Genome-wide screening identified SEC61A1 as an essential factor for mycolactone-dependent apoptosis in human premonocytic THP-1 cells.

Buruli ulcer is a chronic skin disease caused by a toxic lipid mycolactone produced by Mycobacterium ulcerans, which induces local skin tissue destruction and analgesia. However, the cytotoxicity pathway induced by mycolactone remains largely unknown. Here we investigated the mycolactone-induced cell death pathway by screening host factors using a genome-scale lenti-CRISPR mutagenesis assay in human premonocytic THP-1 cells. As a result, 884 genes were identified as candidates causing mycolactone-induced cell death, among which SEC61A1, the α-subunit of the Sec61 translocon complex, was the highest scoring. CRISPR/Cas9 genome editing of SEC61A1 in THP-1 cells suppressed mycolactone-induced endoplasmic reticulum stress, especially eIF2α phosphorylation, and caspase-dependent apoptosis. Although previous studies have reported that mycolactone targets SEC61A1 based on mutation screening and structural analysis in several cell lines, we have reconfirmed that SEC61A1 is a mycolactone target by genome-wide screening in THP-1 cells. These results shed light on the cytotoxicity of mycolactone and suggest that the inhibition of mycolactone activity or SEC61A1 downstream cascades will be a novel therapeutic modality to eliminate the harmful effects of mycolactone in addition to the 8-week antibiotic regimen of rifampicin and clarithromycin.

Introduction

Buruli ulcer (BU) is a chronic skin disease caused by Mycobacterium ulcerans, a pathogen that lives in aquatic environments. The disease is reported mainly in West Africa, but cases are also found in parts of Asia, South America, the Western Pacific and Australia [1]. Children are most affected in West Africa and, if left untreated, they can develop lifelong disabilities and disfigurements, often causing stigma. Thus, the World Health Organization designated BU as a neglected tropical disease.

The macrolide exotoxin mycolactone is the virulence factor responsible for BU induces skin destruction, chronic skin ulceration and osteomyelitis in severe cases [2]. Mycolactone is detected at high levels in skin lesions; however, it also diffuses at the systemic level and suppresses immune responses [3]. An animal study showed that mycolactone is responsible for tissue damage and immune suppression [4]. Intradermal inoculation of M. ulcerans in Guinea pigs produced skin ulcerations similar to those of human BU [4]. We previously showed that M. ulcerans clones lacking a plasmid that encodes genes essential for mycolactone synthesis had no pathologic effects in mice [5]. Intravenously injected mycolactone accumulates in the spleen of mice, and the mycolactone has a higher affinity for mononuclear cell subsets than for neutrophils [6]. Indeed, it was suggested that mycolactone affects circulating lymphocytes and alters their protective immune function, which contributes to the immune evasion of M. ulcerans [6]. The essential host factors and signal transduction pathways that mediate the action of mycolactone are an area of active investigation.

In vitro studies showed that mycolactone blocks the translocation of nascent proteins across the ER membrane, and similar inhibitors such as CT7, CT8, and ipomoeassin F directly target the ER Sec61 translocon [7-12]. The SEC61α amino acid mutation R66G partly rescued mycolactone-induced cell death and protein translocation in HEK293 cells [11]. A structual study also showed that mycolactone binds the Sec61 translocon [13]. On the other hand, a haploid genetic screen revealed that the histone methyltransferase SETD1B is a mediator of mycolactone-induced cell death in KBM-7 cells, a chronic myelogenous leukemia cell line [14]. The activating transcription factor 4 (ATF4) also affects cell death pathways through the ER stress response in HeLa cells [15]. In this paper, we employed genome-wide screening with CRISPR/Cas9 technology to further the analysis of molecular pathways in mycolactone-induced cell death.

Recent advancements in CRISPR/Cas9 technology have enabled gene disruption studies in mammalian cells on a genome-wide scale [16]. A genome-wide CRISPR knockout (GeCKO) screening strategy has been utilized to investigate pathogen–host interactions [17] and the cytotoxic pathways induced by toxic reagents [18]. Human lenti-CRISPR/Cas9 knockout pooled libraries (v2) containing six small guide (sg) RNAs per gene, target the conserved 5′ coding exons of 19,050 human genes. Compared with siRNAs, the CRISPR/Cas9 system has higher targeting specificity and fewer off-target effects [19]. Therefore, we employed CRISPR knockout screening with human GeCKO sgRNA libraries to conduct comprehensive and unbiased loss-of-function screens to identify genes necessary for mycolactone-induced cell death in human premonocytic THP-1 cells.

Methods

Cell cultures and reagents

Human premonocytic THP-1 cells were obtained from the American Type Culture Collection (Manassas, VA, USA). Cells were cultured in RPMI 1640 medium (Sigma-Aldrich, St. Louis, MO, USA) supplemented with 10% fetal calf serum (Sigma-Aldrich) and 100 U/mL penicillin/100 μg/mL streptomycin (Sigma-Aldrich). Lenti-X 293T cells (Takara Bio Inc., Otsu, Shiga, Japan) were cultured in Dulbecco’s modified Eagle’s medium (Wako Pure Chemical Industries, Ltd., Osaka, Japan) supplemented with 10% fetal calf serum, 100 U/mL penicillin and 100 μg/mL streptomycin. The cell number and viability were measured by the trypan blue exclusion assay using an automatic cell counter (Countess; Life Technologies, Carlsbad, CA, USA).

Synthetic mycolactone A/B was provided as an ethanol-diluted solution (1 mg/mL) by Dr. Yoshito Kishi, Department of Chemistry and Chemical Biology, Harvard University [20]. The mycolactone A/B solution was diluted in the culture medium at final concentrations of 3, 30 and 300 ng/mL. Ethanol diluted in the culture medium was used as the solvent control. Actinomycin D (ActD; Sigma-Aldrich) was used to induce apoptosis as a control. Thapsigargin (Wako) was used to induce ER stress as a control. z-Asp-Glu-Val-Asp-fluoromethyl ketone (Z-DEVD-FMK), a pan-caspase inhibitor, was purchased from Cayman Chemical (Ann Arbor, MI, USA). The DEVD-FMK peptide inhibits caspase-3,7, 8 and 9 [21, 22].

Lentivirus production and screening for mycolactone resistance

The human GeCKO v2 pooled library was a gift from Feng Zhang (Addgene, Cambridge, MA, USA; #1000000048). The GeCKO library was divided into two libraries, A and B. Each library was co-transfected with pCMV-VSV-G (RIKEN, Wako, Saitama, Japan) and psPAX2 (gift from Didier Trono; Addgene plasmid #12260; http://n2t.net/addgene:12260; RRID: Addgene_12260) into Lenti-X 293T cells using PEI-MAX (Polysciences, Warrington, PA, USA). Lentiviral particles from the culture supernatant were filtered through a 0.45-μm ultra-low protein-binding filter (Merck Millipore, Bedford, MA, USA) and concentrated by ultracentrifugation (50,000 × g for 2 h). For lentivirus transduction, THP-1 cells (2.0 × 108) were incubated with lentiviral vectors for 16 h at a multiplicity of infection of 0.3 in the presence of 8 μg/mL polybrene (Sigma-Aldrich). Cells were plated in a T225 flask (Thermo Fisher Scientific, Waltham, MA, USA) in RPMI 1640 medium containing 8 μg/mL polybrene for 3 days, followed by incubation with 0.5 μg/mL puromycin (Sigma-Aldrich) for at least 1 week. THP-1 cells harboring GeCKO libraries A and B were treated with 30 ng/mL mycolactone for 1 week. Surviving cells were reseeded, expanded to 3.0 × 107 cells, and harvested for genomic DNA sequencing.

Genomic DNA sequencing and analysis

Genomic DNA was purified from 3.0 × 107 THP-1 cells using the QIAamp DNA Mini Kit (Qiagen, Valencia, CA, USA) and subjected to PCR to amplify lenti-CRISPR v2 sgRNAs using the following primers: (sense) 5′-TCTTGTGGAAAGGACGAAC-3′ and (antisense) 5′-TAGGCACCGGATCAATTGC-3′. Adaptors were added to each end of the PCR products for next-generation sequencing using the following PCR primers: (sense, read 1 sequencing primer) 5′-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGTCTTGTGGAAAGGACGAAACACC-3′ and (antisense, read 2 sequencing primer) 5′- GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTACACGACATCACTTTCCC-3′. The products from the second round of PCR were subjected to electrophoresis and extracted from agarose gels using the MinElute Gel Extraction Kit (Qiagen) according to the manufacturer’s instructions. The PCR products were sequenced using the next-generation sequencer NovaSeq 6000 (Illumina, San Diego, CA, USA).

sgRNAs enriched in the mycolactone-resistant population were ranked using Model-based Analysis of Genome-wide CRISPR-Cas9 Knockout (MAGeCK) (v0.5.8) [23], in which the read counts of each sequence from mycolactone-selected cells were compared with matched read counts from unselected control cells. MAGeCK consists of read count normalization, sgRNA ranking and gene ranking. Briefly, read counts from different samples were first median normalized to adjust for the effect of library size and read count distribution. MAGeCK was run using the default parameters, with the human GeCKO v2 pooled library (Addgene) used as a reference. MAGeCK ranks each sgRNA based on p-values calculated from a negative binomial model, which is used to test whether sgRNA abundance differs significantly from the mean and variance of all samples. All sgRNAs targeting each gene were then ranked and summarized into one score for the gene (gene score) using a modified robust ranking aggregation (RRA) algorithm [24]. The RRA algorithm uses a probabilistic model for aggregation that is robust to noise and that facilitates the calculation of significance probabilities for all elements in the final ranking.

