Joy Ogbechi1, Belinda S Hall1, Thomas Sbarrato2, Jack Taunton3, Anne E Willis2, Ronald C Wek4, Rachel E Simmonds5. 1. Department of Microbial Sciences, School of Biosciences and Medicine, University of Surrey, Guildford, Surrey, GU2 7XH, UK. 2. MRC Toxicology Unit, Lancaster Rd, Leicester, LE1 9HN, UK. 3. Department of Cellular and Molecular Pharmacology, University of California, San Francisco, San Francisco, CA, 94158, USA. 4. Department of Biochemistry and Molecular Biology, Indiana University School of Medicine, Indianapolis, IN, 46202-5126, USA. 5. Department of Microbial Sciences, School of Biosciences and Medicine, University of Surrey, Guildford, Surrey, GU2 7XH, UK. rachel.simmonds@surrey.ac.uk.
Abstract
Mycolactone is the exotoxin virulence factor of Mycobacterium ulcerans that causes the neglected tropical disease Buruli ulcer. We recently showed it to be a broad spectrum inhibitor of Sec61-dependent co-translational translocation of proteins into the endoplasmic reticulum (ER). An outstanding question is the molecular pathway linking this to its known cytotoxicity. We have now used translational profiling to better understand the reprogramming that occurs in cells exposed to mycolactone. Gene ontology identified enrichment in genes involved in cellular response to stress, and apoptosis signalling among those showing enhanced translation. Validation of these results supports a mechanism by which mycolactone activates an integrated stress response meditated by phosphorylation of eIF2α via multiple kinases (PERK, GCN, PKR) without activation of the ER stress sensors IRE1 or ATF6. The response therefore uncouples the integrated stress response from ER stress, and features translational and transcriptional modes of genes expression that feature the key regulatory transcription factor ATF4. Emphasising the importance of this uncoupled response in cytotoxicity, downstream activation of this pathway is abolished in cells expressing mycolactone-resistant Sec61α variants. Using multiple genetic and biochemical approaches, we demonstrate that eIF2α phosphorylation is responsible for mycolactone-dependent translation attenuation, which initially protects cells from cell death. However, chronic activation without stress remediation enhances autophagy and apoptosis of cells by a pathway facilitated by ATF4 and CHOP. Our findings demonstrate that priming events at the ER can result in the sensing of stress within different cellular compartments.
Mycolactone is the exotoxin virulence factor of Mycobacterium ulcerans that causes the neglected tropical disease Buruli ulcer. We recently showed it to be a broad spectrum inhibitor of Sec61-dependent co-translational translocation of proteins into the endoplasmic reticulum (ER). An outstanding question is the molecular pathway linking this to its known cytotoxicity. We have now used translational profiling to better understand the reprogramming that occurs in cells exposed to mycolactone. Gene ontology identified enrichment in genes involved in cellular response to stress, and apoptosis signalling among those showing enhanced translation. Validation of these results supports a mechanism by which mycolactone activates an integrated stress response meditated by phosphorylation of eIF2α via multiple kinases (PERK, GCN, PKR) without activation of the ER stress sensors IRE1 or ATF6. The response therefore uncouples the integrated stress response from ER stress, and features translational and transcriptional modes of genes expression that feature the key regulatory transcription factor ATF4. Emphasising the importance of this uncoupled response in cytotoxicity, downstream activation of this pathway is abolished in cells expressing mycolactone-resistant Sec61α variants. Using multiple genetic and biochemical approaches, we demonstrate that eIF2α phosphorylation is responsible for mycolactone-dependent translation attenuation, which initially protects cells from cell death. However, chronic activation without stress remediation enhances autophagy and apoptosis of cells by a pathway facilitated by ATF4 and CHOP. Our findings demonstrate that priming events at the ER can result in the sensing of stress within different cellular compartments.
Mycolactone is a toxin produced by Mycobacterium ulcerans, the causative organism of Buruli ulcer[1] (BU). All BU pathology is caused by this diffusible polyketide-derived compound acting remotely from the bacteria[2]. It is cytotoxic and immunosuppressive, inhibiting production of cytokines, chemokines and adhesion molecules[3]. The cellular effects of mycolactone can be attributed to its inhibitory effect on the Sec61 translocon[4]. Mycolactone inhibits co-translational translocation of secretory proteins, Type II transmembrane proteins (TMPs) and most Type I TMPs[5,6], an essential early step in targeting most membrane and secretory proteins to the correct compartment[7]. Known Sec61 inhibitors include eeyarestatin I (ESI), CAM741/cotransin and decatransin[8], and mycolactone can compete with cotransin for Sec61α binding, suggesting a similar interaction site[9]. However, mycolactone is more potent than all these, inhibiting protein translocation at nanomolar doses[4,9]. Despite great advances in our understanding of mycolactone function, the mechanistic linkage between translocation blockade and cell death by apoptosis[9,10] has not been defined.The integrated stress response (ISR) is a highly conserved adaptation to stress centred upon phosphorylation of the alpha subunit of eukaryotic initiation factor 2 (eIF2α)[11]. Four eIF2α kinases sense distinct stress conditions: HRI (EIF2AK1), PKR (EIF2AK2), PERK (EIF2AK3) and GCN2 (EIF2AK4). Phosphorylation of eIF2α (p-eIF2α) inhibits global translation, conserving cellular resources and facilitating reprogramming of gene expression. Simultaneously, p-eIF2α directs preferential translation of a subset of ‘stress response’ mRNAs, including ATF4, via a delayed translation reinitiation that allows ribosome scanning through inhibitory upstream open reading frames (uORF)[12]. ATF4 drives enhanced transcription of genes that collectively can alleviate stress[13], including GADD34 (PPP1R15A), which targets PP1 for dephosphorylation of p-eIF2α in the feedback control of the ISR[14,15]. During chronic stress this pathway can also act to promote apoptosis, mediated by another ATF4 target; CHOP (DDIT-3)[16].The eIF2α kinase PERK is usually considered to be activated by endoplasmic reticulum (ER) stress, sensing disturbances in calcium homeostasis, redox status or protein load that compromise protein folding and assembly in this organelle[17]. PERK represents one arm of the Unfolded Protein Response (UPR), acting in conjunction with two other ER stress sensors, IRE1 and ATF6. Upon ER stress, IRE1 undergoes autophosphorylation and activation, resulting in cytosolic splicing of XBP1 mRNA[18-20], whereas ATF6 transits from the ER to the Golgi where it is cleaved into its active form[21]. Both XBP-1 and ATF6 mediate their cellular effects as transcription factors that reprogramme gene expression.Previously, we noted global changes to polysome profiles in cells after mycolactone exposure[4]. Here, we use ‘translational profiling’ to reveal pan-activation of the ISR without concurrent ER stress. Instead inhibition of Sec61 at the ER is sensed in the cytosol, leading to changes in translational and transcriptional control, autophagy and ultimately, cell death.
Results
Translational profiling identifies response to stress as an enriched gene ontology functional group
Polysome profiling performed on activated macrophages (LPS-stimulated RAW264.7 cells) showed that, as previously described[4], mycolactone reduced the peak area in polysomal fractions and increased that of sub-polysomal fractions (Fig. 1a). This pattern, indicative of repression of translation initiation, also occurs in the absence of LPS[4] (Fig. S1A). However, the effect is weak compared to positive control tunicamycin, a pharmacological inducer of ER stress[12] (Fig. S1B).
Fig. 1
Translational microarray of cells exposed to mycolactone identifies ATF4 as translationally upregulated.
a−g RAW264.7 cells pre-incubated for 1 h (mycolactone (MYC) or DMSO) then stimulated with 100 ng/ml LPS for 4 h or tunicamycin alone (Tuni). a−e Cell lysates were subject to polysome profiling and translational microarrays, as described in the text. a Mycolactone induces changes in polysome profiles. RNA purified from subpolysomal fractions (1–5) and polysomal fractions (6–10) was pooled and used in microarray analysis as described in Methods. b Scatter plot for probes in the microarray. Black and blue dots represent probes enriched in either polysomes or sub-polysomes respectively. Rank product analysis rules out changes in transcription and achieves a high validation rate for translationally regulated targets. c Summary of microarray data following translational profiling analysis as described in Methods. d Heatmap showing representative data for genes in eight significantly overrepresented gene ontology groups (p < 0.05), identified by PANTHER. e Northern blotting for transcripts in individual gradient fractions from LPS stimulated RAW264.7 cells, the migration of 18S rRNA is indicated; quantified in (f); n = 3 independent experiments. g Cell lysates were analysed by immunoblotting. h Relative fold change (ΔΔCt) for steady-state mRNA levels determined by one-step qRT-PCR on total RNA (Mean ± SEM, n = 3 independent experiments). i HeLa cells were treated as shown and lysates were analysed by immunoblotting. All immunoblots show the approximate migration of molecular weight markers in kDa. See also Figs. S1 and S2, Tables S1 and S2
Translational microarray of cells exposed to mycolactone identifies ATF4 as translationally upregulated.
a−g RAW264.7 cells pre-incubated for 1 h (mycolactone (MYC) or DMSO) then stimulated with 100 ng/ml LPS for 4 h or tunicamycin alone (Tuni). a−e Cell lysates were subject to polysome profiling and translational microarrays, as described in the text. a Mycolactone induces changes in polysome profiles. RNA purified from subpolysomal fractions (1–5) and polysomal fractions (6–10) was pooled and used in microarray analysis as described in Methods. b Scatter plot for probes in the microarray. Black and blue dots represent probes enriched in either polysomes or sub-polysomes respectively. Rank product analysis rules out changes in transcription and achieves a high validation rate for translationally regulated targets. c Summary of microarray data following translational profiling analysis as described in Methods. d Heatmap showing representative data for genes in eight significantly overrepresented gene ontology groups (p < 0.05), identified by PANTHER. e Northern blotting for transcripts in individual gradient fractions from LPS stimulated RAW264.7 cells, the migration of 18S rRNA is indicated; quantified in (f); n = 3 independent experiments. g Cell lysates were analysed by immunoblotting. h Relative fold change (ΔΔCt) for steady-state mRNA levels determined by one-step qRT-PCR on total RNA (Mean ± SEM, n = 3 independent experiments). i HeLa cells were treated as shown and lysates were analysed by immunoblotting. All immunoblots show the approximate migration of molecular weight markers in kDa. See also Figs. S1 and S2, Tables S1 and S2To better understand this reprogramming, we performed translational profiling, analysing genome-wide redistribution of gene transcripts in mycolactone-exposed cells[22,23]. This approach determines changes in the relative abundance of polysomal vs. sub-polysomal transcripts as a surrogate measure of translational efficiency[23]. Of probes that detected targets, approximately 5% were significantly altered between the different pools in response to mycolactone (p < 0.05, Fig. 1b, c, Tables S1 and S2; GEO: GSE103002).Gene ontology (GO) analysis of unique genes with transcripts altered >2-fold (Fig. 1d) showed enrichment in sub-polysomes (reduced translation) of genes involved in interferon β responses, rRNA processing and translation. Those enriched in polysomes (enhanced translation) included genes involved in ATP synthesis, cellular response to stress and apoptosis signalling (Fig. 1d); in particular ATF4, CHOP and GADD34 warranted further study, given the known cytotoxic effects of mycolactone.
Induction of ATF4 and CHOP is a common feature of cells exposed to mycolactone
Northern blots confirmed redistribution of ATF4 mRNA within polysome profiles (Fig. 1e; quantified in Fig. 1f, left). Mycolactone caused a strong induction of ATF4 protein expression (Fig. 1g) independent of cell activation (Fig. 1g, compare lanes 4 and 5). Induction of ATF4 expression was associated with a 3.9 ± 0.7-fold (p < 0.0001) increase in ATF4 mRNA (Fig. 1h). Thus, mycolactone increases both ATF4 mRNA and its translational efficiency, a mode of gene expression characteristic of the ISR consequent to phosphorylation of eIF2α.CHOP, a known downstream target of ATF4[12], was also induced by mycolactone, similarly independent of LPS (Fig. 1g). CHOP showed a large increase in steady-state mRNA level (25.4 ± 5.1 fold (p < 0.0001, Fig. 1h), suggesting ATF4-directed transcriptional induction accounts for a major portion of the observed increase in protein abundance.Since induction of ATF4 and CHOP were independent of cell activation, we determined whether mycolactone induced ISR regulators in a hierarchical fashion in the more genetically tractable HeLa cells (Fig. 1i). As in RAW264.7 cells, we observed p-eIF2α 3 h after mycolactone treatment, coinciding with ATF4 induction, and followed shortly after by CHOP. Indeed, this response to mycolactone is conserved widely between cell types (Fig. S2), although, as with other mycolactone-dependent responses, sensitivity varies[1,4,24-27]. Taken together, these data validate the translational profiling findings and suggest mycolactone may elicit a prototypical stress response.
The mycolactone response involves multiple eIF2α kinases but not ER stress
The ISR overlaps with ER stress due to the participation of PERK in both pathways (Fig. 2a). Since the cellular target of mycolactone, the Sec61 translocon, is located in the ER membrane, we reasoned ER stress was a likely mediator. Mouse embryonic fibroblast MEFs respond rapidly to mycolactone, with ATF4 detected after 2 h exposure (Fig. S2B). As previously reported[12], MEFs with a homozygous genetic deletion of PERK showed a strongly attenuated response to tunicamycin (Fig. 2b, lanes 4 and 8). In PERK−/− MEFs, mycolactone-induced p-eIF2α was reduced compared to wild type (Fig. 2b, compare lanes 3 and 7), and ATF4 expression decreased by 85 ± 2.2% (p = 0.0002). Furthermore, we detected modest, but rapid, phosphorylation of PERK in mycolactone-treated cells (Fig. 2c).
