summarized information of 9 selected DEGs. B Expression comparison of the selected genes by RNA-Seq and qPCR. The fold changes by RNA-Seq and qPCR were calculated by FPKM and 2− ΔΔCT, respectively. qPCR data are shown as means ± SD (n = 3)

Table 4

List of primers used for qPCR

Gene nameAbbreviation nameForward and reverse primer (5′ -3′)
beta-glucuronidase-likebglCACTTGGAAATCATTGAGCAGCA TTCAGCCTGGTATTCTTCTGTCC
beta-N-acetylglucosaminidasebNa

AAGACTCTCCGGTGTTTCCTTAC

GTAGACAGGGAAAGAGTGTGTGT

Putative inorganic phosphate cotransporteripc

GGGGAATCAAACAATCACAGCTT

TCTGTTTGGGTTTTGGTTCGTTC

cytochrome P450 2 L1-like isoform X3CYP-2L1l-3

CATTCTCTTCCTCTCCCTCGTTC

AGGGCATCCTTCATCAGTTTGTA

Threonine-rich proteintrp

AGGAGGAATGTTGAAAGCCGTAT

CGGAATCAGACGAAGAAAAGCAC

hydroxyacyl-coenzyme A dehydrogenasehcd

CAGATGCAATACAACGATTGGGT

TGCATTCAACTGTGACTTTTCCC

Putative fatty acid elongation protein 3fep3

CGAGAAACGACGATGGATGAAAG

CATGATTGCCCAGGACATAGAGA

V-type proton ATPase subunit d 1V-pasd1

TTGAAGGAGCTGGAAACAATCCT

TGTCAATCTTTGCCCTGTGTTTC

40S ribosomal protein S2540rib25

CCCAAGAAGGATACCAAGGGAAA

TCCGGTGATCTTGAGTCTTTCAG

qPCR validation of RNA-Seq. A Summarized information of 9 selected DEGs. B Expression comparison of the selected genes by RNA-Seq and qPCR. The fold changes by RNA-Seq and qPCR were calculated by FPKM and 2− ΔΔCT, respectively. qPCR data are shown as means ± SD (n = 3) List of primers used for qPCR AAGACTCTCCGGTGTTTCCTTAC GTAGACAGGGAAAGAGTGTGTGT GGGGAATCAAACAATCACAGCTT TCTGTTTGGGTTTTGGTTCGTTC CATTCTCTTCCTCTCCCTCGTTC AGGGCATCCTTCATCAGTTTGTA AGGAGGAATGTTGAAAGCCGTAT CGGAATCAGACGAAGAAAAGCAC CAGATGCAATACAACGATTGGGT TGCATTCAACTGTGACTTTTCCC CGAGAAACGACGATGGATGAAAG CATGATTGCCCAGGACATAGAGA TTGAAGGAGCTGGAAACAATCCT TGTCAATCTTTGCCCTGTGTTTC CCCAAGAAGGATACCAAGGGAAA TCCGGTGATCTTGAGTCTTTCAG

Further investigation of candidate genes

Furthermore, we analyzed the transcription levels of the nine genes during the five ovarian maturation stages (Fig. 5). Bgl showed the highest expression in O-II (P < 0.05), but was relatively low in other stages. The bNa also displayed significantly higher expression in O-II (P < 0.05), but very low expression in O-IV and O-I (P < 0.05). The ipc was negatively correlated with ovarian maturation (P < 0.05). CYP-2L1l-3 showed dominant expression in O-III (P < 0.05), whereas trp had a similar expression profile to that of bNa. The hcd also showed its highest expression in O-II (P < 0.05), with relatively low expression in the other stages. fep3 was expressed mainly expressed in O-II and O-V (P < 0.05). V-pasd1 showed its highest expression in O-II (P < 0.05). 40rib25 displayed significant higher expression in O-II (P < 0.05), but was low levels in the other stages.
Fig. 5