Secondary assessment of CRISPR screening hits by cell viability assay

Each of the top-ranking sgRNAs from the GeCKO screening was inserted into the Cas9-encoding lenti-CRISPR v2 vector (52961; Addgene) [16], and the vector was transfected into Lenti-X 293T cells using PEI-MAX (Polysciences) together with three packaging plasmids (encoding gag-pol, rev and vesicular stomatitis virus glycoprotein). The lentiviral particles from the culture supernatant were concentrated by ultracentrifugation (50,000 × g for 2 h). THP-1 cells were incubated with lentiviral vectors for 16 h in the presence of 8 μg/mL polybrene (Sigma-Aldrich) for lentivirus transduction, then selected with 0.5 μg/mL puromycin (Sigma-Aldrich) for at least 1 week. Surviving cells were reseeded in a 10 cm dish and expanded to use for the experiments. Cells were also transduced with sgRNA targeting the enhanced green fluorescent protein (EGFP) gene as a control [25]. After selection, 2.0 × 105 cells were seeded in each well of a 24-well plate in 500 μL RPMI 1640 medium containing 5% fetal bovine serum. The following day, mycolactone was added at a final concentration of 30 ng/mL, and the cells were incubated for 48, 96 and 144 h before assessing cell viability by the trypan blue exclusion assay. Five replicates per condition were performed in each of three independent experiments.

Total RNA isolation and real-time PCR

Total RNA was purified using the RNeasy Plus Mini Kit (Qiagen), and cDNA was synthesized using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Waltham, MA, USA) as descried previously [26, 27]. Real-time PCR was performed using the Thermal Cycler Dice Real Time System III and Fast SYBR Green Master Mix (both from Applied Biosystems) according to the manufacturer’s instructions as described previously [28, 29]. The sgRNA sequences are listed in S1 Table. Real-time PCR analysis was conducted in triplicate. The resulting mRNA levels were normalized to GAPDH mRNA levels and expressed relative to the control mRNA levels. The PCR primers are listed in S2 Table.

Western blot analysis

Cells were lysed in buffer containing 150 mM NaCl, 1% Nonidet P-40, 0.5% sodium deoxycholate, 0.1% SDS and 50 mM Tris pH 8.0 for 1 h (4°C). The supernatant was collected after centrifugation, and 10 μg protein was used for Western blot analysis, as describe previously [28, 30, 31]. Briefly, the proteins were separated on NuPage 4–12% Bis-Tris gels (Invitrogen, Waltham, MA, USA) by electrophoresis and transferred to nitrocellulose membranes using i-Blot gel transfer stacks (Invitrogen). The membrane was washed with PBS containing 0.1% Tween 20 (PBST) and incubated in blocking buffer (PBST containing 5% nonfat milk) for 1 h. Then, the membrane was incubated with primary antibodies (all at 1:1000 dilution) at 4°C overnight. The primary antibodies used were rabbit anti-caspase-3 (Cell Signaling Technology #9662, Beverly, MA, USA), rabbit anti-cleaved caspase-3 (Asp175) (Cell Signaling Technology #9661), rabbit anti-SEC61A1 (D4K2Z) (Cell Signaling Technology #14867), rabbit anti-eukaryotic initiation factor (eIF2)α (D7D3) (Cell Signaling Technology #5325), rabbit anti-phospho-eIF2α (Ser51) (D9D8) (Cell Signaling Technology #3398), rabbit anti- protein kinase-like ER kinase (PERK) (C33E10) (Cell Signaling Technology #3192), rabbit anti-phospho-PERK (Thr980) (16F8) (Cell Signaling Technology #3179), rabbit anti-activating transcription factor (ATF6) (D4Z8V) (Cell Signaling Technology #65880), rabbit anti-inositol requiring enzyme-1 (IRE1)α (14C10) (Cell Signaling Technology #3294) and mouse anti-β-actin (Sigma-Aldrich #5441). After washing with PBST, the membranes were incubated with horseradish peroxidase-labeled goat anti-rabbit IgG (Cell Signaling Technology #7074) or goat anti-mouse IgG (Cell Signaling Technology #7076) as secondary antibodies (both at 1:1000 dilution). The horseradish peroxidase signal was detected using Immunostar LD reagent (Wako Pure Chemical), and chemiluminescence was analyzed using the C-DiGit blot scanner (LI-COR, Lincoln, NE, USA). Original images of Western blots are shown in S4 Fig.

Genome mutation analysis

To confirm the SEC61A1 genome mutation induced by the SEC61A1-targeting sgRNA, we extracted genomic DNA from EGFP-knockout and SEC61A1-knockout THP-1 cells using the QIAamp DNA Mini Kit (Qiagen) and subjected the genomic DNA to PCR to amplify the SEC61A1 sgRNA targeting site using the following primers: (sense) 5′- GCCTGGCGTTGAATTGGTG-3′ and (antisense) 5′- AAGTGTGAGGGGCTACTCAA-3′. PCR was performed using the Thermal Cycler Dice (Takara Bio, Shiga, Japan). Briefly, the PCR mixture was first denatured for 5 min at 94°C, followed by 15 cycles of three-temperature PCR consisting of denaturation for 30 sec at 94°C, annealing for 30 sec at 65°C and extension at 72°C for 45 sec. The PCR products were analyzed by 2% agarose gel electrophoresis. The SEC61A1 targeting site was also analyzed by direct sequencing with (sense) 5′- GCCTGGCGTTGAATTGGTG using the Fasmac sequencing service (Fasmac, Atsugi, Japan).

Measurement of caspase activity

Activation of caspase-dependent apoptosis activity was analyzed using the fluorochrome-labeled inhibitors of caspases (FLICA) Caspase-3/7 Assay Kit (Immunochemistry Technologies, Bloomington, MN, USA) according to the manufacturer’s instructions [22]. Briefly, THP-1 cells plated on 8-well cover glass chambers (IWAKI, Chuo, Tokyo, Japan) were incubated with mycolactone (30 or 300 ng/mL) or ActD (1 μM) for 24 h. Cells were then labeled with Z-DEVD-FMK, a cell-permeable fluorogenic substrate used to monitor activated caspase-3/7, for 24 h and washed with apoptosis wash buffer. Nuclei were counter stained with Hoechst 33342, and fluorescence was detected using confocal laser-scanning microscopy (FV-10i; Olympus, Shinjuku, Tokyo, Japan). More than 1,000 cells were counted to evaluate the percentage of FLICA-positive cells.

Statistical analysis

Data are expressed as the mean ± SEM. Unpaired t tests were used to assess differences between two groups. A p-value <0.05 was considered to represent statistical significance.

Results

Synthetic mycolactone-induced cell death in THP-1 cells via apoptosis

To assess the effect of mycolactone, the major virulence factor of M. ulcerans, on tissue macrophages (histiocytes), we treated human premonocytic THP-1 cells with mycolactone and assessed cell death. The concentrations of mycolactone used in this study were determined by mass spectrometry analysis of skin and serum samples from patients with BU, as reported previously [3, 32]. Significant cell death was induced by 30 ng/mL synthetic mycolactone at 48 h after treatment in THP-1 cells, as evidenced by the trypan blue exclusion assay (Fig 1A). This concentration is 6 to 8 times higher than the previously reported concentrations used in other cell types [32, 33]. Under the same conditions, Hoechst 33342 staining revealed condensed, fragmented nuclei with much brighter fluorescence, indicating apoptotic DNA fragmentation (Fig 1B). Treatment of THP-1 cells with the pan-caspase inhibitor Z-DEVD-FMK before exposure to mycolactone resulted in significant suppression of mycolactone-induced cell death (Fig 1C), suggesting that the cell death induced by mycolactone was attributed mostly to apoptosis rather than cytotoxicity (necrosis). Western blot analysis showed that mycolactone treatment activated caspase-3, based on the presence of cleaved caspase-3 (Fig 1D, molecular weight: 19,000 and 17,000). The appearance of cleaved caspase-3 was completely blocked by the pan-caspase inhibitor Z-DEVD-FMK (Fig 1D). Taken together, these data suggest that mycolactone induced caspase-3-dependent apoptosis in THP-1 cells.

Fig 1

Synthetic mycolactone-induced caspase-3-dependent apoptosis in THP-1 cells.

(A) Viability of THP-1 cells treated with mycolactone at a final concentration of 3, 30 or 300 ng/mL for 48, 96 or 144 h. Cells were harvested, and viability was determined by the trypan blue exclusion assay. ***: p <0.005 (n = 5) compared with the viability of ethanol (EtOH)-treated cells. (B) Fluorescence images of THP-1 cells treated with or without mycolactone at 3, 30 or 300 ng/mL for 48 h, followed by Hoechst 33342 nuclear staining. Fluorescence was observed using the FV10i confocal laser scanning microscope. Scale bar: 50 μm. (C) Viability of THP-1 cells treated with mycolactone (30 ng/mL, 48 h) in the presence or absence of the pan-caspase inhibitor Z-DEVD-FMK (20 μM, 24 h). Cell viability was determined by the trypan blue exclusion assay (n = 5). ***: p < 0.005. (D) Western blot analysis of caspase-3 and cleaved caspase-3 in lysates from THP-1 cells treated with 30 ng/mL mycolactone for 48 h in the presence or absence of Z-DEVD-FMK (20 μM). β-actin was used as a loading control.