Fig. 2
Mycolactone uncouples the integrated response from the unfolded protein response via a pathway that implicates multiple eIF2α kinases.
a Cartoon representation of the ISR and ER stress response sensors and consequences. Genes that are specifically induced by the three ER sensors are shown. b Wild-type (WT) or knockout MEFs were treated with either mycolactone (MYC), DMSO or tunicamycin (Tuni), and the lysates were analysed by immunoblotting. * indicates a cross-reactive band. Relative semi-quantified signal intensities for ATF4 (Mean ± SEM, n = 3 independent experiments). c, h, i HeLa cells were treated as shown and lysates were analysed by immunoblotting. Representative data from n > 3 independent experiments. d HeLa cells were treated as shown. Total RNA was isolated and used as a template for RT-PCR of XBP-1 (upper panel) which was then digested with Pst1 and separated on a 2% agarose gel (lower panel). The migration of molecular weight markers in bp is indicated. S spliced, US unspliced. e, f HeLa cells were treated with DMSO for 48 h, DTT for 1 h or mycolactone (MYC) for the indicated duration (up to 48 h). Equal protein quantities in lysates were analysed by immunoblotting. * indicates a cross-reactive band. g HeLa cells were treated as shown for 10 h. Relative fold change (ΔΔCt) for steady-state mRNA levels determined by one-step qRT-PCR on total RNA (Mean ± SEM of three independent experiments). All immunoblots show the approximate migration of molecular weight markers in kDa. See also Fig. S3
Mycolactone uncouples the integrated response from the unfolded protein response via a pathway that implicates multiple eIF2α kinases.
a Cartoon representation of the ISR and ER stress response sensors and consequences. Genes that are specifically induced by the three ER sensors are shown. b Wild-type (WT) or knockout MEFs were treated with either mycolactone (MYC), DMSO or tunicamycin (Tuni), and the lysates were analysed by immunoblotting. * indicates a cross-reactive band. Relative semi-quantified signal intensities for ATF4 (Mean ± SEM, n = 3 independent experiments). c, h, i HeLa cells were treated as shown and lysates were analysed by immunoblotting. Representative data from n > 3 independent experiments. d HeLa cells were treated as shown. Total RNA was isolated and used as a template for RT-PCR of XBP-1 (upper panel) which was then digested with Pst1 and separated on a 2% agarose gel (lower panel). The migration of molecular weight markers in bp is indicated. S spliced, US unspliced. e, f HeLa cells were treated with DMSO for 48 h, DTT for 1 h or mycolactone (MYC) for the indicated duration (up to 48 h). Equal protein quantities in lysates were analysed by immunoblotting. * indicates a cross-reactive band. g HeLa cells were treated as shown for 10 h. Relative fold change (ΔΔCt) for steady-state mRNA levels determined by one-step qRT-PCR on total RNA (Mean ± SEM of three independent experiments). All immunoblots show the approximate migration of molecular weight markers in kDa. See also Fig. S3The three ER stress sensors (Fig. 2a) are thought to respond in parallel[17]; however, we have strong evidence that mycolactone activates PERK without discernible activation of IRE1 or ATF6. In accordance with previous findings[4], IRE1 activation (identified by splicing of XBP1) was undetectable in mycolactone-treated cells (Fig. 2d) even at extended timepoints (Fig. S3A). Furthermore, no ATF6 cleavage was observed following mycolactone exposure (Fig. 2e and Fig. S3B). On the contrary, mycolactone caused depletion of full length ATF6, presumably because it is a Sec61-dependent type II TMP[6]. IRE1 and PERK are also depleted by mycolactone, but after extended exposure times (Fig. 2f). Induction of discriminatory target gene mRNAs downstream of the three sensors[28] confirmed these findings. While tunicamycin upregulates all three gene, (Fig. 2g), mycolactone only induced Sestrin-2 (SESN2, downstream of the ISR, p = 0.0045) but not Signal Sequence Receptor Subunit 2 (SSR2, downstream of IRE1 and XBP1) or Calreticulin (CALR, downstream of ATF6).Since these findings suggest that the stress induced by mycolactone is not being sensed in the ER, we asked whether other eIF2α kinases may also be involved in the response. We found a broad and rapid activation of eIF2α kinases (Figs. S3C, D). Phosphorylation of the nutrient sensor GCN2[29] was evident after 1 h of exposure (Fig. 2h) and continued to increase up to 8 h. Transient phosphorylation of PKR (Fig. 2i), which normally senses viral dsRNA[11] but also hyperosmotic stress in an RNA-independent manner[30], may explain the residual ATF4 induction we observed in PERK−/− GCN2−/− MEFs (Fig. S3D). Hence, our results demonstrate that multiple eIF2a kinases are involved in the ISR in mycolactone-exposed cells.
eIF2α phosphorylation and translational attenuation is required for ATF4 induction by mycolactone
To confirm mycolactone induces the ISR, we used several different experimental approaches. First, we measured the impact of mycolactone on translation, observing a large reduction (66.5 ± 8.2% (p = 0.0056)) in puromycin incorporation (Fig. 3a). This finding, combined with the reduction in polysomes upon mycolactone treatment (Fig. 1), is consistent with reduced availability of the ternary complex expected following eIF2α phosphorylation. Second, we assessed the effect of mycolactone in cells stably overexpressing the p-eIF2α phosphatase GADD4. Here, mycolactone induced neither p-eIF2α nor ATF4 expression (Fig. 3b, lane 5). In control cells expressing KARA (a GADD34 (Val225Ala, Phe558Ala) variant unable to recruit PP1[14]), both ISR markers were detected after mycolactone treatment (Fig. 3b, lane 2). Third, pharmacological inhibition of the ISR was achieved with ISRIB, which activates the guanine nucleotide exchange activity of eIF2B, partially restoring eIF2-GTP levels and translation even during stress and despite high p-eIF2α levels[31,32]. ISRIB reduced the degree of ATF4 induction by mycolactone (Fig. 3c, compare lanes 4 and 5) and also partially reversed the mycolactone-dependent changes to polysome profiles (Fig. 3d). Taken together, these findings strongly support a model whereby mycolactone stimulates p-eIF2α, attenuating translation and driving ATF4 expression.
Fig. 3
eIF2α phosphorylation and translational control drive ATF4 expression in cells exposed to mycolactone.
a Immunoblot analysis of newly synthesised puromycilated proteins prepared from HeLa cells exposed to DMSO, mycolactone (MYC) or tunicamycin (Tuni) for 12 h. Relative quantified signal intensities are shown (Mean ± SEM, n = 3 independent experiments). b HeLa-gs cells stably expressing GFP-GADD34 (clone 8) or GFP-KARA (clone 4), an inactive mutant of GADD34, were exposed for 5 h. Lysates were analysed by immunoblotting. c HeLa cells were pre-treated with ISRIB for 1 h, followed by exposure to mycolactone for 8 h. Lysates were analysed by immunoblotting. d RAW246.7 cells were exposed to either DMSO, mycolactone or 100 nM ISRIB for 5 h. For co-incubation cells were pre-treated with ISRIB for 1 h prior to addition of mycolactone. Cell lysates were subject to polysome profiling. All immunoblots show the approximate migration of molecular weight markers in kDa. All data representative of at least three independent experiments
eIF2α phosphorylation and translational control drive ATF4 expression in cells exposed to mycolactone.
a Immunoblot analysis of newly synthesised puromycilated proteins prepared from HeLa cells exposed to DMSO, mycolactone (MYC) or tunicamycin (Tuni) for 12 h. Relative quantified signal intensities are shown (Mean ± SEM, n = 3 independent experiments). b HeLa-gs cells stably expressing GFP-GADD34 (clone 8) or GFP-KARA (clone 4), an inactive mutant of GADD34, were exposed for 5 h. Lysates were analysed by immunoblotting. c HeLa cells were pre-treated with ISRIB for 1 h, followed by exposure to mycolactone for 8 h. Lysates were analysed by immunoblotting. d RAW246.7 cells were exposed to either DMSO, mycolactone or 100 nM ISRIB for 5 h. For co-incubation cells were pre-treated with ISRIB for 1 h prior to addition of mycolactone. Cell lysates were subject to polysome profiling. All immunoblots show the approximate migration of molecular weight markers in kDa. All data representative of at least three independent experiments
The ISR initially protects against cell death by inducing autophagic responses
To determine the consequences of ISR activation, we compared survival of cells stably expressing GADD34 to wild-type and KARA cells. Cells exposed to mycolactone can persist for several days before succumbing to apoptosis[33-35], although different cells show distinct kinetics (Fig. S4A). Here we followed cell death, as determined by activation of caspase 3/7 and PI staining, using time-points and concentrations where WT cells show minimal change. The inability to induce an ISR provided a significant loss of protection from mycolactone-induced cell death (55 vs. 89% surviving cells, p = 0.0042, Fig. 4a). Likewise, PERK−/− GCN2−/− MEFs also showed reduced survival (31 vs. 91%, p < 0.0001, Fig. 4b). Both cell types were equally susceptible to the control staurosporine.
Fig. 4
The phosphorylation of eIF2α protects cells by a mechanism that involves adaptive autophagy.
a HeLa-gs cells stably expressing GFP-GADD34 (clone 8) or GFP-KARA (clone 4), an inactive mutant of GADD34, were treated with mycolactone for 4 days The number of apoptotic cells (positive for both active caspase 3/7 and PI) were determined for three fields and expressed as a proportion of total cells (Mean ± SEM n = 4 independent experiments). b Wild-type and PERK−/− GCN2−/− MEFs were treated with mycolactone for 24 h and analysed by confocal microscopy as in (a). c, d HeLa cells were treated as shown or with chloroquine (CQ) for 12 h. Equal protein quantities in lysates were analysed by immunoblotting. e WT and PERK−/− GCN2−/− MEFs were treated as in (c). Lysates were analysed by immunoblotting. All data representative of at least three independent experiments. All immunoblots show the approximate migration of molecular weight markers in kDa. See also Fig. S4
The phosphorylation of eIF2α protects cells by a mechanism that involves adaptive autophagy.
a HeLa-gs cells stably expressing GFP-GADD34 (clone 8) or GFP-KARA (clone 4), an inactive mutant of GADD34, were treated with mycolactone for 4 days The number of apoptotic cells (positive for both active caspase 3/7 and PI) were determined for three fields and expressed as a proportion of total cells (Mean ± SEM n = 4 independent experiments). b Wild-type and PERK−/− GCN2−/− MEFs were treated with mycolactone for 24 h and analysed by confocal microscopy as in (a). c, d HeLa cells were treated as shown or with chloroquine (CQ) for 12 h. Equal protein quantities in lysates were analysed by immunoblotting. e WT and PERK−/− GCN2−/− MEFs were treated as in (c). Lysates were analysed by immunoblotting. All data representative of at least three independent experiments. All immunoblots show the approximate migration of molecular weight markers in kDa. See also Fig. S4This altered susceptibility can be explained, at least in part, by an inability to induce autophagy[28]. Others have previously shown that mycolactone induces this adaptation to stress[34]. However, whereas Gama et al. ascribed autophagy induction to cytoskeletal changes, we show it is linked to the mycolactone-dependent ISR. We probed processing of microtubule-associated protein 1 light chain 3 (LC3-I), through lipidation, to LC3-II. Mycolactone, like tunicamycin and chloroquine, causes accumulation of LC3-II in HeLa cells (Fig. 4c) and other cell types (Fig S4B). Co-incubation of cells with mycolactone and chloroquine (an inhibitor of autolysosome degradation[36]) further increased levels of LC3-II (Fig. 4d, lanes 4 and 5), thus ruling out reduced autophagosome turnover as the cause of LC3-II accumulation. That autophagy is induced in a stress-dependent manner similarly to tunicamycin[37] is supported by experiments in PERK−/− GCN2−/− MEFs, which retained chloroquine-mediated but not mycolactone-induced induction of LC3-II (Fig. 4e, lanes 3 and 8).
Chronic exposure to mycolactone causes death via the ATF4/Bcl-2/Bim route
ER stress responses, while initially protective, can also be damaging to cells, particularly in the face of chronic stress. These latter effects are driven not only by ATF4/CHOP but also IRE1[38]. Investigating the contributions of the different pathways normally requires genomic approaches as there are no known examples of inhibitors that activate PERK without also activating the other two ER sensors and CHOP is also a transcriptional target of both XBP-1 (IRE1) and ATF6[38,39]. We are now able to shed light on this by investigating the effects of mycolactone via the ISR in cells with and without ATF4 (Fig. S5). In two independent CRISPR/Cas9 generated knockout clones, neither ATF4 nor CHOP were induced by mycolactone or Leucine starvation, despite normal levels of p-eIF2α (Fig. 5a, compare lane 2 with lanes 5 and 8), providing further evidence of UPR absence in mycolactone-treated cells. Both ATF4 knockouts have a slightly elevated endogenous level of p-eIF2α (Fig. 5a, compare lane 1 with lanes 4 and 7), likely due to lowered expression of expression of GADD34, a downstream target of ATF4[40].
Fig. 5
ATF4 promotes mycolactone-mediated cytotoxicity.
a, b Wild-type HeLa cells and two different ATF4−/− clones (3 and 5.5) were treated with either DMSO, mycolactone (MYC) or starved of leucine (Leu−). a Lysates from 24-h-treated cells were analysed by immunoblotting. b After 4 days the % survival of cells was determined by staining of cells with propidium iodide (PI), cell event (detects active caspase 3/7) and DRAQ5. The number of live cells (negative for both active caspase 3/7 and PI) in three fields was determined and expressed as a proportion of total cells (Mean ± SEM, n = 3 independent experiments). c−e HeLa cells were treated as shown or with LY294002 (LY) for 1 h. Equal protein quantities in lysates were analysed by immunoblotting. All immunoblots show the approximate migration of molecular weight markers in kDa. See also Fig. S5
ATF4 promotes mycolactone-mediated cytotoxicity.
a, b Wild-type HeLa cells and two different ATF4−/− clones (3 and 5.5) were treated with either DMSO, mycolactone (MYC) or starved of leucine (Leu−). a Lysates from 24-h-treated cells were analysed by immunoblotting. b After 4 days the % survival of cells was determined by staining of cells with propidium iodide (PI), cell event (detects active caspase 3/7) and DRAQ5. The number of live cells (negative for both active caspase 3/7 and PI) in three fields was determined and expressed as a proportion of total cells (Mean ± SEM, n = 3 independent experiments). c−e HeLa cells were treated as shown or with LY294002 (LY) for 1 h. Equal protein quantities in lysates were analysed by immunoblotting. All immunoblots show the approximate migration of molecular weight markers in kDa. See also Fig. S5ATF4 knockout clones were protected from mycolactone-mediated cell death (9 vs. 52% cells surviving, p = 0.0004, Fig. 5b), likely due to the absence of CHOP induction, which is known to promote cell death by altering expression of the pro-apoptotic Bim and pro-survival Bcl-2[41]. In WT cells, mycolactone exposure decreased Bcl-2 expression from 24 h (Fig. 5c) and increased Bim from 48 h (Fig. 5d) suggesting that ISR-dependent induction of ATF4 and CHOP causes a shift in the pro/anti-apoptotic mechanisms to favour apoptosis from 48 h onward. Although upregulation of Bim by mycolactone has been ascribed to direct inhibition of mTORC2 signalling[10], given the known cross-talk between eIF2α and mTORC2 pathways[42,43] it is also possible that loss of mTORC2-dependent Akt phosphorylation at Ser473 between 24 and 48 h after exposure (Fig. 5e) is secondary to induction of ATF4.