Expression profiles of 9 genes in five ovary stages. A bgl, B bNa, C ipc, D CYP-2L1l-3, E trp, F hcd, G fep3, H V-pasd1, I: 40rib25. Different ovarian stages expressions: OI undeveloped stage, OII developing stage, OIII nearly-ripe stage, OIV ripe stage, OV spent stage. Data are shown as mean ± SD (n = 3). Statistical analyses were performed with one-way ANOVA analysis. Different letters denote significant differences (P < 0.05)

Expression profiles of 9 genes in five ovary stages. A bgl, B bNa, C ipc, D CYP-2L1l-3, E trp, F hcd, G fep3, H V-pasd1, I: 40rib25. Different ovarian stages expressions: OI undeveloped stage, OII developing stage, OIII nearly-ripe stage, OIV ripe stage, OV spent stage. Data are shown as mean ± SD (n = 3). Statistical analyses were performed with one-way ANOVA analysis. Different letters denote significant differences (P < 0.05) The bNa and ipc were selected to for evolutionary analysis. Several amino acid sequences of beta-N-acetylglucosaminidase and a putative inorganic phosphate cotransporter in crustaceans were deduced and a phylogenetic tree was built to determine the phylogenetic relationships based on the NJ method (Fig. 6A,B). The results showed that bNa of M. nipponense was most closely related to that from Palaemon carincauda. These clustered into one branch with other beta-N-acetyl glucosaminidases from Penaeus japonicas, P. monodon, Penaeus vannamei, and Penaeus chinensis. Beta-N-acetyl glucosaminidases from Procambarus clarkii and Cherax quadricarinatus were most closely related and clustered with Homarus americanus and Portunus trituberculatus into another branch. The putative inorganic phosphate cotransporter genes of P. vannamei, P. monodon, and P. japonicas first clustered together and then further clustered with ipc of M. nipponense into one branch. The genes from P. clarkii, C. quadricarinatus, and H. americanus first clustered together and then clustered with P. trituberculatus and Chionoecetes opilio into another branch. The gene from P. chinensis clustered alone into one branch.
Fig. 6

Phylogenetic tree of amino acid sequence. A bNa, B ipc. The numbers below the node indicate the bootstrap value

Phylogenetic tree of amino acid sequence. A bNa, B ipc. The numbers below the node indicate the bootstrap value