Genome-wide CRISPR/Cas9-mediated screening identified SEC61A1 as a factor responsible for mycolactone-induced cell death

To further investigate the underlying molecular mechanism of mycolactone-induced cell death, we performed GeCKO screening in THP-1 cells (Fig 2A). Cells were genome-edited using the lentivirus-based human GeCKO v2 library consisting of 123,411 sgRNAs targeting 19,050 protein-coding genes and 1,000 control genes. Transfection was performed at a low multiplicity of infection (<0.3) to ensure that the cells received no more than one sgRNA. Cells were then treated with 30 ng/ml mycolactone for 1 week, and the surviving cells were recovered and reseeded to use for genomic DNA sequencing. The copy number of each sgRNA was determined by deep sequencing using the next-generation sequencer Novaseq 6000. The MAGeCK tool was used to analyze the deep sequencing data, and the RRA algorithm was used to compute gene-level scores, as described in the Methods. The screening results were visualized using volcano plots (Fig 2B). The x-axis of the volcano plots indicates enriched sgRNA counts, and the y-axis indicates significant p-values from MAGeCK RRA comparisons of vehicle versus mycolactone-treated cells. As a result, 884 candidate genes mediating mycolactone-induced cell death were identified (p <0.05) (Fig 2B and S1 Data).

Fig 2

GeCKO screening identified essential factors meditating mycolactone-induced cell death.

(A) Schematic representation of the GeCKO screening procedure (see Methods for details). (B) Volcano plot showing genes associated with mycolactone-induced cell death. The plot displays the log2 fold changes of the mean sgRNA counts (sgRNA count in resistant cells / sgRNA count in control cells) on the x-axis and −log10 p-values from MAGeCK RRA comparisons on the y-axis. Genes with p <0.05 are shown in the gray area of the plot.

To verify the potential host factors required for mycolactone-induced cell death, the top 10 genes with the highest RRA values were selected (S1 Fig and Table 1) and further validated. Thus, THP-1 cells were transduced with the sgRNAs corresponding to each of these 10 genes, and then the cells were treated with 30 ng/mL mycolactone and assessed for viability. THP-1 cells transduced with an sgRNA against EGFP served as the negative control. Among the top 10 candidate genes, only cells with the SEC61A1 knockout showed substantial prolongation of survival following mycolactone treatment, even after 144 h (Fig 3), which agrees with the exceptionally high RRA value (p = 7.46 × 10−5) for SEC61A1, which was the highest among the 10 genes (Table 1). SEC61A1, the alpha 1 subunit of Sec61, is a component of the translocon, a transmembrane channel involved in the translocation of proteins across the endoplasmic reticulum (ER) membrane. Thus, SEC61A1 located on the ER membrane is a potential mediator of mycolactone-induced cell death, an essential pathologic characteristic of BU.

Table 1

The top 10 ranking genes identified by MAGeCK screening in mycolactone-treated cells.

Rank	Gene	Gene ID	Number of sgRNAs	Positive RRA value (p)
1	SEC61A1	29927	3	7.46 × 10−5
2	ZNF645	158506	2	1.05 × 10−4
3	IPO5	3843	3	2.23 × 10−4
4	CLEC12A	160364	2	2.49 × 10−4
5	SULT1A3	6818	1	2.73 × 10−4
6	R3HDML	140902	2	3.34 × 10−4
7	RNF141	50862	2	3.48 × 10−4
8	TNFRSF11B	4982	3	4.25 × 10−4
9	ANKRD33	341405	1	4.72 × 10−4
10	SGSH	6448	2	5.22 × 10−4

Summary of the top 10 ranking candidate genes identified by MAGeCK screening. Each Gene ID was provided by the NCBI database. “Number of sgRNAs” refers to the number of significantly enriched sgRNAs corresponding to each target gene.

Fig 3

Viability of sgRNA-transduced THP-1 cells treated with mycolactone.

The top 10 sgRNAs identified by MAGeCK screening were introduced into THP-1 cells. Then, the cells were treated with mycolactone at 30 ng/mL for 48, 96 and 144 h, after which cell viability was determined by the trypan blue exclusion assay (n = 5). Data are expressed as the cell viability relative to that of non-treated EGFP-knockout cells. *: p < 0.05; **: p < 0.01; ***: p < 0.005.

SEC61A1 mediates mycolactone-induced apoptosis

We next explored the possibility that SEC61A1 is involved in mycolactone-induced apoptosis, especially focusing on the molecular mechanisms of apoptosis in THP-1 cells. First, we confirmed SEC61A1 depletion by Western blotting, PCR analysis and DNA sequencing of the sgRNA binding site in SEC61A1 (S2A–S2C Fig, respectively). Thereafter, we confirmed SEC61A1 deletion by the CRISPR/Cas9 genome editing system. SEC61A1 is known to be important for protein translocation and calcium leakage, and SEC61A1 blockade affects cell growth and survival [34, 35]. After puromycin selection of knockout cells, we compared cell growth in control, EGFP- and SEC61A1-knockout cells (S2D Fig). SEC61A1-knockout cells grew more slowly than intact THP-1 cells and EGFP-knockout cells.

Next, we used FLICA, which is a fluorescent cell-permeable probe that binds selectively to activated caspase-3/7. Mycolactone increased the level of apoptosis compared with no treatment in EGFP-knockout cells, but this increase was prevented in SEC61A1-knockout cells (Fig 4A and 4B). However, there was no difference in the proportion of apoptotic cells between EGFP- and SEC61A1-knockout cells treated with ActD (Fig 4A and 4B). Western blot analysis revealed that mycolactone increased the cleaved caspase-3 level in control THP-1 cells, while caspase-3 cleavage was not detected in SEC61A1-knockout cells (Fig 4C). ActD is a transcription inhibitor which intercalates into DNA to inhibit new mRNA synthesis, arrest the cell cycle and induce caspase-3 dependent apoptosis [36], independent of ER stress. As a result, the knockout of SEC61A1 had no effect on ActD-induced caspase-3 activation following mycolactone treatment (Fig 4C). These results suggest that SEC61A1 is essential for mycolactone-mediated caspase-3 activation, but not for ActD-induced apoptosis in human monocytic THP-1 cells.

Fig 4

Mycolactone-induced caspase-3-dependent apoptosis was suppressed by knockout of SEC61A1.

(A) Caspase activation assessed by FLICA assay. Cells were treated with 30 or 300 ng/mL mycolactone for 48 h. Caspase-3/7 activity was visualized by incubation with a fluorescent cell-permeable probe (FLICA) that binds selectively to activated caspase-3/7 in apoptotic cells. FLICA-positive cells (red) were observed using the FV10i confocal laser scanning microscope. Scale bar: 50 μm. (B) Quantitation of FLICA-positive cells (n = 6). ***: p < 0.005. (C) Western blot analysis of caspase-3 activation. Proteins from control (EGFP) and SEC61A1-knockout (SEC61A1) THP-1 cells treated with 30 or 300 ng/mL mycolactone for 48 h were subjected to Western blot analysis using antibodies against SEC61A1, caspase-3 and cleaved caspase-3. β-actin was used as a loading control. ActD was used as a positive control of caspase-3-dependent apoptosis.

Mycolactone-induced ER stress response and proapoptotic gene expression was abolished by SEC61A1-knockout THP-1 cells

SEC61A1 plays a key role in protein transport and calcium signaling in the ER membrane [37]. Dysfunction of SEC61A1 leads to accumulation of misfolded proteins, thereby activating ER-stress-related genes, which in turn activate proapoptotic genes [15, 38]. We therefore evaluated the mRNA expression of genes related to ER stress after mycolactone treatment in THP-1 cells using real-time PCR. In control (EGFP-knockout) cells, mycolactone significantly induced the mRNA expression of activating transcription factor 4 (ATF4) and DNA damage inducible transcript 3 (DDIT3), which are early response ER-stress-related genes; however, this increased expression was completely abolished in SEC61A1-knockout cells (Fig 5A). In addition, the mRNA levels of the proapoptotic genes phorbol-12-myristate-13-acetate-induced protein 1 (PMAIP1), B-cell lymphoma 2 binding component 3 (BBC3) and B-cell lymphoma 2 like 11 (BCL2L11) were significantly induced by mycolactone treatment in EGFP-knockout cells, but not in SEC61A1-knockout cells (Fig 5B). mRNA expression of ATF4 and DDIT3 was detected at 6 h after mycolactone treatment, while that of BBC3 and BCL2L11 was detected at much later time points (S3 Fig) [38].

Fig 5

Knockout of SEC61A1 suppressed the mycolactone-induced ER stress response and expression of proapoptotic genes.

Control EGFP-knockout and SEC61A1-knockout THP-1 cells were treated with 30 ng/mL mycolactone for 6 h (ATF4, DDIT3 and PMAIP1) or 48 h (BBC3 and BCL2L11). (A) The mRNA levels of ER-stress-related genes (ATF4 and DDIT3) and (B) proapoptotic genes (PMAIP1, BBC3 and BCL2L11) were analyzed by real-time RT-PCR. mRNA levels are expressed relative to those of ethanol-treated EGFP-knockout or SEC61A1-knockout THP-1 cells (n = 3). (C) The mRNA levels of unspliced, spliced and total XBP1 using control EGFP-knockout and SEC61A1-knockout THP-1 cells treated with 30 ng/mL mycolactone for 0, 3, 6, 12, and 24 h. mRNA levels are expressed relative to those of mycolactone-treated EGFP-knockout THP-1 cells (n = 3). *: p < 0.05; **: p < 0.01; ***: p < 0.005. (D) Control EGFP-knockout and SEC61A1-knockout THP-1 cells were treated with 30 ng/mL mycolactone for 24 h. ER stress proteins (p-eIF2α, eIF2α, p-PERK, PERK, full length ATF6, cleaved C-ATF6, and IRE1α) and SEC61A1 were evaluated by Western blotting. 1 μM thapsigargin for 24 h was included as a positive control for ER stress.