ATF4 induction depends on Sec61 blockade by mycolactone
To verify that mycolactone responses arise from Sec61 inhibition, we used random mutagenesis with ENS[44] to generate mycolactone-resistant cells in the DNA repair-defective cell line HCT-116. Eight of nine independent, mycolactone-resistant clones analysed to date have one of two heterozygous mutations in the SEC61A1 gene locus (Asp60Gly and Arg66Lys). These cells are highly resistant to the cytotoxic effects of mycolactone (Fig. 6a) and show reduced depletion of ATF6, used here as a surrogate for translocation blockade (Fig. 6b). In line with heterozygosity, restoration of ATF6 levels is only partial. As expected, all cells induced ATF4 in response to leucine starvation (Fig. 6b). Remarkably, and in contrast to parental cells, no ATF4 was induced in Sec61-mutant cells exposed to mycolactone (Fig. 6b) strongly suggesting ATF4 induction is associated with the ability of mycolactone to alter translocon functionality.
Fig. 6
Uncoupling of the ISR from ER stress is a consequence of mycolactone’s effect on the Sec61 translocon, but is not a general feature of translocation inhibition.
a, b An unbiased screen for mycolactone-resistant clones was performed in HCT-116 cells, yielding clones with heterozygous missense mutations in Sec61A1. Parental HCT-116 cells and representative clones with D60G and R66K were analysed. a Normalised viability index of cells treated with mycolactone for 5 days, assessed by MTT assay. b Immunoblot of lysates that were treated with DMSO, mycolactone or starved of Leucine (Leu−) for 24 h. c, d Wild-type MEFs were treated with CT8 (c) or CT9 (d) for the indicated times or tunicamycin (Tuni). Lysates were analysed by immunoblotting. e, f Wild-type (WT) or PERK−/− MEFs were treated as shown and the lysates were analysed by immunoblotting. g Wild-type MEFs were treated as shown. Total RNA was isolated and used as a template for RT-PCR of XBP-1 (upper panel) which was then digested with Pst1 and separated on a 2% agarose gel (lower panel). The migration of molecular weight markers in bp is indicated. S spliced, US unspliced. All data representative of at least two independent experiments. h HeLa cells were treated as shown for 10 h. Relative fold change (ΔΔCt) for steady-state mRNA levels (Mean ± SEM, n = 3 independent experiments). All immunoblots show the approximate migration of molecular weight markers in kDa
Uncoupling of the ISR from ER stress is a consequence of mycolactone’s effect on the Sec61 translocon, but is not a general feature of translocation inhibition.
a, b An unbiased screen for mycolactone-resistant clones was performed in HCT-116 cells, yielding clones with heterozygous missense mutations in Sec61A1. Parental HCT-116 cells and representative clones with D60G and R66K were analysed. a Normalised viability index of cells treated with mycolactone for 5 days, assessed by MTT assay. b Immunoblot of lysates that were treated with DMSO, mycolactone or starved of Leucine (Leu−) for 24 h. c, d Wild-type MEFs were treated with CT8 (c) or CT9 (d) for the indicated times or tunicamycin (Tuni). Lysates were analysed by immunoblotting. e, f Wild-type (WT) or PERK−/− MEFs were treated as shown and the lysates were analysed by immunoblotting. g Wild-type MEFs were treated as shown. Total RNA was isolated and used as a template for RT-PCR of XBP-1 (upper panel) which was then digested with Pst1 and separated on a 2% agarose gel (lower panel). The migration of molecular weight markers in bp is indicated. S spliced, US unspliced. All data representative of at least two independent experiments. h HeLa cells were treated as shown for 10 h. Relative fold change (ΔΔCt) for steady-state mRNA levels (Mean ± SEM, n = 3 independent experiments). All immunoblots show the approximate migration of molecular weight markers in kDaIn an alternative approach, we compared the mycolactone response with that of two variants of cotransin. CT8 is a selective inhibitor of translocation, whereas CT9 has broad-spectrum effects[9,45]. Both drugs induce ATF4 expression at higher doses (2 µM), albeit with slightly different kinetics (Fig. 6c, d; and cf. Fig. S2B), and less strongly than mycolactone. A weak ATF4 signal could be detected in cotransin-treated PERK−/− MEFs (Fig. 6e, f), suggesting other kinases may also participate in the response to cotransins. Nevertheless, an uncoupling of the ISR from ER stress does not appear to be a common feature of translocation inhibition, since partial XBP1 splicing was also detected (Fig. 6g), coinciding with a small induction of SSR2 expression, though not statistically significant (Fig. 6h).
Discussion
We have identified an unusual property of the M. ulcerans exotoxin and Sec61-dependent translocation inhibitor, mycolactone, which is characterised by activation of PERK and other eIF2α kinases without concomitant activation of IRE1 and ATF6. This study therefore not only sheds light on the molecular mechanisms driving cell death in BU disease but also reveals highly selective cross-talk between the ER and the cytosol during stress.The uncoupling of PERK activation from the other ER stress pathways is remarkable because stressful stimuli such as tunicamycin[41] usually activate the ISR and ER stress responses in unison, since loss of BiP binding activates each pathway[46]. Furthermore, in addition to PERK, at least two other eIF2α kinases contribute to the cellular response to mycolactone (PKR and GCN2) and no single kinase is solely responsible for the subsequent eIF2α phosphorylation and ATF4 induction. Such multiple-activation of eIF2α kinases has previously been shown to occur following UVB irradiation and in conditions causing oxidative stress (e.g. arsenite or H2O2)[47], although here the UPR is also activated. Mycolactone has previously been shown to cause ROS production[48], and inhibition of this by the addition of a combination of antioxidants (deferoxamine and TEMPOL) reduced cytotoxicity. Since selective activation of the ISR is dependent on mycolactone’s actions at the Sec61 translocon, future experiments will examine whether oxidative stress or production of other metabolites triggered by the inhibition of translocation might drive the response.One explanation for the lack of UPR in mycolactone-exposed cells is the Sec61-depedence of the ER stress sensors themselves. ATF6 is a type II TMP, a class of protein that is particularly susceptible to mycolactone inhibition[5]. Inhibition of translocation leads to cytosolic degradation of newly synthesised proteins[4]. Since the half-life of ATF6 is ~2 h[49] the observed decrease in cellular levels is not unexpected and could explain the failure to trigger this arm of the UPR. However, IRE1 and PERK are type I membrane proteins, which show a more variable response to mycolactone in vitro[5] and have longer half-lives[46,50]. Since IRE1 is still detectable ~12 h after mycolactone addition, the lack of XBP1 splicing or SSR2 induction is less readily explained.Taken together, our findings support a model in which mycolactone-mediated stress at the ER interface can be sensed predominantly in the cytosol, but responses are not contained within a single compartment. This supports recent findings of important cross-talk between the ER and the cytosol[51]. Others have previously examined the impact of translocation blockade on similar pathways. Notably, both genetic knockdown of translocon components[28] or chemical treatment with other translocation inhibitors ESI[52], CAM741[53] or cotransins (this manuscript), all cause activation of IRE1. Thus, the uncoupled response to mycolactone is not common to translocation inhibition per se. The differences between mycolactone and cotransin are unexpected because of the overlap in missense mutations conferring resistance[9,44,45]. Furthermore, mycolactone competes for cotransin binding to Sec61α implying a coincident binding site[9]. Nevertheless, the downstream effects seem different, suggesting distinct mechanisms of action. As cotransin is a cyclodepsipeptide and mycolactone is a polyketide lactone[8], with very different chemical properties, they may interact with the translocon in distinct ways, even if the binding site is similar. Mycolactone, as the more potent agent, may also lead to a faster loss of function within the ER.A large body of research supports the contention that the canonical ISR, by decreasing translation and activating cytoprotective processes such as autophagy, is initially protective. For instance, PERK activation can induce autophagy and several autophagy genes are downstream of ATF4[54]. Conversely, activation of the ISR has also been shown to promote cell death. The nature of the response obtained in practice is thought to be a function of both extent and duration of the stress. For cells exposed to environmental stress, ISR activation can be at first beneficial; however, in the latter stages of the response, ATF4 and CHOP restore protein synthesis by recruiting their downstream target GADD34 to de-phosphorylate eIF2α, leading to oxidative stress and cell death[40]. In addition, CHOP also promotes cell death by altering the expression of apoptosis regulators such as Bim, Bcl2, Bax and Bad[41].Two different genetic models with reduced ability to phosphorylate eIF2α die at an accelerated rate following mycolactone exposure, suggesting the mycolactone-induced ISR operates by a similar mechanism. Consistent with this, the activation of the cytoprotective autophagic response by mycolactone was also lost in PERK−/−GCN2−/− cells. With prolonged exposure to mycolactone, there was a shift towards a pro-apoptotic response, with increased expression of pro-apoptotic proteins. Conversely, cells unable to make ATF4 were more resistant to the toxic effects of mycolactone indicating that this is a key determinant of the fate of cells. However, although cell death was delayed, it was not completely prevented, suggesting additional triggers of apoptosis in cells exposed to mycolactone, or other pathways that manifest in the absence of ATF4.In this regard, there remain additional candidates identified in the translational profiling that require investigation; thus the full extent of mycolactone-responsive genes and pathways awaits discovery. Given the single 5 h time point used, this data set likely includes both primary targets (like ATF4) and secondary response genes. For instance, reduced polysomal association of several interferon response genes (IFIT1, IFIT3 and IGTP) could be explained by the profound inhibition of type I interferon production by these cells[4,47]. However, it is important to recognise that enhanced translation does not necessarily correlate with increased protein expression, should the translated transcripts be subject to translocation inhibition and thus premature degradation[4]. Nevertheless, it would be interesting to compare the transcriptional and translational effects of mycolactone in mutant lines lacking any or all of the eIF2α kinases, or the ATF4−/− cells, to further dissect the pathway.Mycolactone seems unique in its ability to induce stress in the cytosol despite an initial priming event at the ER membrane. The global effect of mycolactone is widely conserved between varied cell types derived from both humans and mice (for instance, refs.[4,9,35]). Our discovery has implications for treatment of M. ulcerans infection. BU lesions are characterised by widespread tissue damage and cell death, and wound healing even after antibiotic treatment is extremely slow and the presence of residual mycolactone could be a contributory factor. Prolonged exposure to stress leads to the activation of pathways that have been shown to drive M. ulcerans-infection-induced apoptosis[10]. Could this pathway therefore be targeted to treat BU? The answer is not straightforward, since reduced p-eIF2α enhanced rather than diminished susceptibility to mycolactone. In other diseases, such as dementia, reducing the ISR only appears to be protective at early stages of the disease[55,56]. Unravelling the mechanisms of mycolactone activity is valuable for understanding the pathogenesis of BU but additionally provides insights useful in the development of chemotherapeutic agents that modulate the ISR and ER stress response.
Material and methods
Reagents
We used synthetic mycolactone A/B (kind gift from Prof. Yoshito Kishi, Harvard University) throughout these investigations. Unless specified, all other reagents are from Sigma-Aldrich.
Cell culture and treatment
PERK−/−, GCN2−/−, PERK−/− GCN2−/− MEFs or their wild-type counterparts have been described previously[57,58], while all other cells were obtained from ATCC. To allow for stable overexpression of the KARA and GADD34 clones (see below), specific-geneticin-sensitive HeLa cells were used, referred to here as HeLa-gs. All cells were maintained in high-glucoseDMEM supplemented with 10% FBS at 37 °C and 5% CO2 and in the case of PERK−/−, GCN2−/−, PERK−/− GCN2−/− MEFs and ATF4−/− HeLa cells, 1 mM non-essential amino acids, 50 µM β-mercaptoethanol, 100 units/ml penicillin and 100 μg/ml streptomycin were also added. Unless otherwise noted, mycolactone was used at 31.3 ng/ml and the vehicle control was DMSO diluted to the same extent (0.025%). Initial experiments with RAW264.7 cells utilised mycolactone at 125 ng/ml as previously described[4]. Various inducers of the integrated stress response were utilised. Induction of ER stress routinely achieved by adding 5 µg/ml tunicamycin to the medium followed by incubation for up to 12 h. To activate GCN2, cells were grown in leucine-free DMEM/Nutrient Mixture F-12 Ham for up to 8 h while PKR activation was achieved by transfecting cells with 10 µg/ml Poly I:C for 4 h. Other inducers used were cycloheximide (10 µg/ml), chloroquine (50 µM), DL-Dithiothreitol (1 mM), staurosporin (Calbiochem, 1 µM), Cotransin-8 (CT8; 2 µM), Cotransin-9 (CT9; 2 µM)[45] and ISRIB (100 nM).
Polysome profiling, RNA isolation and analysis
Polysome profiling was carried out as previously described[4]. Briefly, cells were incubated with 10 μg/ml cycloheximide (CHX) for 10 min at 37 °C and 5% CO2 and harvested by scraping into PBS/CHX and spun at 450 × g for 5 min at 4 °C. The cell pellet was resuspended in 500 μl lysis buffer (15 mM TrisCl pH 7.5, 300 mM sodium chloride, 15 mM magnesium chloride, 10 mg/ml heparin, 100 μg/ml CHX and 1% (v/v) Triton-X-100). Lysates were clarified by centrifugation at 21,000 × g for 1 min at 4 °C and supernatants snap frozen in liquid nitrogen. To separate polysomes, samples were layered onto a 10–50% sucrose gradient in lysis buffer and centrifuged in a SW40Ti rotor (Beckmann Coulter) at 38,000 rpm for 2 h. Gradients were fractionated using a FoxyR1 collection system (Teledyne ISCO) and RNA was extracted from fractions as previously described[4,59]. For northern blotting, extracted RNA was separated on 1% agarose/formaldehyde gels and transferred onto Hybond N+ membranes. Blots were probed in Ultrahyb solution (GE Healthcare) with 32P-labelled cDNA probes washed and exposed to a phosphorimager screen (Bio-Rad). Full length coding-region cDNA probe for actin was already available[22]. MurineATF4 probe was prepared by amplification and cloning of full-length coding-region cDNAs from RAW264.7 cells exposed to mycolactone.