Discussion

The hepatopancreas is the largest digestive and nutrient storage organ in crustaceans and has an important role in carbohydrate and lipid metabolism, nutritional status, and energy storage and decomposition [24-26]. Nutrients are stored in the hepatopancreas and transported to gonads, muscles, and other tissues during growth and reproduction. It is also considered as a major lipid storage organ, similar to fat bodies in insects and vertebrates [27]. In crustaceans, the hepatopancreas is an important site for reproductive steroid hormone biosynthesis and catabolism and some biosynthetic steps in metabolic pathways, such as those producing sex steroid hormones and vitellogenin [26, 28–31]. Therefore, the hepatopancreas was hypothesized to have an important role in regulating gonad maturation in crustaceans. Previous studies of hepatopancreatic transcriptomes in M. nipponense mainly focused on hypoxic and nitrite stress, toxicity stress, virus infection, nutrition metabolism, and environmental stress [32-39]. In other crustaceans, hepatopancreas transcriptome analyses were performed to investigate the relationships between nutrition and male reproduction in Eriocheir sinensis [40]. To gain new insights into the role of the hepatopancreas in ovarian maturation of M. nipponense, we constructed systematic hepatopancreas transcriptomes from five ovary maturation stages in this species. In total, 90.46% of the clean reads obtained mapped to the M. nipponense reference genome [41], indicating that the transcriptomes had good coverage. The GO enrichment results showed that DEGs was highly concentrated in synthesis and metabolic processes of nutrients and energy during ovarian maturation. Thus, the hepatopancreas was likely to undergo biological changes during ovarian development. During the HE-I–HE-III stages, the hepatopancreas, as the energy supply organ, was mainly involved in the synthesis and accumulation of energy substances, carbohydrates, and lipids. From HE-III to HE-IV, energy substrates were broken down and transported to the ovary. From HE-IV to HE-V, a new round of energy material synthesis began. KEGG enrichment results also indicated that nearly half of the pathways identified were involved in the synthesis, degradation, and metabolism of carbohydrates, lipids, and other nutrient intermediates, suggesting that the hepatopancreas has an important role in energy supply during ovarian maturation. In our previous ovary transcriptomes repots, the most significantly enriched pathway was the lysosome pathway (containing seven DEGs) in stage III versus IV, and this pathway was not significant enriched in the other comparison groups [6]. The gene encoding cathepsin L in this pathway shows higher expression in the hepatopancreas compared with ovary and has an important role in promoting ovarian maturation in M. nipponense [9, 13, 14]. Lysosomes were proposed to have an important part in the degradation of vitellogenin and were suggested to be involved in energy redistribution [42, 43]. Thus, it is widely accepted that lysosomes are related to gonadal development in most fish [14]. Crustacean ovary maturation involves the gradual accumulation of yolk, and the hepatopancreas provides nutrition for ovarian maturation [44, 45]. Carbohydrates, in the form of a variety of glycosylated products, are important functional groups in reproductive biology [46]. In zebrafish, the glycosaminoglycan biosynthesis pathway is associated with ovarian follicle activation [47]. In crustaceans, during ovarian growth, large amounts of glycoproteins are synthesized, forming the cortical vesicles and yolk granules of mature oocytes [48, 49]. In addition, lipids are also an important component of ovarian development [50]. In crustaceans, the most important energy materials transported to the ovary by the hepatopancreas is vitellogenin [51-53]. In decapods, as a precursor of Vitellin, vitellogenin is a high-density lipoprotein produced in the hepatopancreas in females and serves as an important source of proteins, lipids, and carbohydrates for the developing embryo [54]. The fatty acid degradation pathway is also associated with gonadal development in crabs [55, 56]. Based on the above research, we further hypothesized that the hepatopancreas of crustaceans regulated ovarian maturation through the lysosomal pathway. We further analyzed the expression profiles of nine genes from these significantly enriched KEGG pathways in ovaries of different maturation stages. The results showed that seven DEGS were dominantly expressed in O-II, which is the vitellogenesis stage, indicating they might be involved in vitellogenesis. The above-described previous studies supported our results that enriched pathways from hepatopancreas were involved in ovary maturation. Furthermore, our results also suggested a new way to control rapid ovarian maturation in M. nipponense by regulating molecular nutritional signaling. As a next step, we will analyze the gene structure, spatial and temporal expression patterns, biological functions, and mutual regulatory relationships of these candidate genes in these important pathways to reveal their roles in ovarian maturation. Conspicuously, “Insect hormone biosynthesis” was the only pathway enriched in the HE-II versus HE-III stage and participated in the development of the ovary from immaturity to maturity. This pathway is important in molting in insects. It mainly involves the synthesis of two terpenoids, ecdysteroid and juvenile hormone, which work in a synergistic manner to regulate development, metamorphosis, and reproduction [57-59]. In M. nipponense, as well as other crustaceans [60-62], females lay eggs after molting off the exoskeleton under favorable conditions, which means that the reproductive cycle occurs synchronously with the molting cycle. Many genes related to both ecdysteroid- and juvenile hormone signaling have been studied and proved to be involved in reproduction in crustaceans [63-66]. Thus, our results supported the important role of ecdysteroid and juvenile hormone signaling pathways in the hepatopancreatic regulation of ovarian maturation. In subsequent studies, we will conduct independent functional analysis of these DEG genes and determine their regulatory mechanisms in ovary maturation.

Conclusions

Taken together, this study shed light on the role of the hepatopancreas in the molecular regulation of ovary maturation in M. nipponense. The results showed that nearly half of the significantly enriched pathways linked to nutrient metabolism and one insect hormone synthesis pathway were involved throughout ovarian maturation. This provided new insights into nutrition regulation and hormone regulation of ovarian maturation in crustaceans. Considerable efforts have been made to detect important pathways and functional genes related to the molecular nutritional-signaling regulation of reproduction. Subsequent functional validation studies of these candidate genes are necessary. We will analyze the gene structure, spatial and temporal expression patterns, biological functions, and mutual regulatory relationships of candidate genes in these important pathways to reveal their roles in ovarian maturation. Further studies on these genes and pathways will expand our understanding of the mechanism of fast ovary maturation in M. nipponense.
  50 in total

Review 1.  Ecdysteroid hormone action.