The ER stress response is triggered through three pathways, i.e., IRE1-X-box binding protein 1 (XBP1) splicing, PERK-eIF2α phosphorylation and ATF6 cleavage [38, 39]. When ER stress is activated, IRE1α splices the XBP1 mRNA, producing an active transcription factor that stimulates the ER stress response [38, 39]. We therefore performed real-time PCR to evaluate the mRNA levels of these genes. XBP1 splicing was induced in 3 h, peaked at 6 h and decreased in 24 h in EGFP-knockout cells (Fig 5C), suggesting that mycolactone activated the IRE1α-XBP1 pathway. However, SEC61A1-knockout cells showed higher levels of XBP1 splicing even before mycolactone treatment (Fig 5C).

Next, we analyzed the phosphorylation of proteins involved in the ER stress pathway by Western blotting. The eIF2α phosphorylation was induced by mycolactone in EGFP-knockout cells, but not in SEC61A1-knockout cells (Fig 5D). The PERK protein showed a weak signal, and its phosphorylation was not evident in THP-1 cells. Although full-length ATF6 was not detected in THP-1 cells, thapsigargin, an inducer of ER stress, induced ATF6 in EGFP-knockout cells but not in SEC61A1-knockout cells. Thapsigargin also induced IRE1α protein synthesis and eIF2α phosphorylation in all these cells. This evidence suggests that SEC61A1 knockout affects ATF6 protein synthesis. These results also indicate that mycolactone induced XBP1 splicing and eIF2α phosphorylation in THP-1 cells. Cells with the SEC61A1 deletion showed sustained XBP1 splicing but were resistant to mycolactone treatment (Figs 5C and S2D). Taken together, these results suggest that SEC61A1 is an essential factor mediating the ability of mycolactone to induce eIF2α phosphorylation.

Discussion

Refractory skin ulceration caused by mycolactone, an exotoxin of M. ulcerans, is the main pathologic feature of BU and a potentially valuable therapeutic target. However, the mechanisms underlying the induction of cell death by mycolactone are not understood. Using GeCKO screening, we identified SEC61A1 as an essential factor mediating mycolactone induction of caspase-3-dependent apoptosis. Thus, our results corroborate previous studies using mutation screening and structural analysis, which identified SEC61A1 as one of the targets of mycolactone action [11, 13, 15, 40]. Since SEC61A1 is a component of the ER translocon, we additionally showed that mycolactone activates the expression of ER stress-related genes, which are known to trigger cytochrome c release from mitochondria to activate the caspase cascade and thus apoptosis [41]. We showed that SEC61A1 is specific for apoptosis induced by mycolactone, but not that induced by ActD, a well-known transcriptional inhibitor that triggers nucleolar stress and ultimately apoptosis [41].

SEC61A1 is a component of the Sec61 translocon complex responsible for the transportation of signal peptide precursors across the ER membrane to newly synthesized proteins [42]. The Sec61 complex also functions as an ER Ca2+ channel that modulates calcium homeostasis, Ca2+ is required for protein folding in the ER and its leakage will lead destabilization of proteins [43]. In a clinical study, de novo missense mutations in SEC61A1 were reported to be the cause of common variable immunodeficiency and glomerulocystic kidney disease, a rare hereditary disorder characterized by the cystic dilation of Bowman’s capsule due to protein instability and functional impairment with dysregulated calcium homeostasis [37]. In addition, other inhibitors that directly target SEC61A1, such as CT7, CT8, and ipomoeassin F, have similar effects to mycolactone [8-12]. Mycolactone physically binds to SEC61A1, maintains the Sec61 translocon conformation, and prevents the access of signaling peptides to the binding site of SEC61A1 [13]. Mycolactone alters the Sec61 translocon conformation to open the cytosolic side of the lateral gate and enhance calcium leakage [44]. Mycolactone also prevents the translocation of proteins that pass through the endoplasmic reticulum for secretion or placement in cell membranes [7, 8, 45]; these proteins accumulate and activate ER stress responses [7, 46]. In the present study, we demonstrated that the knockout of SEC61A1 blocked the mycolactone-induced expression of ER stress-related genes, eIF2α phosphorylation, and apoptosis in human premonocytic THP-1 cells. Therefore, mycolactone directly binds to SEC61A1 thereby inhibiting the protein translocation into the ER and enhancing calcium leakage, which results in the accumulation of misfolded mislocated proteins [8, 46, 47]. This process causes ER stress and subsequently activates caspase-3 to induce apoptosis in affected cells. However, so far the relationship between ER stress and oxidative stress was not confirmed. Mycolactone also induces reactive oxygen species, which affect cytotoxicity [48, 49].

SEC61A1 has an important role in protein translocation and calcium leakage [42, 46]. It was reported that SEC61A1 deletion or silencing resulted in growth defects or cell death in association with sustained XBP1 splicing [34, 35, 50]. In our study, deletion of SEC61A1 showed a low growth phenotype and sustained XBP1 splicing in THP-1 cells (Figs 5C and S2D). However, SEC61A1 deletion did not induce apoptosis or the expression of proapoptotic genes such as PMAIP1, BBC3 and BCL2L11 (Fig 5B). We could not elucidate the mechanism contributing to the different growth and cytotoxic phenotype of SEC61A1 deletion between THP-1 cells and other cells. In our genome-wide screening, SEC61A1-knockout cells had low growth rates but could survive in the presence of mycolactone; SEC61A1 was found as a top score gene (Table 1).

In the present genome-wide screening, several other genes were identified as candidates involved in mycolactone-induced cell death, although their RRA values were much lower than that of SEC61A1 (Table 1). These genes include the C-type lectin domain family 12 member A (CLEC12A), which encodes an early adaptor molecule involved in autophagy to eliminate stress-related proteins [51], and the ring finger protein 141 (RNF141), a gene that is upregulated in the jejunum of XBP1-silenced mice [52]. However, the knockout of each of these genes did not alter mycolactone-induced apoptosis in THP-1 cells. Several other genes have been reported as candidates mediating mycolactone-initiated cell death, such as angiotensin II receptor type 2, WASP-like actin nucleation promoting factor, FKBP prolyl isomerase 1A, AKT serine/threonine kinase 2, mechanistic target of rapamycin kinase and SET domain containing 1B [14, 53–55]. However, none of these genes were detected as candidates in our GeCKO screening. Although these differences may be due to the different cell types used in each study [31], further analysis may be required to elucidate the whole picture of mycolactone-induced ER stress and apoptosis.

Mycolactone induced the ER stress response, which triggers cell apoptosis [15, 46]. ER stress responses are activated by three major pathways including IRE1-XBP1 splicing, phosphorylation of eIF2α via multiple kinases (PERK, general control non-repressed 2: GCN2, protein kinase RNA-activated: PKR), and ATF6 cleavage. Each pathway activates a pro-survival response, responsible for restoring normal ER function by reducing unfolded proteins [56]. Finally, failure to remove stress results in the expression of proapoptotic signaling genes such as PMAIP1, BBC3 and BCL2L11.

In this paper, we showed that mycolactone induced IRE1-XBP1 splicing and eIF2α phosphorylation, but not ATF6 cleavage. It was reported that mycolactone induced XBP1 splicing in MutuDCs [46] and eIF2α phosphorylation in HeLa cells and MEF cells [15]. We also demonstrated that mycolactone induced ER stress responses in THP-1 cells. The SEC61A1 deletion cells have diminished eIF2α phosphorylation and expression of proapoptotic genes. Although phosphorylation of PERK, one of the eIF2α kinases, was not detected in THP-1 cells, other kinases such as GCN or PKR may phosphorylate eIF2α with mycolactone treatment [15]. In the present study, the ER stress inducer thapsigargin induced eIF2α phosphorylation in EGFP- and SEC61A1-knockout THP-1 cells. ATF6 was upregulated by thapsigargin in control, but not in SEC61A1-knockout cells. Therefore, it is possible to infer that thapsigargin induces eIF2α phosphorylation independent of SEC61A1, whereas ATF6 expression was dependent on SEC61A1. It was reported that the SEC61A1 inhibitor ipomoeassin F also suppressed ATF6 protein expression in HepG2 cells [9]. Morel et al. demonstrated that mycolactone induced an atypical ER stress response, in which the ATF4/DDIT3 branch of the ER stress response was robustly activated, but Bip, an upstream regulator of the ER stress response, was downregulated [39, 46]. It was different from the conventional ER stress response induced by thapsigargin, tunicamycin, and MG132. Our study also showed mycolactone-induced ATF4/DDIT3 expression, which was diminished by SEC61A1 knockout. ATF6 gene activation was induced only by thapsigargin and not by mycolactone. We have confirmed that the SEC61A1 knockout suppressed mycolactone-induced ER stress and cytotoxicity. However, the viability assay and FLICA assay demonstrated that mycolactone-induced apoptosis was not completely prevented by the SEC61A1 knockout. This evidence suggests that other mycolactone-induced stress pathways may also be involved in inducing apoptosis in THP-1 cells. Further study is required to demonstrate the precise molecular mechanisms of SEC61A1 in ER stress apoptosis.

Several approaches have been proposed to inhibit mycolactone activity, e.g., the use of IgG antibody against mycolactone [57, 58], the inhibition of the mycolactone synthesis pathway with substrates (malonyl-CoA, methyl malonyl-CoA) [59] and the attenuation of cytotoxicity with antioxidants [48, 49]. At present there is no effective drug to reduce the toxicity of mycolactone, and further drug screening and analysis of the biological activity of mycolactone will be required to develop novel therapeutic modalities to inhibit mycolactone-induced ulceration.