Microarray analysis
RAW297.4 cells (1–2×107) were incubated with or without 125 ng/ml mycolactone for 1 h, then stimulated with 100 ng/ml TLR-grade LPS (Enzo Life Sciences) for 4 h. Cells were treated with 10 µg/ml CHX before harvesting for polysome isolation. Polysomes were prepared and RNA purified as described in Hall et al.[4]. Subpolysomal (fractions 1–5) and polysomal fractions (fractions 6–10) were pooled and precipitated twice with lithium chloride, then purified through RNA Clean and Concentrate-5 columns (Zymo Research). RNA quality was confirmed by Bioanalyser (Bio-Rad). Cy5 and Cy3 labelled cRNA with Spike-in was prepared from pooled RNA (~150 ng each) using a Two Colour Low Input Quick Amp Labelling Kit (Agilent). Spike-in concentration was adjusted according to sample RNA concentration. Polysomal and sub-polysomal cRNAs (825 ng each) were pooled and used to probe Agilent Mouse Gene Expression v2 4 × 44 K slides according to the manufacturer’s instructions. Dye swaps were carried out to compensate for dye bias. Fluorescence intensity was measured with an Agilent Microarray Scanner. Data was analysed by the method described in ref.[23], with some variations. Briefly, background was corrected by the normexp method. Low intensity values (<2 SD above background) were filtered out. Normalisation was carried out within arrays by the Loess method and between arrays by the Scale method. After dye-swap correction, the fold change in polysomal association for individual transcripts due to mycolactone was calculated from the normalised data using the following formula:whereTranscripts showing a significant change in translational efficiency after exposure mycolactone were identified by Rank Product analysis of the entire data set of three biological repeats. This rank product analysis rules out changes in transcription that may occur and, while it yields a lower number of positive hits than other approaches, it leads to a higher validation rate for translationally regulated targets[23]. Gene transcripts that were enriched in the polysomal or sub-polysomal pools (reflecting enhanced and reduced translation, respectively) were subject to PANTHER Overrepresentation Test (release 20160715) to identify significantly overrepresented gene ontology (GO) groups (p < 0.05).
Preparation of protein lysates and immunoblot analyses
For western blots, cells were lysed either in RIPA buffer (Sigma) supplemented with protease inhibitors (Sigma) and phosphatase inhibitors (1 mM sodium pyrophosphate, 1 mM PMSF, 5 mM sodium fluoride and 1.75 mM β-glycerophosphate) or gel sample buffer followed by sonication for 30 s. Following RIPA lysis, lysates were clarified by centrifugation, and the protein content was determined using Pierce BCA protein assay kit (Thermo Fisher) according to the manufacturer’s recommendation. For immunoblots, equal amounts of each protein sample were separated in an SDS-polyacrylamide gel followed by conventional blotting and a broad range polypeptide marker (Thermo Fisher) was used to determine the molecular weight of proteins. The antibodies used in this study were as follows: anti-p-PERK, p-PKR and PKR (Santa Cruz Biotechnology); anti-p-eIF2α (Ser-51) and anti-GFP (Invitrogen); anti-Bcl-2, Bim and LC3B (ProSci); anti-p-GCN2 (Thr-899) (Abcam); and anti-GAPDH (Ambion). With the exception of the ATF6 antibody that has been described previously[17], all other antibodies were purchased from Cell Signaling Technology and the HRP-conjugated secondary antibodies were from Life Technologies. The size of each protein was determined by comparisons to molecular weight markers. CHOP (∼27 kDa), GAPDH (∼37 kDa), ATF4 (49 kDa), p-eIF2α/eIF2α (∼38 kDa), GFP GADD34/KARA (∼180 kDa), ATF6 (full-length ∼90 kDa, cleaved ∼50 kDa), IRE1 (∼130 kDa), p-GCN2/GCN2 (∼220 kDa), p-PERK/PERK (∼140 kDa), p-PKR/PKR (∼50 kDa), GAPDH (∼37 kDa), LC3B II (∼17 kDa), Bcl2 (∼28 kDa), Bim (∼23 kDa), p/AKT/AKT (∼60 kDa). All immunoblotting results are representative of at least three independent experiments. Where quantitation was performed, pixel density was assessed using ImageJ analysis of non-saturated images and data were normalised to an appropriate loading control (eIF2α or GAPDH).
PCR and qPCR
Total RNA was extracted using a Qiagen RNAeasy kit. Off-the-shelf gene expression assays used were: GAPDH, 4352934; ATF4, Mm_00515324_m1; CHOP, Mm_01135937_g1; SESN2, Hs_00189032_m1; CALR, Hs_00162346_m1 and SSR2, Hs_0023012_m1. Real-time one-step qRT-PCR was carried out with either One-Step RT-PCR Master Mix (Applied Biosystems) on Quantstudio 7 flex real-time PCR system (Applied Biosystems). Primers used for RT-PCR analysis of XBP1 mRNA splicing by IRE1 were 5′-AAACAGAGTAGCAGCTCAGACTGC-3′ and 5′-TCCTTCTGGGTAGACCTCTGGGAG-3′.
Puromycin labelling
Cells were incubated in complete medium containing 9 µM puromycin and 91 µM emetine at 37 °C for the last 5 min of a 12 h exposure before harvest. Cells were lysed with gel sample buffer pre-heated to 95 °C after which the lysate was boiled for a further 5 min and sonicated for 30 s. Immunoblotting was performed with anti-puromycin (Merck) and scanned images were quantified using ImageJ software.
Transfection
HeLa cells were either transiently or stably transfected using Lipofectamine LTX (Invitrogen). Reverse transfection of 5×104 cells was routinely carried out on a 24-well tissue culture plate using 300 ng plasmid DNA and 1 µl Lipofectamine LTX according to the manufacturer’s recommendation. EGFP-C1 GADD34 and EGFP-C1 KARA plasmids were kindly provided by Shirish Shenolikar (Duke University) while two plasmids each encoding a Cas9 nickase and an ATF4-specific guide RNA were obtained from Santa Cruz (sc-400155). Sixteen hours post-transfection, plasmid uptake was assessed by observing the cells under a fluorescent microscope for expression of GFP. For transient transfection with the ATF-4 double nickase plasmids, both mock and plasmid transfected cells were transferred into a 100 mm dish and selection was carried out with 200 ng/ml puromycin. Media was replaced every 2 days and 96 h post transfection, selection medium was replaced with DMEM supplemented with FBS, 1 mM non-essential amino acids and 50 µM β-mercaptoethanol (these growth conditions are specific to ATF4 knockout cells). For stable transfection with EGFP-C1 GADD34 and EGFP-C1 KARA plasmids, selection was initiated 48 h post transfection with DMEM containing 400 µg/ml G418. In both cases, when distinct colonies were observed, they were picked and moved to a 24-well plate followed by expansion and gene expression or deletion was confirmed by western blot analysis of cell lysates.
Viability assays
Cells in a 96-well plate were treated as required and stained with 0.3 µg/ml of PI (BD Biosciences), 2% (v/v) CellEvent (Invitrogen) and 3 µM DRAQ5 (Biostatus) to label nuclei followed by incubation in the dark for 30 min. Stained cells were observed using a Nikon A1 confocal microscope. Active caspase-3/7, nuclear and PI staining of the same field were observed in three different fields representing the top, bottom and middle part of the plate. The number of active caspase 3/7 (green channel) and PI (red channel)-positive cells was counted for each field and expressed as a percentage of the total number of cells (based on DRAQ5 staining, blue channel) in the field.
Unbiased screen for mycolactone-resistant clones using ENS mutagenesis
DNA damage repair-resistant Hct-116 cells were randomly mutagenised according to the method of Junne et al.[44]. Briefly, cells were treated with ethyl methane sulphonate at the IC20 for 1 h, reseeded at 15,000 cells/cm2 and allowed to recover overnight. Cells were then treated with 10 ng/ml mycolactone (the minimal inhibitory concentration for this cell line) every 5 days for 3 weeks after which colonies of mycolactone-resistant cells began to emerge. Colonies were picked and expanded in a 24-well plate that also contained 10 ng/ml mycolactone. No mycolactone-resistant clones were obtained from control cells that had not been mutagenised. To test each resistant clone, cells were further expanded before RNA extraction and parallel testing for mycolactone-sensitivity by IC50 at 5 days using an MTT assay[25]. In order to determine if mutations were present in SEC61A1, mRNA was reverse transcribed and the coding region amplified by PCR in four overlapping fragments (Sec61A1_frag1F; TAGCACTGACGTGTCTCTCG, Sec61A1_frag1R; TCCCCATACATCCCGGTCAT, Sec61A1_frag2F; CTTCAACGGAGCCCAAAAGT, Sec61A1_frag2R; GTGTTGTACTGGCCACGGTAG, Sec61A1_frag3F; TCATCGCCACCATCTTTGTCTT, Sec61A1_frag3R; GGACCATGGAGGTCTCTCGG, Sec61A1_frag4F; TATACATAGTGTTCATGCTGGGCT, Sec61A1_frag4R; ACACAGTGGAATGAAAGAATACGA) then subject to Sanger sequencing.
Statistical analysis
Data were analysed using Graphpad Prism v.6 software. For semi-quantification of immunoblots normalised to control levels, a one sample ttest was employed. For qRT-PCR, two-way ANOVA with Holm−Sidak test for multiple comparisons was performed on log2 transformed data. All other comparisons utilised either a one- or two-way ANOVA with Dunnet’s or Holm−Sidak test for multiple comparisons as appropriate. n.s., not significant, *p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001, ****p ≤ 0.0001.Supplemental figure legends(PDF 183 kb)Table S1(PDF 360 kb)Table S2(PDF 401 kb)Figure S1(PDF 220 kb)Figure S2(PDF 714 kb)Figure S3(PDF 179 kb)Figure S4(PDF 45 kb)Figure S5(PDF 15 kb)
Authors: Yusuke Sekine; Alisa Zyryanova; Ana Crespillo-Casado; Peter M Fischer; Heather P Harding; David Ron Journal: Science Date: 2015-04-09 Impact factor: 47.728
Authors: Tina Junne; Joanne Wong; Christian Studer; Thomas Aust; Benedikt W Bauer; Martin Beibel; Bhupinder Bhullar; Robert Bruccoleri; Jürg Eichenberger; David Estoppey; Nicole Hartmann; Britta Knapp; Philipp Krastel; Nicolas Melin; Edward J Oakeley; Lukas Oberer; Ralph Riedl; Guglielmo Roma; Sven Schuierer; Frank Petersen; John A Tallarico; Tom A Rapoport; Martin Spiess; Dominic Hoepfner Journal: J Cell Sci Date: 2015-01-22 Impact factor: 5.285