Authors:  Klaus-Dieter Spindler; C Hönl; Ch Tremmel; S Braun; H Ruff; M Spindler-Barth
Journal:  Cell Mol Life Sci       Date:  2009-12       Impact factor: 9.261

2.  Differential gene and transcript expression analysis of RNA-seq experiments with TopHat and Cufflinks.

Authors:  Cole Trapnell; Adam Roberts; Loyal Goff; Geo Pertea; Daehwan Kim; David R Kelley; Harold Pimentel; Steven L Salzberg; John L Rinn; Lior Pachter
Journal:  Nat Protoc       Date:  2012-03-01       Impact factor: 13.491

3.  Variation in lipid composition of Chinese mitten-handed crab, Eriocheir sinensis during ovarian maturation.

Authors:  X Wen; L Chen; C Ai; Z Zhou; H Jiang
Journal:  Comp Biochem Physiol B Biochem Mol Biol       Date:  2001-08       Impact factor: 2.231

Review 4.  Ecdysteroid and juvenile hormone biosynthesis, receptors and their signaling in the freshwater microcrustacean Daphnia.

Authors:  Hitoshi Miyakawa; Tomomi Sato; You Song; Knut Erik Tollefsen; Taisen Iguchi
Journal:  J Steroid Biochem Mol Biol       Date:  2017-12-13       Impact factor: 4.292

5.  Comparative transcriptome analysis reveals molecular strategies of oriental river prawn Macrobrachium nipponense in response to acute and chronic nitrite stress.

Authors:  Zhixin Xu; Tongyu Li; Erchao Li; Ke Chen; Zhili Ding; Jian G Qin; Liqiao Chen; Jinyun Ye
Journal:  Fish Shellfish Immunol       Date:  2015-12-12       Impact factor: 4.581

6.  Function analysis and molecular characterization of cyclin A in ovary development of oriental river prawn, Macrobrachium nipponense.

Authors:  Zhenyu Zhou; Hongtuo Fu; Shubo Jin; Hui Qiao; Wenyi Zhang; Sufei Jiang; Yiwei Xiong; Yongsheng Gong; Yuning Hu; Xinchi Gu; Yan Wu
Journal:  Gene       Date:  2021-03-20       Impact factor: 3.688

7.  Structural characterization of the N-glycan moiety and site of glycosylation in vitellogenin from the decapod crustacean Cherax quadricarinatus.

Authors:  Isam Khalaila; Jasna Peter-Katalinic; Clarence Tsang; Catherine M Radcliffe; Eliahu D Aflalo; David J Harvey; Raymond A Dwek; Pauline M Rudd; Amir Sagi
Journal:  Glycobiology       Date:  2004-06-02       Impact factor: 4.313

8.  Transcriptome analysis of five ovarian stages reveals gonad maturation in female Macrobrachium nipponense.

Authors:  Yuning Zhang; Sufei Jiang; Hui Qiao; Yiwei Xiong; Hongtuo Fu; Wenyi Zhang; Yongsheng Gong; Shubo Jin; Yan Wu
Journal:  BMC Genomics       Date:  2021-07-06       Impact factor: 3.969

9.  Insights into Sexual Precocity of Female Oriental River Prawn Macrobrachium nipponense through Transcriptome Analysis.

Authors:  Hongxia Jiang; Xilian Li; Yuhang Sun; Fujun Hou; Yufei Zhang; Fei Li; Zhimin Gu; Xiaolin Liu
Journal:  PLoS One       Date:  2016-06-09       Impact factor: 3.240

10.  Validation and Evaluation of Reference Genes for Quantitative Real-Time PCR in Macrobrachium Nipponense.

Authors:  Yuning Hu; Hongtuo Fu; Hui Qiao; Shengming Sun; Wenyi Zhang; Shubo Jin; Sufei Jiang; Yongsheng Gong; Yiwei Xiong; Yan Wu
Journal:  Int J Mol Sci       Date:  2018-08-01       Impact factor: 5.923

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.