In summary, the present genome-wide study of GeCKO-screened THP-1 cells identified SEC61A1 as an essential gene responsible for mycolactone-induced ER stress and caspase-3-dependent apoptosis. Since mycolactone is the sole pathologic factor of M. ulcerans, inhibition of mycolactone activity or its downstream cascades could be a novel therapeutic modality to eliminate the harmful effects of mycolactone, in addition to the 8-week antibiotic regimen of rifampicin and clarithromycin.

Ranking of the candidate genes identified by GeCKO screening.

Genes were ranked according to the p-value of MAGeCK screening. Lower RRA p-values indicate a stronger positive selection of the corresponding gene. The top 10 ranked genes are labeled with red dots. Genes with a p <0.05 are shown in the gray area. Source data are provided in S1 Data.

(DOCX)

Click here for additional data file.

SEC61A1-deleted THP-1 cells were generated using the CRISPR/Cas9 genome editing system.

(A) Cell lysates were prepared from control EGFP-knockout and SEC61A1-knockout THP-1 cells and analyzed by immunoblotting with Abs against SEC61A1. β-Actin was used as a loading control. (B) PCR amplification of genomic DNA from control EGFP-knockout and SEC61A1-knockout THP-1 cells, using a FWD primer targeting the SEC61A1 sgRNA binding site and a BWD primer targeting 100 bp downstream. The higher PCR annealing temperature was set to 65°C for 15 cycles. (C) Sequences of the SEC61A1 sgRNA targeting site from PCR products, which were amplified from genomic DNA of control EGFP-knockout and SEC61A1-knockout THP-1 cells. The sequences are compared to the reference human genome sequence. N means that the nucleotide was not determined by sequencing due to multiple mutations inserted near the PAM sequence (protospacer adjacent motif, which is a CCG DNA sequence). (D) Cell proliferation assay. The cell proliferation assay indicated that control, EGFP-knockout and SEC61A1-knockout THP-1 cell numbers were distinctly increased in a time-dependent manner during the 5-day culture. The cell number and viability were measured by the trypan blue exclusion assay using an automatic cell counter (n = 6). ***: p < 0.005 compared with the cell number of control THP-1 cells. †***: p < 0.005 compared with the cell number of EGFP-knockout THP-1 cells.

(DOCX)

Click here for additional data file.

Mycolactone induced the expression of ER-stress-related genes and proapoptotic genes.

The THP-1 cells were treated with 30 or 300 ng/mL mycolactone for the indicated periods. mRNA levels were analyzed by real-time RT-PCR and normalized to those of GAPDH. The expression levels of ER-stress-related genes (ATF4 and DDIT3) and pro-apoptotic genes (PMAIP1, BBC3 and BCL2L11) are relative to the pre-treatment levels (0 h) in the bar graph (n = 3). *: p < 0.05; **: p < 0.01; ***: p < 0.005.

(DOCX)

Click here for additional data file.

Original uncropped images of Western blots from Figs 1, 4 and 5.

Molecular weight markers were included when available.

(DOCX)

Click here for additional data file.

sgRNA sequences for each target gene.

(DOCX)

Click here for additional data file.

Primers used for real-time PCR.

(DOCX)

Click here for additional data file.

Source data file.

Ranking of genes identified by MAGeCK screening after treatment with mycolactone from the GeCKO v2 library.

(XLSX)

Click here for additional data file.

6 Jan 2022

Dear Dr. Suzuki,

Thank you very much for submitting your manuscript "Genome-wide screening identified SEC61A1 as an essential factor for mycolactone-dependent apoptosis in human premonocytic THP-1 cells" for consideration at PLOS Neglected Tropical Diseases. As with all papers reviewed by the journal, your manuscript was reviewed by members of the editorial board and by several independent reviewers. In light of the reviews (below this email), we would like to invite the resubmission of a significantly-revised version that takes into account the reviewers' comments.

Your research was generally well-received by the reviewers who agreed that, despite a now well-established literature on Sec61a as the target of mycolactone, this manuscript does provide additional and important novel insights. However, all reviewers had similar concerns about some aspects of the experimental data, and the conclusions drawn. The reviews are broadly in agreement, but the additional guidance in the preparation of the revision is provided:

All reviewers were concerned about the viability of THP-1 cells in which SEC61A1 had been knocked out by CRISPR. It is essential that experimental data directly comparing viability of SEC61A1 knockout cells to control cells (preferably non-targeting sgRNA) in the absence and presence of mycolactone at different timepoints is presented. You may need to carefully consider the normalisation strategy to ensure this data accurately reflects the findings. It should also be confirmed whether the knockout is complete or partial (either by PCR of targeted cell genomes, or by testing the ability of these cells to make Sec61-dependent proteins such as cytokines).

The reviewers felt that the your findings of transcriptional responses in several genes were not sufficient to specifically implicate ER stress in the response to mycolactone. Here, you have the option of either providing additional experimental data to support the induction of ER stress (activation of all three arms: XBP-1, ATF6 and eIF2a), or changes to the abstract/keywords/manuscript text to reflect the existing literature taking all reviewers’ comments into account. Please also clarify the point identified by reviewer 1, regarding XBP-1 (I believe this refers to lines 428-431)

In terms of other changes to the text, two critical areas are highlighted by the reviewers.

First, the final conclusion that Sec61 is a therapeutic target in Buruli ulcer is not justified, since all Sec61 inhibitors have a similar toxicity profile to mycolactone. Please change these aspects in line with the reviewers’ comments.

Second, it is important that the prior literature on this topic is cited; there are a significant number of specific areas and papers suggested by each reviewer, and a Pubmed search of Sec61 and mycolactone may reveal more. The discussion should place your work in the context of these previous findings. I would be particularly interested to hear your thoughts on how the toxicity profile of mycolactone and/or Sec61 depletion may have a different profile in the non-adherent THP-1 cells to adherent cells investigated by others.

We cannot make any decision about publication until we have seen the revised manuscript and your response to the reviewers' comments. Your revised manuscript is also likely to be sent to reviewers for further evaluation.

When you are ready to resubmit, please upload the following:

[1] A letter containing a detailed list of your responses to the review comments and a description of the changes you have made in the manuscript. Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.

[2] Two versions of the revised manuscript: one with either highlights or tracked changes denoting where the text has been changed; the other a clean version (uploaded as the manuscript file).

Important additional instructions are given below your reviewer comments.

Please prepare and submit your revised manuscript within 60 days. If you anticipate any delay, please let us know the expected resubmission date by replying to this email. Please note that revised manuscripts received after the 60-day due date may require evaluation and peer review similar to newly submitted manuscripts.

Thank you again for your submission. We hope that our editorial process has been constructive so far, and we welcome your feedback at any time. Please don't hesitate to contact us if you have any questions or comments.

Sincerely,

Rachel E Simmonds, Ph.D.

Guest Editor

PLOS Neglected Tropical Diseases

Gerd Pluschke

Deputy Editor

PLOS Neglected Tropical Diseases

***********************

Your research was generally well-received by the reviewers who agreed that, despite a now well-established literature on Sec61a as the target of mycolactone, this manuscript does provide additional and important novel insights. However, all reviewers had similar concerns about some aspects of the experimental data, and the conclusions drawn. The reviews are broadly in agreement, but the additional guidance in the preparation of the revision is provided:

All reviewers were concerned about the viability of THP-1 cells in which SEC61A1 had been knocked out by CRISPR. It is essential that experimental data directly comparing viability of SEC61A1 knockout cells to control cells (preferably non-targeting sgRNA) in the absence and presence of mycolactone at different timepoints is presented. You may need to carefully consider the normalisation strategy to ensure this data accurately reflects the findings. It should also be confirmed whether the knockout is complete or partial (either by PCR of targeted cell genomes, or by testing the ability of these cells to make Sec61-dependent proteins such as cytokines).

The reviewers felt that the your findings of transcriptional responses in several genes were not sufficient to specifically implicate ER stress in the response to mycolactone. Here, you have the option of either providing additional experimental data to support the induction of ER stress (activation of all three arms: XBP-1, ATF6 and eIF2a), or changes to the abstract/keywords/manuscript text to reflect the existing literature taking all reviewers’ comments into account. Please also clarify the point identified by reviewer 1, regarding XBP-1 (I believe this refers to lines 428-431)

In terms of other changes to the text, two critical areas are highlighted by the reviewers.

First, the final conclusion that Sec61 is a therapeutic target in Buruli ulcer is not justified, since all Sec61 inhibitors have a similar toxicity profile to mycolactone. Please change these aspects in line with the reviewers’ comments.

Second, it is important that the prior literature on this topic is cited; there are a significant number of specific areas and papers suggested by each reviewer, and a Pubmed search of Sec61 and mycolactone may reveal more. The discussion should place your work in the context of these previous findings. I would be particularly interested to hear your thoughts on how the toxicity profile of mycolactone and/or Sec61 depletion may have a different profile in the non-adherent THP-1 cells to adherent cells investigated by others.

Reviewer's Responses to Questions

Key Review Criteria Required for Acceptance?

As you describe the new analyses required for acceptance, please consider the following:

Methods

-Are the objectives of the study clearly articulated with a clear testable hypothesis stated?

-Is the study design appropriate to address the stated objectives?

-Is the population clearly described and appropriate for the hypothesis being tested?

-Is the sample size sufficient to ensure adequate power to address the hypothesis being tested?

-Were correct statistical analysis used to support conclusions?

-Are there concerns about ethical or regulatory requirements being met?

Reviewer #1: No major new analyses/experiments are required to make the study acceptable for publication.