Authors: Alvar Grönberg; Louise Zettergren; Kerstin Bergh; Mona Ståhle; Johan Heilborn; Kristian Angeby; Pamela L Small; Hannah Akuffo; Sven Britton Journal: PLoS One Date: 2010-11-04 Impact factor: 3.240
Authors: Britt Adamson; Thomas M Norman; Marco Jost; Min Y Cho; James K Nuñez; Yuwen Chen; Jacqueline E Villalta; Luke A Gilbert; Max A Horlbeck; Marco Y Hein; Ryan A Pak; Andrew N Gray; Carol A Gross; Atray Dixit; Oren Parnas; Aviv Regev; Jonathan S Weissman Journal: Cell Date: 2016-12-15 Impact factor: 41.582
Authors: Michelle H Larsen; Karen Lacourciere; Tina M Parker; Alison Kraigsley; Jacqueline M Achkar; Linda B Adams; Kathryn M Dupnik; Luanne Hall-Stoodley; Travis Hartman; Carly Kanipe; Sherry L Kurtz; Michele A Miller; Liliana C M Salvador; John S Spencer; Richard T Robinson Journal: Tuberculosis (Edinb) Date: 2020-02-11 Impact factor: 3.131
Authors: Brendon Y Chua; Timothy P Stinear; Kirstie M Mangas; Andrew H Buultjens; Jessica L Porter; Sarah L Baines; Estelle Marion; Laurent Marsollier; Nicholas J Tobias; Sacha J Pidot; Kylie M Quinn; David J Price; Katherine Kedzierska; Weiguang Zeng; David C Jackson Journal: Infect Immun Date: 2020-02-20 Impact factor: 3.441
Authors: Kirstie M Mangas; Nicholas J Tobias; Estelle Marion; Jérémie Babonneau; Laurent Marsollier; Jessica L Porter; Sacha J Pidot; Chinn Yi Wong; David C Jackson; Brendon Y Chua; Timothy P Stinear Journal: PeerJ Date: 2020-08-07 Impact factor: 2.984
Authors: Jean-David Morel; Anja O Paatero; Jiajie Wei; Jonathan W Yewdell; Laure Guenin-Macé; Delphi Van Haver; Francis Impens; Natalia Pietrosemoli; Ville O Paavilainen; Caroline Demangel Journal: Mol Cell Proteomics Date: 2018-06-18 Impact factor: 5.911
Authors: Daniel J Klionsky; Amal Kamal Abdel-Aziz; Sara Abdelfatah; Mahmoud Abdellatif; Asghar Abdoli; Steffen Abel; Hagai Abeliovich; Marie H Abildgaard; Yakubu Princely Abudu; Abraham Acevedo-Arozena; Iannis E Adamopoulos; Khosrow Adeli; Timon E Adolph; Annagrazia Adornetto; Elma Aflaki; Galila Agam; Anupam Agarwal; Bharat B Aggarwal; Maria Agnello; Patrizia Agostinis; Javed N Agrewala; Alexander Agrotis; Patricia V Aguilar; S Tariq Ahmad; Zubair M Ahmed; Ulises Ahumada-Castro; Sonja Aits; Shu Aizawa; Yunus Akkoc; Tonia Akoumianaki; Hafize Aysin Akpinar; Ahmed M Al-Abd; Lina Al-Akra; Abeer Al-Gharaibeh; Moulay A Alaoui-Jamali; Simon Alberti; Elísabet Alcocer-Gómez; Cristiano Alessandri; Muhammad Ali; M Abdul Alim Al-Bari; Saeb Aliwaini; Javad Alizadeh; Eugènia Almacellas; Alexandru Almasan; Alicia Alonso; Guillermo D Alonso; Nihal Altan-Bonnet; Dario C Altieri; Élida M C Álvarez; Sara Alves; Cristine Alves da Costa; Mazen M Alzaharna; Marialaura Amadio; Consuelo Amantini; Cristina Amaral; Susanna Ambrosio; Amal O Amer; Veena Ammanathan; Zhenyi An; Stig U Andersen; Shaida A Andrabi; Magaiver Andrade-Silva; Allen M Andres; Sabrina Angelini; David Ann; Uche C Anozie; Mohammad Y Ansari; Pedro Antas; Adam Antebi; Zuriñe Antón; Tahira Anwar; Lionel Apetoh; Nadezda Apostolova; Toshiyuki Araki; Yasuhiro Araki; Kohei Arasaki; Wagner L Araújo; Jun Araya; Catherine Arden; Maria-Angeles Arévalo; Sandro Arguelles; Esperanza Arias; Jyothi Arikkath; Hirokazu Arimoto; Aileen R Ariosa; Darius Armstrong-James; Laetitia Arnauné-Pelloquin; Angeles Aroca; Daniela S Arroyo; Ivica Arsov; Rubén Artero; Dalia Maria Lucia Asaro; Michael Aschner; Milad Ashrafizadeh; Osnat Ashur-Fabian; Atanas G Atanasov; Alicia K Au; Patrick Auberger; Holger W Auner; Laure Aurelian; Riccardo Autelli; Laura Avagliano; Yenniffer Ávalos; Sanja Aveic; Célia Alexandra Aveleira; Tamar Avin-Wittenberg; Yucel Aydin; Scott Ayton; Srinivas Ayyadevara; Maria Azzopardi; Misuzu Baba; Jonathan M Backer; Steven K Backues; Dong-Hun Bae; Ok-Nam Bae; Soo Han Bae; Eric H Baehrecke; Ahruem Baek; Seung-Hoon Baek; Sung Hee Baek; Giacinto Bagetta; Agnieszka Bagniewska-Zadworna; Hua Bai; Jie Bai; Xiyuan Bai; Yidong Bai; Nandadulal Bairagi; Shounak Baksi; Teresa Balbi; Cosima T Baldari; Walter Balduini; Andrea Ballabio; Maria Ballester; Salma Balazadeh; Rena Balzan; Rina Bandopadhyay; Sreeparna Banerjee; Sulagna Banerjee; Ágnes Bánréti; Yan Bao; Mauricio S Baptista; Alessandra Baracca; Cristiana Barbati; Ariadna Bargiela; Daniela Barilà; Peter G Barlow; Sami J Barmada; Esther Barreiro; George E Barreto; Jiri Bartek; Bonnie Bartel; Alberto Bartolome; Gaurav R Barve; Suresh H Basagoudanavar; Diane C Bassham; Robert C Bast; Alakananda Basu; Henri Batoko; Isabella Batten; Etienne E Baulieu; Bradley L Baumgarner; Jagadeesh Bayry; Rupert Beale; Isabelle Beau; Florian Beaumatin; Luiz R G Bechara; George R Beck; Michael F Beers; Jakob Begun; Christian Behrends; Georg M N Behrens; Roberto Bei; Eloy Bejarano; Shai Bel; Christian Behl; Amine Belaid; Naïma Belgareh-Touzé; Cristina Bellarosa; Francesca Belleudi; Melissa Belló Pérez; Raquel Bello-Morales; Jackeline Soares de Oliveira Beltran; Sebastián Beltran; Doris Mangiaracina Benbrook; Mykolas Bendorius; Bruno A Benitez; Irene Benito-Cuesta; Julien Bensalem; Martin W Berchtold; Sabina Berezowska; Daniele Bergamaschi; Matteo Bergami; Andreas Bergmann; Laura Berliocchi; Clarisse Berlioz-Torrent; Amélie Bernard; Lionel Berthoux; Cagri G Besirli; Sebastien Besteiro; Virginie M Betin; Rudi Beyaert; Jelena S Bezbradica; Kiran Bhaskar; Ingrid Bhatia-Kissova; Resham Bhattacharya; Sujoy Bhattacharya; Shalmoli Bhattacharyya; Md Shenuarin Bhuiyan; Sujit Kumar Bhutia; Lanrong Bi; Xiaolin Bi; Trevor J Biden; Krikor Bijian; Viktor A Billes; Nadine Binart; Claudia Bincoletto; Asa B Birgisdottir; Geir Bjorkoy; Gonzalo Blanco; Ana Blas-Garcia; Janusz Blasiak; Robert Blomgran; Klas Blomgren; Janice S Blum; Emilio Boada-Romero; Mirta Boban; Kathleen Boesze-Battaglia; Philippe Boeuf; Barry Boland; Pascale Bomont; Paolo Bonaldo; Srinivasa Reddy Bonam; Laura Bonfili; Juan S Bonifacino; Brian A Boone; Martin D Bootman; Matteo Bordi; Christoph Borner; Beat C Bornhauser; Gautam Borthakur; Jürgen Bosch; Santanu Bose; Luis M Botana; Juan Botas; Chantal M Boulanger; Michael E Boulton; Mathieu Bourdenx; Benjamin Bourgeois; Nollaig M Bourke; Guilhem Bousquet; Patricia Boya; Peter V Bozhkov; Luiz H M Bozi; Tolga O Bozkurt; Doug E Brackney; Christian H Brandts; Ralf J Braun; Gerhard H Braus; Roberto Bravo-Sagua; José M Bravo-San Pedro; Patrick Brest; Marie-Agnès Bringer; Alfredo Briones-Herrera; V Courtney Broaddus; Peter Brodersen; Jeffrey L Brodsky; Steven L Brody; Paola G Bronson; Jeff M Bronstein; Carolyn N Brown; Rhoderick E Brown; Patricia C Brum; John H Brumell; Nicola Brunetti-Pierri; Daniele Bruno; Robert J Bryson-Richardson; Cecilia Bucci; Carmen Buchrieser; Marta Bueno; Laura Elisa Buitrago-Molina; Simone Buraschi; Shilpa Buch; J Ross Buchan; Erin M Buckingham; Hikmet Budak; Mauricio Budini; Geert Bultynck; Florin Burada; Joseph R Burgoyne; M Isabel Burón; Victor Bustos; Sabrina Büttner; Elena Butturini; Aaron Byrd; Isabel Cabas; Sandra Cabrera-Benitez; Ken Cadwell; Jingjing Cai; Lu Cai; Qian Cai; Montserrat Cairó; Jose A Calbet; Guy A Caldwell; Kim A Caldwell; Jarrod A Call; Riccardo Calvani; Ana C Calvo; Miguel Calvo-Rubio Barrera; Niels Os Camara; Jacques H Camonis; Nadine Camougrand; Michelangelo Campanella; Edward M Campbell; François-Xavier Campbell-Valois; Silvia Campello; Ilaria Campesi; Juliane C Campos; Olivier Camuzard; Jorge Cancino; Danilo Candido de Almeida; Laura Canesi; Isabella Caniggia; Barbara Canonico; Carles Cantí; Bin Cao; Michele Caraglia; Beatriz Caramés; Evie H Carchman; Elena Cardenal-Muñoz; Cesar Cardenas; Luis Cardenas; Sandra M Cardoso; Jennifer S Carew; Georges F Carle; Gillian Carleton; Silvia Carloni; Didac Carmona-Gutierrez; Leticia A Carneiro; Oliana Carnevali; Julian M Carosi; Serena Carra; Alice Carrier; Lucie Carrier; Bernadette Carroll; A Brent Carter; Andreia Neves Carvalho; Magali Casanova; Caty Casas; Josefina Casas; Chiara Cassioli; Eliseo F Castillo; Karen Castillo; Sonia Castillo-Lluva; Francesca Castoldi; Marco Castori; Ariel F Castro; Margarida Castro-Caldas; Javier Castro-Hernandez; Susana Castro-Obregon; Sergio D Catz; Claudia Cavadas; Federica Cavaliere; Gabriella Cavallini; Maria Cavinato; Maria L Cayuela; Paula Cebollada Rica; Valentina Cecarini; Francesco Cecconi; Marzanna Cechowska-Pasko; Simone Cenci; Victòria Ceperuelo-Mallafré; João J Cerqueira; Janete M Cerutti; Davide Cervia; Vildan Bozok Cetintas; Silvia Cetrullo; Han-Jung Chae; Andrei S Chagin; Chee-Yin Chai; Gopal Chakrabarti; Oishee Chakrabarti; Tapas Chakraborty; Trinad Chakraborty; Mounia Chami; Georgios Chamilos; David W Chan; Edmond Y W Chan; Edward D Chan; H Y Edwin Chan; Helen H Chan; Hung Chan; Matthew T V Chan; Yau Sang Chan; Partha K Chandra; Chih-Peng Chang; Chunmei Chang; Hao-Chun Chang; Kai Chang; Jie Chao; Tracey Chapman; Nicolas Charlet-Berguerand; Samrat Chatterjee; Shail K Chaube; Anu Chaudhary; Santosh Chauhan; Edward Chaum; Frédéric Checler; Michael E Cheetham; Chang-Shi Chen; Guang-Chao Chen; Jian-Fu Chen; Liam L Chen; Leilei Chen; Lin Chen; Mingliang Chen; Mu-Kuan Chen; Ning Chen; Quan Chen; Ruey-Hwa Chen; Shi Chen; Wei Chen; Weiqiang Chen; Xin-Ming Chen; Xiong-Wen Chen; Xu Chen; Yan Chen; Ye-Guang Chen; Yingyu Chen; Yongqiang Chen; Yu-Jen Chen; Yue-Qin Chen; Zhefan Stephen Chen; Zhi Chen; Zhi-Hua Chen; Zhijian J Chen; Zhixiang Chen; Hanhua Cheng; Jun Cheng; Shi-Yuan Cheng; Wei Cheng; Xiaodong Cheng; Xiu-Tang Cheng; Yiyun Cheng; Zhiyong Cheng; Zhong Chen; Heesun Cheong; Jit Kong Cheong; Boris V Chernyak; Sara Cherry; Chi Fai Randy Cheung; Chun Hei Antonio Cheung; King-Ho Cheung; Eric Chevet; Richard J Chi; Alan Kwok Shing Chiang; Ferdinando Chiaradonna; Roberto Chiarelli; Mario Chiariello; Nathalia Chica; Susanna Chiocca; Mario Chiong; Shih-Hwa Chiou; Abhilash I Chiramel; Valerio Chiurchiù; Dong-Hyung Cho; Seong-Kyu Choe; Augustine M K Choi; Mary E Choi; Kamalika Roy Choudhury; Norman S Chow; Charleen T Chu; Jason P Chua; John Jia En Chua; Hyewon Chung; Kin Pan Chung; Seockhoon Chung; So-Hyang Chung; Yuen-Li Chung; Valentina Cianfanelli; Iwona A Ciechomska; Mariana Cifuentes; Laura Cinque; Sebahattin Cirak; Mara Cirone; Michael J Clague; Robert Clarke; Emilio Clementi; Eliana M Coccia; Patrice