I have, however, suggested two additional experiments that would enhance the novelty of the study and further our understanding of the mechanism of mycolactone-induced cell death in THP-1 cells (see final paragraph of the Summary and General Comments section). Both suggestions are potentially beyond the scope of the current study so, provided that the authors address the points that I have listed in the 'Editorial and Data Presentation Modifications' section, I recommend that the study is acceptable for publication with 'minor revisions', even if the suggested experiments are not performed. This is because the current methods and analyses answer the stated objectives, have been performed with scientific rigour and used correctly to support the current conclusions.

Reviewer #2: The methods are fully described and appropriate to the objectives of the study. The statistics are sufficient to support the conclusions. There are no ethical or regulatory concerns.

Reviewer #3: The work was carried out with the appropriate methodology.

--------------------

Results

-Does the analysis presented match the analysis plan?

-Are the results clearly and completely presented?

-Are the figures (Tables, Images) of sufficient quality for clarity?

Reviewer #1: Presented analysis matches the analysis plan.

Results are clearly and completely presented and figures are clear. Minor errors: a spelling mistake in Figure 2 and the implication that XBP1 was identified as candidate in the text but not in any of the Figures, Table 1 or source data (more detail given in the Editorial and Data Presentation Modifications section).

Reviewer #2: The data are very well presented and all figures and legends are of high quality.

Reviewer #3: I ma happy with presentation of the results.

--------------------

Conclusions

-Are the conclusions supported by the data presented?

-Are the limitations of analysis clearly described?

-Do the authors discuss how these data can be helpful to advance our understanding of the topic under study?

-Is public health relevance addressed?

Reviewer #1: Conclusions are supported by the presented data.

Limitations are described and the authors discuss how these data can advance our understanding of mycolactone-induced cell death but do not place this in the context of current literature where these mechanisms have been elucidated in significant detail using other cell lines (Ogbechi et al. 2018, Morel et al. 2018).

Public health relevance is briefly discussed but lacks clarity.

Reviewer #2: I have several reservations about the conclusions drawn from this data and feel more work is needed to support the authors' interpretation of the results, mostly related to conclusion that the cell death caused by mycolactone is entirely due to the induction of ER stress.

Reviewer #3: The conclusions are well supported by the data. However, limitations of the study are not currently sufficiently discussed especially with regard to the known role of Sec61 in mediating mycolactone cytotoxicity. This needs to be corrected in a revised manuscript.

--------------------

Editorial and Data Presentation Modifications?

Use this section for editorial suggestions as well as relatively minor modifications of existing data that would enhance clarity. If the only modifications needed are minor and/or editorial, you may wish to recommend “Minor Revision” or “Accept”.

Reviewer #1: Line 118 vs. 247: Z-DEVD-FMK is described as ‘a specific and irreversible caspase-3 inhibitor’ (line 118) and a ‘pan-caspase inhibitor’ (line 247). Z-DEVD-FMK shows potent inhibition of other caspases so is not a ‘specific’ inhibitor of caspase-3 (please amend in line 118). Since Z-DEVD-FMK also inhibits caspase-8 (which acts upstream of caspase-9 and caspase-3) in cells, perhaps it would be more appropriate to say that ‘mycolactone induced caspase-dependent apoptosis in THP-1 cells’ (line 254) rather than being specific for caspase-3?

Line 301: spelling error in Fig. 2A, step 4; change ‘mycoractone’ to ‘mycolactone’.

Line 330: Was there a ‘no treatment’ control for any of the sgRNA treated cells? Or have the values shown here been expressed relative to the ‘no treatment’ for each sgRNA? For example, I’d expect the viability of SEC61A1-KO cells to start declining after 96-144 h even when not treated with mycolactone?

Line 336: Reference(s) for FLICA probe?

Line 340: Could benefit from stating that Actinomycin D (ActD) is a transcription inhibitor ie. to make it clearer that there is no difference in apoptosis induction between the EGFP- and SEC61A1-KO cells.

Line 401: Suggest text is amended to: ‘which are known to trigger cytochrome c release from…’ It currently sounds like this has been experimentally determined in this manuscript when it hasn’t.

Line 426-431: The authors include XBP1 as one of the genes identified as a candidate of mycolactone-induced cell death with a lower RRA value than SEC61A1 and state that knockout of these genes did not alter mycolactone-induced apoptosis in THP-1 cells. However, there is no mention of XBP1 in any of the Figures, Table 1 or source data.

Line 441: Note spelling error; change ‘dependant’ to ‘dependent’.

Line 441-447: This section lacks clarity. What is meant by ‘inhibition of mycolactone’? Do you mean inhibit its biogenesis by M. ulcerans or something else? Could you expand on how Sec61alpha could be inhibited with reduced toxicity than that induced by mycolactone-mediated inhibition of Sec61? Do you think that a more substrate-selective Sec61 inhibitor (eg. the cotransin derivative CT8; see Pauwels et al. 2021) could be used to compete with mycolactone-Sec61 binding during an M. ulcerans infection?

Line 541: The authors acknowledge ‘synthetic and biotinylated mycolactone A/B’ but biotinylated mycolactone is not mentioned elsewhere in the manuscript?

Reviewer #2: There are some errors in interpretation of current knowledge that need to be corrected.

1. In line 407, the authors state that calcium leakage from the ER is “required for stabilization of protein folding” and in line 421 suggest that mycolactone inhibits calcium leakage. Calcium leakage is an inevitable consequence of the opening of the Sec61 channel. Countering this to maintain ER calcium levels is the process required for protein folding and cells go to some lengths to minimise the leak via BiP in the ER lumen and calmodulin in the cytosol. Recent evidence suggests that mycolactone does not inhibit the leak but actually increases it (see Bhadra et al, 2021, PMID: 34726690). This needs to be discussed.

2. In line 420 the authors speculate that “mycolactone directly binds to SEC61A1, thereby inhibiting modification of signalling peptides … which results in accumulation of unfolded proteins in the ER” and in line 446 they suggest that the effects of mycolactone may be blocked by inhibiting SEC61A1. It is now well established that mycolactone is in fact an inhibitor of SEC61A1 (see refs 29 and 30 for example). As mycolactone prevents proteins passing through the translocon, the authors need to address how it might cause accumulation of unfolded proteins within the ER. Finally, most of the other known inhibitors of SEC61A1 activity induce a remarkably similar phenotype to mycolactone (eg Ipomoeassin F, see Zong et al, 2019, PMID: 31059257 and Roboti et al, 2021, PMID: 34079010) and therefore would be expected to mimic the effects of mycolactone rather than protect against them. These parts of the discussion need to be rewritten.

Reviewer #3: I would recommend considering this manuscript if my concerns can be adequately addressec.

--------------------

Summary and General Comments

Use this section to provide overall comments, discuss strengths/weaknesses of the study, novelty, significance, general execution and scholarship. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. If requesting major revision, please articulate the new experiments that are needed.

Reviewer #1: The manuscript by Kawashima et al. focusses on understanding the genes necessary for mycolactone-induced cell death in human premonocytic THP-1 cells. Mycolactone is an exotoxin produced by Mycobacterium ulcerans, the causative agent of the necrotising skin disease known as Buruli ulcer, and it is well established that the pathology of this disease is directly linked to mycolactone binding to the central subunit of the Sec61 complex, Sec61alpha (Demangel and High 2018). The Sec61 complex is the predominant protein conducting channel via which secretory and transmembrane proteins traverse, or are inserted into, the membrane of the endoplasmic reticulum (ER) (O’Keefe et al. 2021). By binding to the cytosolic side of Sec61alpha and stabilising a partially open conformation of Sec61 (Gérard et al. 2020), mycolactone precludes the entry of most newly synthesised polypeptides into the Sec61 channel and, hence, inhibits their access to the secretory pathway. This global blockade in ER protein translocation reduces the ability of cells to synthesise many secretory and transmembrane proteins (type I, type II but not type III or tail-anchored proteins; McKenna et al. 2017, Morel et al. 2018, Zong et al. 2019), triggering stress responses that ultimately induce apoptosis and cell death (Ogbechi et al. 2018, Morel et al. 2018).

Here, the authors first use trypan blue and Hoescht 33342 staining, together with the pan-caspase inhibitor Z-DEVD-FMK, to show that mycolactone-induced cell death proceeds via a caspase-3 dependent apoptotic pathway in THP-1 cells. They then use genome-wide CRISPR/Cas9-mediated screening to identify 884 candidate genes involved in mycolactone-induced cell death. After sgRNA-mediated knockout of each of the top 10 scored candidate genes, the authors find that only SEC61A1-KO THP-1 cells showed prolonged survival when treated with mycolactone. Next, by using a fluorescent probe that binds to activated caspase-3, the small molecule apoptosis inducer Actinomycin D and western blot analysis, the authors show that Sec61alpha is required for mycolactone-induced caspase-3 activation. Finally, the authors use real-time PCR to show that mycolactone-treated THP-1 cells induce mRNA expression of the ER-stress related genes ATF4 and DDIT3 (CHOP) after 6 h and, after prolonged exposure, increased mRNA levels of the pro-apoptotic genes PMAIP1 (Noxa), BBC3 (Puma) and BCL2L11 (Bim); effects that are ablated in SEC61A1-KO cells. Taken together, the authors conclude that Sec61alpha is essential for the ability of mycolactone to induce ER stress and caspase-3 dependent apoptosis. From this, they propose that either inhibiting Sec61alpha or downstream ER stress and caspase-3 dependent apoptotic factors presents a novel approach to eliminate the harmful effects of mycolactone during M. ulcerans infection.

Overall, this is a well-executed and technically sound study. However, despite the use of sophisticated biochemical methods and genome-wide screening, most of what is shown here confirms previous work which has already established that mycolactone’s toxicity strictly depends on its binding to Sec61alpha (Baron et al. 2016) and that ATF4 and CHOP mRNA expression is increased in response to mycolactone in RAW264.7 (Ogbechi et al. 2018), HeLa (Ogbechi et al. 2018) and dendritic (Morel et al. 2018) cells.