Codogno; Ehud Cohen; Mickael M Cohen; Tania Colasanti; Fiorella Colasuonno; Robert A Colbert; Anna Colell; Miodrag Čolić; Nuria S Coll; Mark O Collins; María I Colombo; Daniel A Colón-Ramos; Lydie Combaret; Sergio Comincini; Márcia R Cominetti; Antonella Consiglio; Andrea Conte; Fabrizio Conti; Viorica Raluca Contu; Mark R Cookson; Kevin M Coombs; Isabelle Coppens; Maria Tiziana Corasaniti; Dale P Corkery; Nils Cordes; Katia Cortese; Maria do Carmo Costa; Sarah Costantino; Paola Costelli; Ana Coto-Montes; Peter J Crack; Jose L Crespo; Alfredo Criollo; Valeria Crippa; Riccardo Cristofani; Tamas Csizmadia; Antonio Cuadrado; Bing Cui; Jun Cui; Yixian Cui; Yong Cui; Emmanuel Culetto; Andrea C Cumino; Andrey V Cybulsky; Mark J Czaja; Stanislaw J Czuczwar; Stefania D'Adamo; Marcello D'Amelio; Daniela D'Arcangelo; Andrew C D'Lugos; Gabriella D'Orazi; James A da Silva; Hormos Salimi Dafsari; Ruben K Dagda; Yasin Dagdas; Maria Daglia; Xiaoxia Dai; Yun Dai; Yuyuan Dai; Jessica Dal Col; Paul Dalhaimer; Luisa Dalla Valle; Tobias Dallenga; Guillaume Dalmasso; Markus Damme; Ilaria Dando; Nico P Dantuma; April L Darling; Hiranmoy Das; Srinivasan Dasarathy; Santosh K Dasari; Srikanta Dash; Oliver Daumke; Adrian N Dauphinee; Jeffrey S Davies; Valeria A Dávila; Roger J Davis; Tanja Davis; Sharadha Dayalan Naidu; Francesca De Amicis; Karolien De Bosscher; Francesca De Felice; Lucia De Franceschi; Chiara De Leonibus; Mayara G de Mattos Barbosa; Guido R Y De Meyer; Angelo De Milito; Cosimo De Nunzio; Clara De Palma; Mauro De Santi; Claudio De Virgilio; Daniela De Zio; Jayanta Debnath; Brian J DeBosch; Jean-Paul Decuypere; Mark A Deehan; Gianluca Deflorian; James DeGregori; Benjamin Dehay; Gabriel Del Rio; Joe R Delaney; Lea M D Delbridge; Elizabeth Delorme-Axford; M Victoria Delpino; Francesca Demarchi; Vilma Dembitz; Nicholas D Demers; Hongbin Deng; Zhiqiang Deng; Joern Dengjel; Paul Dent; Donna Denton; Melvin L DePamphilis; Channing J Der; Vojo Deretic; Albert Descoteaux; Laura Devis; Sushil Devkota; Olivier Devuyst; Grant Dewson; Mahendiran Dharmasivam; Rohan Dhiman; Diego di Bernardo; Manlio Di Cristina; Fabio Di Domenico; Pietro Di Fazio; Alessio Di Fonzo; Giovanni Di Guardo; Gianni M Di Guglielmo; Luca Di Leo; Chiara Di Malta; Alessia Di Nardo; Martina Di Rienzo; Federica Di Sano; George Diallinas; Jiajie Diao; Guillermo Diaz-Araya; Inés Díaz-Laviada; Jared M Dickinson; Marc Diederich; Mélanie Dieudé; Ivan Dikic; Shiping Ding; Wen-Xing Ding; Luciana Dini; Jelena Dinić; Miroslav Dinic; Albena T Dinkova-Kostova; Marc S Dionne; Jörg H W Distler; Abhinav Diwan; Ian M C Dixon; Mojgan Djavaheri-Mergny; Ina Dobrinski; Oxana Dobrovinskaya; Radek Dobrowolski; Renwick C J Dobson; Jelena Đokić; Serap Dokmeci Emre; Massimo Donadelli; Bo Dong; Xiaonan Dong; Zhiwu Dong; Gerald W Dorn Ii; Volker Dotsch; Huan Dou; Juan Dou; Moataz Dowaidar; Sami Dridi; Liat Drucker; Ailian Du; Caigan Du; Guangwei Du; Hai-Ning Du; Li-Lin Du; André du Toit; Shao-Bin Duan; Xiaoqiong Duan; Sónia P Duarte; Anna Dubrovska; Elaine A Dunlop; Nicolas Dupont; Raúl V Durán; Bilikere S Dwarakanath; Sergey A Dyshlovoy; Darius Ebrahimi-Fakhari; Leopold Eckhart; Charles L Edelstein; Thomas Efferth; Eftekhar Eftekharpour; Ludwig Eichinger; Nabil Eid; Tobias Eisenberg; N Tony Eissa; Sanaa Eissa; Miriam Ejarque; Abdeljabar El Andaloussi; Nazira El-Hage; Shahenda El-Naggar; Anna Maria Eleuteri; Eman S El-Shafey; Mohamed Elgendy; Aristides G Eliopoulos; María M Elizalde; Philip M Elks; Hans-Peter Elsasser; Eslam S Elsherbiny; Brooke M Emerling; N C Tolga Emre; Christina H Eng; Nikolai Engedal; Anna-Mart Engelbrecht; Agnete S T Engelsen; Jorrit M Enserink; Ricardo Escalante; Audrey Esclatine; Mafalda Escobar-Henriques; Eeva-Liisa Eskelinen; Lucile Espert; Makandjou-Ola Eusebio; Gemma Fabrias; Cinzia Fabrizi; Antonio Facchiano; Francesco Facchiano; Bengt Fadeel; Claudio Fader; Alex C Faesen; W Douglas Fairlie; Alberto Falcó; Bjorn H Falkenburger; Daping Fan; Jie Fan; Yanbo Fan; Evandro F Fang; Yanshan Fang; Yognqi Fang; Manolis Fanto; Tamar Farfel-Becker; Mathias Faure; Gholamreza Fazeli; Anthony O Fedele; Arthur M Feldman; Du Feng; Jiachun Feng; Lifeng Feng; Yibin Feng; Yuchen Feng; Wei Feng; Thais Fenz Araujo; Thomas A Ferguson; Álvaro F Fernández; Jose C Fernandez-Checa; Sonia Fernández-Veledo; Alisdair R Fernie; Anthony W Ferrante; Alessandra Ferraresi; Merari F Ferrari; Julio C B Ferreira; Susan Ferro-Novick; Antonio Figueras; Riccardo Filadi; Nicoletta Filigheddu; Eduardo Filippi-Chiela; Giuseppe Filomeni; Gian Maria Fimia; Vittorio Fineschi; Francesca Finetti; Steven Finkbeiner; Edward A Fisher; Paul B Fisher; Flavio Flamigni; Steven J Fliesler; Trude H Flo; Ida Florance; Oliver Florey; Tullio Florio; Erika Fodor; Carlo Follo; Edward A Fon; Antonella Forlino; Francesco Fornai; Paola Fortini; Anna Fracassi; Alessandro Fraldi; Brunella Franco; Rodrigo Franco; Flavia Franconi; Lisa B Frankel; Scott L Friedman; Leopold F Fröhlich; Gema Frühbeck; Jose M Fuentes; Yukio Fujiki; Naonobu Fujita; Yuuki Fujiwara; Mitsunori Fukuda; Simone Fulda; Luc Furic; Norihiko Furuya; Carmela Fusco; Michaela U Gack; Lidia Gaffke; Sehamuddin Galadari; Alessia Galasso; Maria F Galindo; Sachith Gallolu Kankanamalage; Lorenzo Galluzzi; Vincent Galy; Noor Gammoh; Boyi Gan; Ian G Ganley; Feng Gao; Hui Gao; Minghui Gao; Ping Gao; Shou-Jiang Gao; Wentao Gao; Xiaobo Gao; Ana Garcera; Maria Noé Garcia; Verónica E Garcia; Francisco García-Del Portillo; Vega Garcia-Escudero; Aracely Garcia-Garcia; Marina Garcia-Macia; Diana García-Moreno; Carmen Garcia-Ruiz; Patricia García-Sanz; Abhishek D Garg; Ricardo Gargini; Tina Garofalo; Robert F Garry; Nils C Gassen; Damian Gatica; Liang Ge; Wanzhong Ge; Ruth Geiss-Friedlander; Cecilia Gelfi; Pascal Genschik; Ian E Gentle; Valeria Gerbino; Christoph Gerhardt; Kyla Germain; Marc Germain; David A Gewirtz; Elham Ghasemipour Afshar; Saeid Ghavami; Alessandra Ghigo; Manosij Ghosh; Georgios Giamas; Claudia Giampietri; Alexandra Giatromanolaki; Gary E Gibson; Spencer B Gibson; Vanessa Ginet; Edward Giniger; Carlotta Giorgi; Henrique Girao; Stephen E Girardin; Mridhula Giridharan; Sandy Giuliano; Cecilia Giulivi; Sylvie Giuriato; Julien Giustiniani; Alexander Gluschko; Veit Goder; Alexander Goginashvili; Jakub Golab; David C Goldstone; Anna Golebiewska; Luciana R Gomes; Rodrigo Gomez; Rubén Gómez-Sánchez; Maria Catalina Gomez-Puerto; Raquel Gomez-Sintes; Qingqiu Gong; Felix M Goni; Javier González-Gallego; Tomas Gonzalez-Hernandez; Rosa A Gonzalez-Polo; Jose A Gonzalez-Reyes; Patricia González-Rodríguez; Ing Swie Goping; Marina S Gorbatyuk; Nikolai V Gorbunov; Kıvanç Görgülü; Roxana M Gorojod; Sharon M Gorski; Sandro Goruppi; Cecilia Gotor; Roberta A Gottlieb; Illana Gozes; Devrim Gozuacik; Martin Graef; Markus H Gräler; Veronica Granatiero; Daniel Grasso; Joshua P Gray; Douglas R Green; Alexander Greenhough; Stephen L Gregory; Edward F Griffin; Mark W Grinstaff; Frederic Gros; Charles Grose; Angelina S Gross; Florian Gruber; Paolo Grumati; Tilman Grune; Xueyan Gu; Jun-Lin Guan; Carlos M Guardia; Kishore Guda; Flora Guerra; Consuelo Guerri; Prasun Guha; Carlos Guillén; Shashi Gujar; Anna Gukovskaya; Ilya Gukovsky; Jan Gunst; Andreas Günther; Anyonya R Guntur; Chuanyong Guo; Chun Guo; Hongqing Guo; Lian-Wang Guo; Ming Guo; Pawan Gupta; Shashi Kumar Gupta; Swapnil Gupta; Veer Bala Gupta; Vivek Gupta; Asa B Gustafsson; David D Gutterman; Ranjitha H B; Annakaisa Haapasalo; James E Haber; Aleksandra Hać; Shinji Hadano; Anders J Hafrén; Mansour Haidar; Belinda S Hall; Gunnel Halldén; Anne Hamacher-Brady; Andrea Hamann; Maho Hamasaki; Weidong Han; Malene Hansen; Phyllis I Hanson; Zijian Hao; Masaru Harada; Ljubica Harhaji-Trajkovic; Nirmala Hariharan; Nigil Haroon; James Harris; Takafumi Hasegawa; Noor Hasima Nagoor; Jeffrey A Haspel; Volker Haucke; Wayne D Hawkins; Bruce A Hay; Cole M Haynes; Soren B Hayrabedyan; Thomas S Hays; Congcong He; Qin He; Rong-Rong He; You-Wen He; Yu-Ying He; Yasser Heakal; Alexander M Heberle; J Fielding Hejtmancik; Gudmundur Vignir Helgason; Vanessa Henkel; Marc Herb; Alexander Hergovich; Anna Herman-Antosiewicz; Agustín Hernández; Carlos Hernandez; Sergio Hernandez-Diaz; Virginia Hernandez-Gea; Amaury Herpin; Judit Herreros; Javier H Hervás; Daniel Hesselson; Claudio Hetz; Volker T Heussler; Yujiro Higuchi; Sabine Hilfiker; Joseph A Hill; William S Hlavacek; Emmanuel A Ho; Idy H T Ho; Philip Wing-Lok Ho; Shu-Leong Ho; Wan Yun Ho; G Aaron Hobbs; Mark Hochstrasser; Peter H M Hoet; Daniel Hofius; Paul Hofman; Annika Höhn; Carina I Holmberg; Jose R Hombrebueno; Chang-Won Hong Yi-Ren Hong; Lora V Hooper; Thorsten Hoppe; Rastislav Horos; Yujin Hoshida; I-Lun Hsin; Hsin-Yun Hsu; Bing Hu; Dong Hu; Li-Fang Hu; Ming Chang Hu; Ronggui Hu; Wei Hu; Yu-Chen Hu; Zhuo-Wei Hu; Fang Hua; Jinlian Hua; Yingqi Hua; Chongmin Huan; Canhua Huang; Chuanshu Huang; Chuanxin Huang; Chunling Huang; Haishan Huang; Kun Huang; Michael L H Huang; Rui Huang; Shan Huang; Tianzhi Huang; Xing Huang; Yuxiang Jack Huang; Tobias B Huber; Virginie Hubert; Christian A Hubner; Stephanie M Hughes; William E Hughes; Magali Humbert; Gerhard Hummer; James H Hurley; Sabah Hussain; Salik Hussain; Patrick J Hussey; Martina Hutabarat; Hui-Yun Hwang; Seungmin Hwang; Antonio Ieni; Fumiyo Ikeda; Yusuke Imagawa; Yuzuru Imai; Carol Imbriano; Masaya Imoto; Denise M Inman; Ken Inoki; Juan Iovanna; Renato V Iozzo; Giuseppe Ippolito; Javier E Irazoqui; Pablo Iribarren; Mohd Ishaq; Makoto Ishikawa; Nestor Ishimwe; Ciro Isidoro; Nahed Ismail; Shohreh Issazadeh-Navikas; Eisuke Itakura; Daisuke Ito; Davor Ivankovic; Saška Ivanova; Anand Krishnan V Iyer; José M Izquierdo; Masanori Izumi; Marja Jäättelä; Majid Sakhi Jabir; William T Jackson; Nadia Jacobo-Herrera; Anne-Claire Jacomin; Elise Jacquin; Pooja Jadiya; Hartmut Jaeschke; Chinnaswamy Jagannath; Arjen J Jakobi; Johan Jakobsson; Bassam Janji; Pidder Jansen-Dürr; Patric J Jansson; Jonathan Jantsch; Sławomir Januszewski; Alagie Jassey; Steve Jean; Hélène Jeltsch-David; Pavla Jendelova; Andreas Jenny; Thomas E Jensen; Niels Jessen; Jenna L Jewell; Jing Ji; Lijun Jia; Rui