The present study modestly extends this work by demonstrating that, in THP-1 cells, mycolactone-treatment increases the mRNA levels of ATF4, CHOP, PMAIP1 (Noxa), BBC3 (Puma) and BCL2L11 (Bim) and induces caspase-3 dependent apoptosis. Whether this caspase-dependent apoptosis is the result of; i) a mycolactone-induced integrated stress response in the absence of the UPR (RAW264.7 and HeLa cells; Ogbechi et al. 2018); ii) an atypical UPR as observed in mycolactone-treated dendritic cells (Morel et al. 2018) and ipomoeassin-F-treated HepG2 cells (Roboti et al. 2021) or iii) a combination of stress responses in THP-1 cells, would certainly enhance our understanding of mycolactone-induced cell death in different cell types. The authors could potentially address this question by monitoring XBP1 mRNA splicing in mycolactone-treated THP-1 cells using real-time or reverse-transcription PCR (cf. Ogbechi et al. 2018, Morel et al. 2018, Roboti et al. 2021) or assessing the level of mRNA induction of ATF4 and/or CHOP in mycolactone-treated ATF4-KO THP-1 cells (cf. Ogbechi et al. 2018). Although these experiments are potentially beyond the scope of the current study, the authors can significantly improve their manuscript by placing their results within the context of other recent studies that have advanced our understanding of the mechanisms of mycolactone-induced apoptosis (eg. Morel et al. 2018, Ogbechi et al. 2018).

In summary, Kawashima et al. set out to identify the genes necessary for mycolactone-induced cell death in human premonocytic THP-1 cells. They successfully achieved their objective and, out of 884 candidate genes identified by genome-wide screening, they identified Sec61A1 as the only essential gene that is required for the mycolactone-mediated induction of caspase-dependent apoptosis in THP-1 cells.

Reviewer #2: This work describes an investigation into the mechanism of cell death induced by the Buruli Ulcer virulence factor mycolactone using genome scale CRISPR screen in THP-1 cells. The authors found and validated SEC61A1 as a candidate gene. Knockout of SEC61A1 protected cells against mycolactone-induced cytotoxicity, prevented caspase 3 activation and reduced expression of stress related and pro-apoptotic genes. This well written and interesting paper contributes to our understanding of mycolactone’s activity. However, as well as needing further experiments to back up the conclusions, there are some omissions in the document the weaken the overall impact. There is a brief discussion of the results in the context of previously published works but there are many highly relevant publications that have been largely ignored. For example, the widely reported role of oxidative stress in mycolactone cytotoxicity is not mentioned and multiple papers showing inhibition of Sec61 activity by mycolactone are uncited. When comparing their results to other screens, the authors merely suggest that the differences in their findings to previous screens may be due to cell type, but this seems unlikely given the universal expression of SEC61A1 and the essential nature of its activity. The discussion should be expanded to include a more thorough analysis of the literature and the implications of the findings.

Experimentally there are several areas that need more work to justify the authors conclusions.

1. There are a number of CRISPR-based studies that have identified SEC61A1 as an essential gene and report a severe growth defect in knockout cells (eg Adamson et al, 2016, PMID: 27984733). Some data on the growth of the knockout THP-1 cells would be useful here as changes in growth may affect cellular responses. Confirmation of SEC61A1 knockout by PCR would also strengthen the authors findings.

2. The stress response genes analysed by the authors are not specific for ER-stress and could be induced by other pathways. It cannot be concluded that mycolactone induces ER-stress based on this alone. This is important because Ogbechi et al (Ref 24) showed that mycolactone can activate an integrated stress response via multiple pathways. In addition, Adamson et al (see above) reported that SEC61A1 knockout actually activates the IRE1/XPB1 arm of the ER-stress response. To make a strong case for ER-stress as the major cause of cell death in mycolactone treated cells, the authors need to show all three arms of the stress response are activated by demonstrating EIF2α phosphorylation, XBP1 splicing and ATF6 cleavage. Use of a control inducer of ER-stress that does not depend directly on Sec61 such Tunicamycin or Thapsigargin would help confirm that the protective effect of SEC61A1 knockout is specific for mycolactone.

3. Related to the above point, the activators of the unfolded protein response, PERK, IRE1 and ATF6 are all Sec61 dependent proteins. These proteins could be downregulated in the knockout THP-1 cells prior to addition of mycolactone, which would explain the reduced response. The levels of each should be confirmed by immunoblotting.

Reviewer #3: Review of manuscript of Kawashima et al. entitled ” Genome-wide screening identified SEC61A1 as an essential factor for mycolactone-dependent apoptosis in human premonocytic THP-1 cells”

This manuscript describes a CRISPR screen to identify factors involved in mycolactone-induced apoptosis in premonocytic THP-1 human cells. The screen identified SEC61A1 as the main hit gene, whose downmodulation was further validated to confer protection from mycolactone-induced cytotoxicity. It is already well established that mycolactone directly binds to the trimeric Sec61 translocon and blocks its protein translocation activity. Since Sec61 is essential for viability of all eukaryotic cells, its inhibition by mycolactone leads to broad cytotoxicity across many mammalian cell lines. The screen described in this manuscript is well carried out and the SEC61A1 hit is validated and new insights into the apoptosis mechanism resulting from Sec61 inhibition are presented. The already well-established role of Sec61 as the direct cellular target of mycolactone somewhat detracts from the general impact of this work. Still, this work is worth publishing given that the below comments are addressed by the authors.

Major points:

1) It is already quite abundantly demonstrated by previous studies that the direct cellular target of mycolactone A/B responsible for its cytotoxic effects is the Alpha subunit of the Sec61 complex. I believe it is not correct to completely omit this information from the abstract and this should be corrected in the revised manuscript.

2) Introduction p. 5. Here, the authors state that the essential host factors that mediate the action of mycolactone remain largely unknown. In fact, both the Demangel and Simmonds laboratories have demonstrated that in mammalian cells, the direct target of mycolactone responsible for the compound cytotoxicity is the Alpha subunit of the Sec61 complex. The first papers in this are (PMID: 24699819, 27821549). It is required that this previous determination of the cellular target of mycolactone is at least mentioned and the relevant literature is cited.

3) If I understand it correctly, the CRISPR screen carried out here is resulting in indels on the target gene, presumably resulting in abolished expression of the target gene product. This is of course problematic for identifying essential genes such as SEC61A1 and this can be circumvented by use of CRISPRi screens. It is not immediately clear to me from the text whether this as a CRISPR KO or a CRISPRi screen. This should be clarified and if a KO screen, then it should be discussed how the essential SEC61A1 came up as a hit.

4) Page. 19, Fig. 3. The followup screen clearly shows that cells transduced with sgRNAs against SEC61A1 are highly resistant against mycolactone cytotoxicity. Given the cell-essential nature of Sec61 in all eukaryotic cells, I am slightly confused about this result. Typically, full blockade or downregulation of Sec61 is highly toxic to cells already around 72 hours (see e.g. PMID: 32067014). The authors should discuss this unexpected result in the text. Perhaps the SEC61A1 KO was not complete in these experiments. Does the sgRNA targeting of SEC61A1 and the used mycolactone treatment block new synthesis of secreted and membrane proteins? This could be tested by for example WB analysis of known Sec61 substrate proteins expressed in THP-1 cells.

5) Page 25. “Therefore, we speculate that mycolactone directly binds to SEC61A1, thereby inhibiting modification of signaling peptides and calcium leakage, which results in accumulation of unfolded proteins in the ER. This process in turn causes ER stress”. This sentence needs to be rewritten. First, it is well established that mycolactone directly binds Sec61 (PMID: 27821549, 32692975) and this should be acknowledged in the text. Second, mycolactone inhibits protein translocation into the ER primarily by blocking access of polypeptides into the ER lumen (or ER membrane for integral membrane proteins). Signal peptide cleavage (not signalling peptide) occurs after the signal peptide has passed through the channel.

Minor points:

1) In the abstract, the authors state that SEC61A1 could be a therapeutic target for Buruli ulcer disease, but I am not convinced how Sec61 could be targeted for this purpose. The authors should clarify their rationale on how modulation of Sec61 activity could produce therapeutic benefits against Buruli ulcer disease keeping in mind that global blockade of Sec61 activity is generally cytotoxic to all eukaryotic cells.

2) Page 13. The authors state that significant THO-1 cell death was induced by 30 ng/ml mycolactone at 48 hours. How does this compare to IC50 values reported elsewhere?

3) Page 15. Authors write that cells were mutagenized using lentiviral gRNA delivery. Is mutagenized the correct word here

4) Page 16. “Cells were then treated with mycolactone, and genomic DNA was prepared from the surviving cells”. Please state the concentration used and the duration of compound treatment.

5) Page 19. “We next explored the possibility that SEC61A1 is involved in mycolactone induced apoptosis.”. As mentioned, the role of Sec61 in mycolactone cytotoxicity is well established and this sentence should be reworded maybe to highlight the less studied form of apoptosis that mycolactone induces.

6) Page 22. The authors discuss the role of mycolactone for inducing a ER stress response. Here, a citation to a proteomic study characterizing the specific form of proteotoxic stress induced by mycolactone was characterized (PMID: 29915147).

7) Page 24. Sec61 protein complex is typically written as Sec61, not SEC61.

8) Page 26. Again, please clarify how Sec61 modulation could allow therapeutic targeting of Buruli ulcer disease.

--------------------

PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: Yes: Sarah O'Keefe

Reviewer #2: No

Reviewer #3: No

Figure Files:

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org.