Jia; Liwen Jiang; Qing Jiang; Richeng Jiang; Teng Jiang; Xuejun Jiang; Yu Jiang; Maria Jimenez-Sanchez; Eun-Jung Jin; Fengyan Jin; Hongchuan Jin; Li Jin; Luqi Jin; Meiyan Jin; Si Jin; Eun-Kyeong Jo; Carine Joffre; Terje Johansen; Gail V W Johnson; Simon A Johnston; Eija Jokitalo; Mohit Kumar Jolly; Leo A B Joosten; Joaquin Jordan; Bertrand Joseph; Dianwen Ju; Jeong-Sun Ju; Jingfang Ju; Esmeralda Juárez; Delphine Judith; Gábor Juhász; Youngsoo Jun; Chang Hwa Jung; Sung-Chul Jung; Yong Keun Jung; Heinz Jungbluth; Johannes Jungverdorben; Steffen Just; Kai Kaarniranta; Allen Kaasik; Tomohiro Kabuta; Daniel Kaganovich; Alon Kahana; Renate Kain; Shinjo Kajimura; Maria Kalamvoki; Manjula Kalia; Danuta S Kalinowski; Nina Kaludercic; Ioanna Kalvari; Joanna Kaminska; Vitaliy O Kaminskyy; Hiromitsu Kanamori; Keizo Kanasaki; Chanhee Kang; Rui Kang; Sang Sun Kang; Senthilvelrajan Kaniyappan; Tomotake Kanki; Thirumala-Devi Kanneganti; Anumantha G Kanthasamy; Arthi Kanthasamy; Marc Kantorow; Orsolya Kapuy; Michalis V Karamouzis; Md Razaul Karim; Parimal Karmakar; Rajesh G Katare; Masaru Kato; Stefan H E Kaufmann; Anu Kauppinen; Gur P Kaushal; Susmita Kaushik; Kiyoshi Kawasaki; Kemal Kazan; Po-Yuan Ke; Damien J Keating; Ursula Keber; John H Kehrl; Kate E Keller; Christian W Keller; Jongsook Kim Kemper; Candia M Kenific; Oliver Kepp; Stephanie Kermorgant; Andreas Kern; Robin Ketteler; Tom G Keulers; Boris Khalfin; Hany Khalil; Bilon Khambu; Shahid Y Khan; Vinoth Kumar Megraj Khandelwal; Rekha Khandia; Widuri Kho; Noopur V Khobrekar; Sataree Khuansuwan; Mukhran Khundadze; Samuel A Killackey; Dasol Kim; Deok Ryong Kim; Do-Hyung Kim; Dong-Eun Kim; Eun Young Kim; Eun-Kyoung Kim; Hak-Rim Kim; Hee-Sik Kim; Jeong Hun Kim; Jin Kyung Kim; Jin-Hoi Kim; Joungmok Kim; Ju Hwan Kim; Keun Il Kim; Peter K Kim; Seong-Jun Kim; Scot R Kimball; Adi Kimchi; Alec C Kimmelman; Tomonori Kimura; Matthew A King; Kerri J Kinghorn; Conan G Kinsey; Vladimir Kirkin; Lorrie A Kirshenbaum; Sergey L Kiselev; Shuji Kishi; Katsuhiko Kitamoto; Yasushi Kitaoka; Kaio Kitazato; Richard N Kitsis; Josef T Kittler; Ole Kjaerulff; Peter S Klein; Thomas Klopstock; Jochen Klucken; Helene Knævelsrud; Roland L Knorr; Ben C B Ko; Fred Ko; Jiunn-Liang Ko; Hotaka Kobayashi; Satoru Kobayashi; Ina Koch; Jan C Koch; Ulrich Koenig; Donat Kögel; Young Ho Koh; Masato Koike; Sepp D Kohlwein; Nur M Kocaturk; Masaaki Komatsu; Jeannette König; Toru Kono; Benjamin T Kopp; Tamas Korcsmaros; Gözde Korkmaz; Viktor I Korolchuk; Mónica Suárez Korsnes; Ali Koskela; Janaiah Kota; Yaichiro Kotake; Monica L Kotler; Yanjun Kou; Michael I Koukourakis; Evangelos Koustas; Attila L Kovacs; Tibor Kovács; Daisuke Koya; Tomohiro Kozako; Claudine Kraft; Dimitri Krainc; Helmut Krämer; Anna D Krasnodembskaya; Carole Kretz-Remy; Guido Kroemer; Nicholas T Ktistakis; Kazuyuki Kuchitsu; Sabine Kuenen; Lars Kuerschner; Thomas Kukar; Ajay Kumar; Ashok Kumar; Deepak Kumar; Dhiraj Kumar; Sharad Kumar; Shinji Kume; Caroline Kumsta; Chanakya N Kundu; Mondira Kundu; Ajaikumar B Kunnumakkara; Lukasz Kurgan; Tatiana G Kutateladze; Ozlem Kutlu; SeongAe Kwak; Ho Jeong Kwon; Taeg Kyu Kwon; Yong Tae Kwon; Irene Kyrmizi; Albert La Spada; Patrick Labonté; Sylvain Ladoire; Ilaria Laface; Frank Lafont; Diane C Lagace; Vikramjit Lahiri; Zhibing Lai; Angela S Laird; Aparna Lakkaraju; Trond Lamark; Sheng-Hui Lan; Ane Landajuela; Darius J R Lane; Jon D Lane; Charles H Lang; Carsten Lange; Ülo Langel; Rupert Langer; Pierre Lapaquette; Jocelyn Laporte; Nicholas F LaRusso; Isabel Lastres-Becker; Wilson Chun Yu Lau; Gordon W Laurie; Sergio Lavandero; Betty Yuen Kwan Law; Helen Ka-Wai Law; Rob Layfield; Weidong Le; Herve Le Stunff; Alexandre Y Leary; Jean-Jacques Lebrun; Lionel Y W Leck; Jean-Philippe Leduc-Gaudet; Changwook Lee; Chung-Pei Lee; Da-Hye Lee; Edward B Lee; Erinna F Lee; Gyun Min Lee; He-Jin Lee; Heung Kyu Lee; Jae Man Lee; Jason S Lee; Jin-A Lee; Joo-Yong Lee; Jun Hee Lee; Michael Lee; Min Goo Lee; Min Jae Lee; Myung-Shik Lee; Sang Yoon Lee; Seung-Jae Lee; Stella Y Lee; Sung Bae Lee; Won Hee Lee; Ying-Ray Lee; Yong-Ho Lee; Youngil Lee; Christophe Lefebvre; Renaud Legouis; Yu L Lei; Yuchen Lei; Sergey Leikin; Gerd Leitinger; Leticia Lemus; Shuilong Leng; Olivia Lenoir; Guido Lenz; Heinz Josef Lenz; Paola Lenzi; Yolanda León; Andréia M Leopoldino; Christoph Leschczyk; Stina Leskelä; Elisabeth Letellier; Chi-Ting Leung; Po Sing Leung; Jeremy S Leventhal; Beth Levine; Patrick A Lewis; Klaus Ley; Bin Li; Da-Qiang Li; Jianming Li; Jing Li; Jiong Li; Ke Li; Liwu Li; Mei Li; Min Li; Min Li; Ming Li; Mingchuan Li; Pin-Lan Li; Ming-Qing Li; Qing Li; Sheng Li; Tiangang Li; Wei Li; Wenming Li; Xue Li; Yi-Ping Li; Yuan Li; Zhiqiang Li; Zhiyong Li; Zhiyuan Li; Jiqin Lian; Chengyu Liang; Qiangrong Liang; Weicheng Liang; Yongheng Liang; YongTian Liang; Guanghong Liao; Lujian Liao; Mingzhi Liao; Yung-Feng Liao; Mariangela Librizzi; Pearl P Y Lie; Mary A Lilly; Hyunjung J Lim; Thania R R Lima; Federica Limana; Chao Lin; Chih-Wen Lin; Dar-Shong Lin; Fu-Cheng Lin; Jiandie D Lin; Kurt M Lin; Kwang-Huei Lin; Liang-Tzung Lin; Pei-Hui Lin; Qiong Lin; Shaofeng Lin; Su-Ju Lin; Wenyu Lin; Xueying Lin; Yao-Xin Lin; Yee-Shin Lin; Rafael Linden; Paula Lindner; Shuo-Chien Ling; Paul Lingor; Amelia K Linnemann; Yih-Cherng Liou; Marta M Lipinski; Saška Lipovšek; Vitor A Lira; Natalia Lisiak; Paloma B Liton; Chao Liu; Ching-Hsuan Liu; Chun-Feng Liu; Cui Hua Liu; Fang Liu; Hao Liu; Hsiao-Sheng Liu; Hua-Feng Liu; Huifang Liu; Jia Liu; Jing Liu; Julia Liu; Leyuan Liu; Longhua Liu; Meilian Liu; Qin Liu; Wei Liu; Wende Liu; Xiao-Hong Liu; Xiaodong Liu; Xingguo Liu; Xu Liu; Xuedong Liu; Yanfen Liu; Yang Liu; Yang Liu; Yueyang Liu; Yule Liu; J Andrew Livingston; Gerard Lizard; Jose M Lizcano; Senka Ljubojevic-Holzer; Matilde E LLeonart; David Llobet-Navàs; Alicia Llorente; Chih Hung Lo; Damián Lobato-Márquez; Qi Long; Yun Chau Long; Ben Loos; Julia A Loos; Manuela G López; Guillermo López-Doménech; José Antonio López-Guerrero; Ana T López-Jiménez; Óscar López-Pérez; Israel López-Valero; Magdalena J Lorenowicz; Mar Lorente; Peter Lorincz; Laura Lossi; Sophie Lotersztajn; Penny E Lovat; Jonathan F Lovell; Alenka Lovy; Péter Lőw; Guang Lu; Haocheng Lu; Jia-Hong Lu; Jin-Jian Lu; Mengji Lu; Shuyan Lu; Alessandro Luciani; John M Lucocq; Paula Ludovico; Micah A Luftig; Morten Luhr; Diego Luis-Ravelo; Julian J Lum; Liany Luna-Dulcey; Anders H Lund; Viktor K Lund; Jan D Lünemann; Patrick Lüningschrör; Honglin Luo; Rongcan Luo; Shouqing Luo; Zhi Luo; Claudio Luparello; Bernhard Lüscher; Luan Luu; Alex Lyakhovich; Konstantin G Lyamzaev; Alf Håkon Lystad; Lyubomyr Lytvynchuk; Alvin C Ma; Changle Ma; Mengxiao Ma; Ning-Fang Ma; Quan-Hong Ma; Xinliang Ma; Yueyun Ma; Zhenyi Ma; Ormond A MacDougald; Fernando Macian; Gustavo C MacIntosh; Jeffrey P MacKeigan; Kay F Macleod; Sandra Maday; Frank Madeo; Muniswamy Madesh; Tobias Madl; Julio Madrigal-Matute; Akiko Maeda; Yasuhiro Maejima; Marta Magarinos; Poornima Mahavadi; Emiliano Maiani; Kenneth Maiese; Panchanan Maiti; Maria Chiara Maiuri; Barbara Majello; Michael B Major; Elena Makareeva; Fayaz Malik; Karthik Mallilankaraman; Walter Malorni; Alina Maloyan; Najiba Mammadova; Gene Chi Wai Man; Federico Manai; Joseph D Mancias; Eva-Maria Mandelkow; Michael A Mandell; Angelo A Manfredi; Masoud H Manjili; Ravi Manjithaya; Patricio Manque; Bella B Manshian; Raquel Manzano; Claudia Manzoni; Kai Mao; Cinzia Marchese; Sandrine Marchetti; Anna Maria Marconi; Fabrizio Marcucci; Stefania Mardente; Olga A Mareninova; Marta Margeta; Muriel Mari; Sara Marinelli; Oliviero Marinelli; Guillermo Mariño; Sofia Mariotto; Richard S Marshall; Mark R Marten; Sascha Martens; Alexandre P J Martin; Katie R Martin; Sara Martin; Shaun Martin; Adrián Martín-Segura; Miguel A Martín-Acebes; Inmaculada Martin-Burriel; Marcos Martin-Rincon; Paloma Martin-Sanz; José A Martina; Wim Martinet; Aitor Martinez; Ana Martinez; Jennifer Martinez; Moises Martinez Velazquez; Nuria Martinez-Lopez; Marta Martinez-Vicente; Daniel O Martins; Joilson O Martins; Waleska K Martins; Tania Martins-Marques; Emanuele Marzetti; Shashank Masaldan; Celine Masclaux-Daubresse; Douglas G Mashek; Valentina Massa; Lourdes Massieu; Glenn R Masson; Laura Masuelli; Anatoliy I Masyuk; Tetyana V Masyuk; Paola Matarrese; Ander Matheu; Satoaki Matoba; Sachiko Matsuzaki; Pamela Mattar; Alessandro Matte; Domenico Mattoscio; José L Mauriz; Mario Mauthe; Caroline Mauvezin; Emanual Maverakis; Paola Maycotte; Johanna Mayer; Gianluigi Mazzoccoli; Cristina Mazzoni; Joseph R Mazzulli; Nami McCarty; Christine McDonald; Mitchell R McGill; Sharon L McKenna; BethAnn McLaughlin; Fionn McLoughlin; Mark A McNiven; Thomas G McWilliams; Fatima Mechta-Grigoriou; Tania Catarina Medeiros; Diego L Medina; Lynn A Megeney; Klara Megyeri; Maryam Mehrpour; Jawahar L Mehta; Alfred J Meijer; Annemarie H Meijer; Jakob Mejlvang; Alicia Meléndez; Annette Melk; Gonen Memisoglu; Alexandrina F Mendes; Delong Meng; Fei Meng; Tian Meng; Rubem Menna-Barreto; Manoj B Menon; Carol Mercer; Anne E Mercier; Jean-Louis Mergny; Adalberto Merighi; Seth D Merkley; Giuseppe Merla; Volker Meske; Ana Cecilia Mestre; Shree Padma Metur; Christian Meyer; Hemmo Meyer; Wenyi Mi; Jeanne Mialet-Perez; Junying Miao; Lucia Micale; Yasuo Miki; Enrico Milan; Małgorzata Milczarek; Dana L Miller; Samuel I Miller; Silke Miller; Steven W Millward; Ira Milosevic; Elena A Minina; Hamed Mirzaei; Hamid Reza Mirzaei; Mehdi Mirzaei; Amit Mishra; Nandita Mishra; Paras Kumar Mishra; Maja Misirkic Marjanovic; Roberta Misasi; Amit Misra; Gabriella Misso; Claire Mitchell; Geraldine Mitou; Tetsuji Miura; Shigeki Miyamoto; Makoto Miyazaki; Mitsunori Miyazaki; Taiga Miyazaki; Keisuke Miyazawa; Noboru Mizushima; Trine H Mogensen; Baharia Mograbi; Reza Mohammadinejad; Yasir Mohamud; Abhishek Mohanty; Sipra Mohapatra; Torsten Möhlmann; Asif Mohmmed; Anna Moles; Kelle H Moley; Maurizio Molinari; Vincenzo Mollace; Andreas Buch Møller; Bertrand Mollereau; Faustino Mollinedo; Costanza Montagna; Mervyn J Monteiro; Andrea Montella; L Ruth Montes; Barbara Montico; Vinod K Mony; Giacomo Monzio