Data Requirements:

Please note that, as a condition of publication, PLOS' data policy requires that you make available all data used to draw the conclusions outlined in your manuscript. Data must be deposited in an appropriate repository, included within the body of the manuscript, or uploaded as supporting information. This includes all numerical values that were used to generate graphs, histograms etc.. For an example see here: http://www.plosbiology.org/article/info%3Adoi%2F10.1371%2Fjournal.pbio.1001908#s5.

Reproducibility:

To enhance the reproducibility of your results, we recommend that you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. Additionally, PLOS ONE offers an option to publish peer-reviewed clinical study protocols. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols

25 May 2022

Submitted filename: Suzuki K-Mycolactone response220519AK.docx

Click here for additional data file.

12 Jun 2022

Dear Dr. Suzuki,

Thank you very much for submitting your manuscript "Genome-wide screening identified SEC61A1 as an essential factor for mycolactone-dependent apoptosis in human premonocytic THP-1 cells" for consideration at PLOS Neglected Tropical Diseases. As with all papers reviewed by the journal, your manuscript was reviewed by members of the editorial board and by several independent reviewers. The reviewers appreciated the attention to an important topic. Based on the reviews, we are likely to accept this manuscript for publication, providing that you modify the manuscript according to the review recommendations.

Please ensure you instigate the editorial changes requested by reviewer 2. In particular, the final sentence should be altered... unfortunately other Sec61 inhibitors replicate (rather than ameliorate) mycolactone action, although it is agreed that modulating the downstream effects of this may be beneficial.

Please prepare and submit your revised manuscript within 30 days. If you anticipate any delay, please let us know the expected resubmission date by replying to this email.

When you are ready to resubmit, please upload the following:

[1] A letter containing a detailed list of your responses to all review comments, and a description of the changes you have made in the manuscript.

Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out

[2] Two versions of the revised manuscript: one with either highlights or tracked changes denoting where the text has been changed; the other a clean version (uploaded as the manuscript file).

Important additional instructions are given below your reviewer comments.

Thank you again for your submission to our journal. We hope that our editorial process has been constructive so far, and we welcome your feedback at any time. Please don't hesitate to contact us if you have any questions or comments.

Sincerely,

Rachel E Simmonds, Ph.D.

Guest Editor

PLOS Neglected Tropical Diseases

Gerd Pluschke

Deputy Editor

PLOS Neglected Tropical Diseases

***********************

Please ensure you instigate the editorial changes requested by reviewer 2. In particular, the final sentence should be altered... unfortunately other Sec61 inhibitors replicate (rather than ameliorate) mycolactone action, although it is agreed that modulating the downstream effects of this may be beneficial.

Reviewer's Responses to Questions

Key Review Criteria Required for Acceptance?

As you describe the new analyses required for acceptance, please consider the following:

Methods

-Are the objectives of the study clearly articulated with a clear testable hypothesis stated?

-Is the study design appropriate to address the stated objectives?

-Is the population clearly described and appropriate for the hypothesis being tested?

-Is the sample size sufficient to ensure adequate power to address the hypothesis being tested?

-Were correct statistical analysis used to support conclusions?

-Are there concerns about ethical or regulatory requirements being met?

Reviewer #2: (No Response)

Reviewer #3: The methods for addressing the questions raised by the reviewers are appropriate.

--------------------

Results

-Does the analysis presented match the analysis plan?

-Are the results clearly and completely presented?

-Are the figures (Tables, Images) of sufficient quality for clarity?

Reviewer #2: (No Response)

Reviewer #3: The results are sufficiently presented with the exception of the Western blot images in Figures 1,4 and 5. It is difficult to assess the quality of the Western blotting data as the images are cropped very close to the bands. I would recommend including uncropped WB images in the Supplementary Data section.

--------------------

Conclusions

-Are the conclusions supported by the data presented?

-Are the limitations of analysis clearly described?

-Do the authors discuss how these data can be helpful to advance our understanding of the topic under study?

-Is public health relevance addressed?

Reviewer #2: (No Response)

Reviewer #3: Conclusions are sufficiently supported by the data and study limitations are also discussed suitably.

--------------------

Editorial and Data Presentation Modifications?

Use this section for editorial suggestions as well as relatively minor modifications of existing data that would enhance clarity. If the only modifications needed are minor and/or editorial, you may wish to recommend “Minor Revision” or “Accept”.

Reviewer #2: Minor Points

1. Line 447. "Thasigargin also induced IRE1alpha and EIF2alpha phosphorylation". This sentence is ambiguous as it could be interpreted as indicating phosphorylation of IRE1 rather than an increased protein expression. Please rewrite making the meaning clear.

2. Line 491 . " The Sec61 complex also functions as a channel that mediates calcium leakage from the ER, a process required for stabilization if protein folding". This makes it sound as if it is the calcium leakage that stabilises folding whereas it is the calcium within the ER which is required for protein folding and the loss due to leakage will lead to destabilisation. Please rewrite this sentence to make this clear.

3. Line 508. "..thereby inhibiting the modification of signalling peptides.." It is not the inhibition of signal peptide modification which is causing the mislocalization but the inhibition of translocation into the ER. This sentence needs to be corrected.

4. Line 569. "... SEC61A1 knockout was not completely prevented by mycolactone-induced apoptosis.". I assume you mean mycolactone-induced aopotosis was not completely blocked by SEC61A1 knockout.

5. Line 587. "... to block mycolactone by inhibiting SEC61A..." Inhibition of SEC61A1 will NOT block the actions of mycolactone. Please take this out or rephrase to make it clear that you mean targeting of downstream effects.

Reviewer #3: I would recommend accepting the article in the current form if full Western blotting images are provided.

--------------------

Summary and General Comments

Use this section to provide overall comments, discuss strengths/weaknesses of the study, novelty, significance, general execution and scholarship. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. If requesting major revision, please articulate the new experiments that are needed.

Reviewer #2: The authors have adequately addressed most of my concerns. I think the paper should be accepted if the above editorial amendments are made

Reviewer #3: The authors have addressed all of the reviewer suggestions by new experiments or modifications to the text. I recommend publication of the article in the current form.

--------------------

PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #2: No

Reviewer #3: No

Figure Files:

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org.

Data Requirements:

Please note that, as a condition of publication, PLOS' data policy requires that you make available all data used to draw the conclusions outlined in your manuscript. Data must be deposited in an appropriate repository, included within the body of the manuscript, or uploaded as supporting information. This includes all numerical values that were used to generate graphs, histograms etc.. For an example see here: http://www.plosbiology.org/article/info%3Adoi%2F10.1371%2Fjournal.pbio.1001908#s5.

Reproducibility:

To enhance the reproducibility of your results, we recommend that you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. Additionally, PLOS ONE offers an option to publish peer-reviewed clinical study protocols. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols

References

Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article's retracted status in the References list and also include a citation and full reference for the retraction notice.

4 Jul 2022

Submitted filename: Suzuki K-Mycolactone response220704AK.docx

Click here for additional data file.

18 Jul 2022

Dear Dr. Suzuki,

We are pleased to inform you that your manuscript 'Genome-wide screening identified SEC61A1 as an essential factor for mycolactone-dependent apoptosis in human premonocytic THP-1 cells' has been provisionally accepted for publication in PLOS Neglected Tropical Diseases.

Before your manuscript can be formally accepted you will need to complete some formatting changes, which you will receive in a follow up email. A member of our team will be in touch with a set of requests.

Please note that your manuscript will not be scheduled for publication until you have made the required changes, so a swift response is appreciated.

IMPORTANT: The editorial review process is now complete. PLOS will only permit corrections to spelling, formatting or significant scientific errors from this point onwards. Requests for major changes, or any which affect the scientific understanding of your work, will cause delays to the publication date of your manuscript.

Should you, your institution's press office or the journal office choose to press release your paper, you will automatically be opted out of early publication. We ask that you notify us now if you or your institution is planning to press release the article. All press must be co-ordinated with PLOS.

Thank you again for supporting Open Access publishing; we are looking forward to publishing your work in PLOS Neglected Tropical Diseases.

Best regards,

Rachel E Simmonds, Ph.D.

Guest Editor

PLOS Neglected Tropical Diseases

Gerd Pluschke

Section Editor

PLOS Neglected Tropical Diseases

***********************************************************

4 Aug 2022

Dear Dr. Suzuki,

We are delighted to inform you that your manuscript, "Genome-wide screening identified SEC61A1 as an essential factor for mycolactone-dependent apoptosis in human premonocytic THP-1 cells," has been formally accepted for publication in PLOS Neglected Tropical Diseases.

We have now passed your article onto the PLOS Production Department who will complete the rest of the publication process. All authors will receive a confirmation email upon publication.

The corresponding author will soon be receiving a typeset proof for review, to ensure errors have not been introduced during production. Please review the PDF proof of your manuscript carefully, as this is the last chance to correct any scientific or type-setting errors. Please note that major changes, or those which affect the scientific understanding of the work, will likely cause delays to the publication date of your manuscript. Note: Proofs for Front Matter articles (Editorial, Viewpoint, Symposium, Review, etc...) are generated on a different schedule and may not be made available as quickly.

Soon after your final files are uploaded, the early version of your manuscript will be published online unless you opted out of this process. The date of the early version will be your article's publication date. The final article will be published to the same URL, and all versions of the paper will be accessible to readers.

Thank you again for supporting open-access publishing; we are looking forward to publishing your work in PLOS Neglected Tropical Diseases.

Best regards,

Shaden Kamhawi

co-Editor-in-Chief

PLOS Neglected Tropical Diseases

Paul Brindley

co-Editor-in-Chief

PLOS Neglected Tropical Diseases