Compagnoni; Michael N Moore; Mohammad A Moosavi; Ana L Mora; Marina Mora; David Morales-Alamo; Rosario Moratalla; Paula I Moreira; Elena Morelli; Sandra Moreno; Daniel Moreno-Blas; Viviana Moresi; Benjamin Morga; Alwena H Morgan; Fabrice Morin; Hideaki Morishita; Orson L Moritz; Mariko Moriyama; Yuji Moriyasu; Manuela Morleo; Eugenia Morselli; Jose F Moruno-Manchon; Jorge Moscat; Serge Mostowy; Elisa Motori; Andrea Felinto Moura; Naima Moustaid-Moussa; Maria Mrakovcic; Gabriel Muciño-Hernández; Anupam Mukherjee; Subhadip Mukhopadhyay; Jean M Mulcahy Levy; Victoriano Mulero; Sylviane Muller; Christian Münch; Ashok Munjal; Pura Munoz-Canoves; Teresa Muñoz-Galdeano; Christian Münz; Tomokazu Murakawa; Claudia Muratori; Brona M Murphy; J Patrick Murphy; Aditya Murthy; Timo T Myöhänen; Indira U Mysorekar; Jennifer Mytych; Seyed Mohammad Nabavi; Massimo Nabissi; Péter Nagy; Jihoon Nah; Aimable Nahimana; Ichiro Nakagawa; Ken Nakamura; Hitoshi Nakatogawa; Shyam S Nandi; Meera Nanjundan; Monica Nanni; Gennaro Napolitano; Roberta Nardacci; Masashi Narita; Melissa Nassif; Ilana Nathan; Manabu Natsumeda; Ryno J Naude; Christin Naumann; Olaia Naveiras; Fatemeh Navid; Steffan T Nawrocki; Taras Y Nazarko; Francesca Nazio; Florentina Negoita; Thomas Neill; Amanda L Neisch; Luca M Neri; Mihai G Netea; Patrick Neubert; Thomas P Neufeld; Dietbert Neumann; Albert Neutzner; Phillip T Newton; Paul A Ney; Ioannis P Nezis; Charlene C W Ng; Tzi Bun Ng; Hang T T Nguyen; Long T Nguyen; Hong-Min Ni; Clíona Ní Cheallaigh; Zhenhong Ni; M Celeste Nicolao; Francesco Nicoli; Manuel Nieto-Diaz; Per Nilsson; Shunbin Ning; Rituraj Niranjan; Hiroshi Nishimune; Mireia Niso-Santano; Ralph A Nixon; Annalisa Nobili; Clevio Nobrega; Takeshi Noda; Uxía Nogueira-Recalde; Trevor M Nolan; Ivan Nombela; Ivana Novak; Beatriz Novoa; Takashi Nozawa; Nobuyuki Nukina; Carmen Nussbaum-Krammer; Jesper Nylandsted; Tracey R O'Donovan; Seónadh M O'Leary; Eyleen J O'Rourke; Mary P O'Sullivan; Timothy E O'Sullivan; Salvatore Oddo; Ina Oehme; Michinaga Ogawa; Eric Ogier-Denis; Margret H Ogmundsdottir; Besim Ogretmen; Goo Taeg Oh; Seon-Hee Oh; Young J Oh; Takashi Ohama; Yohei Ohashi; Masaki Ohmuraya; Vasileios Oikonomou; Rani Ojha; Koji Okamoto; Hitoshi Okazawa; Masahide Oku; Sara Oliván; Jorge M A Oliveira; Michael Ollmann; James A Olzmann; Shakib Omari; M Bishr Omary; Gizem Önal; Martin Ondrej; Sang-Bing Ong; Sang-Ging Ong; Anna Onnis; Juan A Orellana; Sara Orellana-Muñoz; Maria Del Mar Ortega-Villaizan; Xilma R Ortiz-Gonzalez; Elena Ortona; Heinz D Osiewacz; Abdel-Hamid K Osman; Rosario Osta; Marisa S Otegui; Kinya Otsu; Christiane Ott; Luisa Ottobrini; Jing-Hsiung James Ou; Tiago F Outeiro; Inger Oynebraten; Melek Ozturk; Gilles Pagès; Susanta Pahari; Marta Pajares; Utpal B Pajvani; Rituraj Pal; Simona Paladino; Nicolas Pallet; Michela Palmieri; Giuseppe Palmisano; Camilla Palumbo; Francesco Pampaloni; Lifeng Pan; Qingjun Pan; Wenliang Pan; Xin Pan; Ganna Panasyuk; Rahul Pandey; Udai B Pandey; Vrajesh Pandya; Francesco Paneni; Shirley Y Pang; Elisa Panzarini; Daniela L Papademetrio; Elena Papaleo; Daniel Papinski; Diana Papp; Eun Chan Park; Hwan Tae Park; Ji-Man Park; Jong-In Park; Joon Tae Park; Junsoo Park; Sang Chul Park; Sang-Youel Park; Abraham H Parola; Jan B Parys; Adrien Pasquier; Benoit Pasquier; João F Passos; Nunzia Pastore; Hemal H Patel; Daniel Patschan; Sophie Pattingre; Gustavo Pedraza-Alva; Jose Pedraza-Chaverri; Zully Pedrozo; Gang Pei; Jianming Pei; Hadas Peled-Zehavi; Joaquín M Pellegrini; Joffrey Pelletier; Miguel A Peñalva; Di Peng; Ying Peng; Fabio Penna; Maria Pennuto; Francesca Pentimalli; Cláudia Mf Pereira; Gustavo J S Pereira; Lilian C Pereira; Luis Pereira de Almeida; Nirma D Perera; Ángel Pérez-Lara; Ana B Perez-Oliva; María Esther Pérez-Pérez; Palsamy Periyasamy; Andras Perl; Cristiana Perrotta; Ida Perrotta; Richard G Pestell; Morten Petersen; Irina Petrache; Goran Petrovski; Thorsten Pfirrmann; Astrid S Pfister; Jennifer A Philips; Huifeng Pi; Anna Picca; Alicia M Pickrell; Sandy Picot; Giovanna M Pierantoni; Marina Pierdominici; Philippe Pierre; Valérie Pierrefite-Carle; Karolina Pierzynowska; Federico Pietrocola; Miroslawa Pietruczuk; Claudio Pignata; Felipe X Pimentel-Muiños; Mario Pinar; Roberta O Pinheiro; Ronit Pinkas-Kramarski; Paolo Pinton; Karolina Pircs; Sujan Piya; Paola Pizzo; Theo S Plantinga; Harald W Platta; Ainhoa Plaza-Zabala; Markus Plomann; Egor Y Plotnikov; Helene Plun-Favreau; Ryszard Pluta; Roger Pocock; Stefanie Pöggeler; Christian Pohl; Marc Poirot; Angelo Poletti; Marisa Ponpuak; Hana Popelka; Blagovesta Popova; Helena Porta; Soledad Porte Alcon; Eliana Portilla-Fernandez; Martin Post; Malia B Potts; Joanna Poulton; Ted Powers; Veena Prahlad; Tomasz K Prajsnar; Domenico Praticò; Rosaria Prencipe; Muriel Priault; Tassula Proikas-Cezanne; Vasilis J Promponas; Christopher G Proud; Rosa Puertollano; Luigi Puglielli; Thomas Pulinilkunnil; Deepika Puri; Rajat Puri; Julien Puyal; Xiaopeng Qi; Yongmei Qi; Wenbin Qian; Lei Qiang; Yu Qiu; Joe Quadrilatero; Jorge Quarleri; Nina Raben; Hannah Rabinowich; Debora Ragona; Michael J Ragusa; Nader Rahimi; Marveh Rahmati; Valeria Raia; Nuno Raimundo; Namakkal-Soorappan Rajasekaran; Sriganesh Ramachandra Rao; Abdelhaq Rami; Ignacio Ramírez-Pardo; David B Ramsden; Felix Randow; Pundi N Rangarajan; Danilo Ranieri; Hai Rao; Lang Rao; Rekha Rao; Sumit Rathore; J Arjuna Ratnayaka; Edward A Ratovitski; Palaniyandi Ravanan; Gloria Ravegnini; Swapan K Ray; Babak Razani; Vito Rebecca; Fulvio Reggiori; Anne Régnier-Vigouroux; Andreas S Reichert; David Reigada; Jan H Reiling; Theo Rein; Siegfried Reipert; Rokeya Sultana Rekha; Hongmei Ren; Jun Ren; Weichao Ren; Tristan Renault; Giorgia Renga; Karen Reue; Kim Rewitz; Bruna Ribeiro de Andrade Ramos; S Amer Riazuddin; Teresa M Ribeiro-Rodrigues; Jean-Ehrland Ricci; Romeo Ricci; Victoria Riccio; Des R Richardson; Yasuko Rikihisa; Makarand V Risbud; Ruth M Risueño; Konstantinos Ritis; Salvatore Rizza; Rosario Rizzuto; Helen C Roberts; Luke D Roberts; Katherine J Robinson; Maria Carmela Roccheri; Stephane Rocchi; George G Rodney; Tiago Rodrigues; Vagner Ramon Rodrigues Silva; Amaia Rodriguez; Ruth Rodriguez-Barrueco; Nieves Rodriguez-Henche; Humberto Rodriguez-Rocha; Jeroen Roelofs; Robert S Rogers; Vladimir V Rogov; Ana I Rojo; Krzysztof Rolka; Vanina Romanello; Luigina Romani; Alessandra Romano; Patricia S Romano; David Romeo-Guitart; Luis C Romero; Montserrat Romero; Joseph C Roney; Christopher Rongo; Sante Roperto; Mathias T Rosenfeldt; Philip Rosenstiel; Anne G Rosenwald; Kevin A Roth; Lynn Roth; Steven Roth; Kasper M A Rouschop; Benoit D Roussel; Sophie Roux; Patrizia Rovere-Querini; Ajit Roy; Aurore Rozieres; Diego Ruano; David C Rubinsztein; Maria P Rubtsova; Klaus Ruckdeschel; Christoph Ruckenstuhl; Emil Rudolf; Rüdiger Rudolf; Alessandra Ruggieri; Avnika Ashok Ruparelia; Paola Rusmini; Ryan R Russell; Gian Luigi Russo; Maria Russo; Rossella Russo; Oxana O Ryabaya; Kevin M Ryan; Kwon-Yul Ryu; Maria Sabater-Arcis; Ulka Sachdev; Michael Sacher; Carsten Sachse; Abhishek Sadhu; Junichi Sadoshima; Nathaniel Safren; Paul Saftig; Antonia P Sagona; Gaurav Sahay; Amirhossein Sahebkar; Mustafa Sahin; Ozgur Sahin; Sumit Sahni; Nayuta Saito; Shigeru Saito; Tsunenori Saito; Ryohei Sakai; Yasuyoshi Sakai; Jun-Ichi Sakamaki; Kalle Saksela; Gloria Salazar; Anna Salazar-Degracia; Ghasem H Salekdeh; Ashok K Saluja; Belém Sampaio-Marques; Maria Cecilia Sanchez; Jose A Sanchez-Alcazar; Victoria Sanchez-Vera; Vanessa Sancho-Shimizu; J Thomas Sanderson; Marco Sandri; Stefano Santaguida; Laura Santambrogio; Magda M Santana; Giorgio Santoni; Alberto Sanz; Pascual Sanz; Shweta Saran; Marco Sardiello; Timothy J Sargeant; Apurva Sarin; Chinmoy Sarkar; Sovan Sarkar; Maria-Rosa Sarrias; Surajit Sarkar; Dipanka Tanu Sarmah; Jaakko Sarparanta; Aishwarya Sathyanarayan; Ranganayaki Sathyanarayanan; K Matthew Scaglione; Francesca Scatozza; Liliana Schaefer; Zachary T Schafer; Ulrich E Schaible; Anthony H V Schapira; Michael Scharl; Hermann M Schatzl; Catherine H Schein; Wiep Scheper; David Scheuring; Maria Vittoria Schiaffino; Monica Schiappacassi; Rainer Schindl; Uwe Schlattner; Oliver Schmidt; Roland Schmitt; Stephen D Schmidt; Ingo Schmitz; Eran Schmukler; Anja Schneider; Bianca E Schneider; Romana Schober; Alejandra C Schoijet; Micah B Schott; Michael Schramm; Bernd Schröder; Kai Schuh; Christoph Schüller; Ryan J Schulze; Lea Schürmanns; Jens C Schwamborn; Melanie Schwarten; Filippo Scialo; Sebastiano Sciarretta; Melanie J Scott; Kathleen W Scotto; A Ivana Scovassi; Andrea Scrima; Aurora Scrivo; David Sebastian; Salwa Sebti; Simon Sedej; Laura Segatori; Nava Segev; Per O Seglen; Iban Seiliez; Ekihiro Seki; Scott B Selleck; Frank W Sellke; Joshua T Selsby; Michael Sendtner; Serif Senturk; Elena Seranova; Consolato Sergi; Ruth Serra-Moreno; Hiromi Sesaki; Carmine Settembre; Subba Rao Gangi Setty; Gianluca Sgarbi; Ou Sha; John J Shacka; Javeed A Shah; Dantong Shang; Changshun Shao; Feng Shao; Soroush Sharbati; Lisa M Sharkey; Dipali Sharma; Gaurav Sharma; Kulbhushan Sharma; Pawan Sharma; Surendra Sharma; Han-Ming Shen; Hongtao Shen; Jiangang Shen; Ming Shen; Weili Shen; Zheni Shen; Rui Sheng; Zhi Sheng; Zu-Hang Sheng; Jianjian Shi; Xiaobing Shi; Ying-Hong Shi; Kahori Shiba-Fukushima; Jeng-Jer Shieh; Yohta Shimada; Shigeomi Shimizu; Makoto Shimozawa; Takahiro Shintani; Christopher J Shoemaker; Shahla Shojaei; Ikuo Shoji; Bhupendra V Shravage; Viji Shridhar; Chih-Wen Shu; Hong-Bing Shu; Ke Shui; Arvind K Shukla; Timothy E Shutt; Valentina Sica; Aleem Siddiqui; Amanda Sierra; Virginia Sierra-Torre; Santiago Signorelli; Payel Sil; Bruno J de Andrade Silva; Johnatas D Silva; Eduardo Silva-Pavez; Sandrine Silvente-Poirot; Rachel E Simmonds; Anna Katharina Simon; Hans-Uwe Simon; Matias Simons; Anurag Singh; Lalit P Singh; Rajat Singh; Shivendra V Singh; Shrawan K Singh; Sudha B Singh; Sunaina Singh; Surinder Pal Singh; Debasish Sinha; Rohit Anthony Sinha; Sangita Sinha; Agnieszka Sirko; Kapil Sirohi; Efthimios L Sivridis; Panagiotis Skendros; Aleksandra Skirycz; Iva Slaninová; Soraya S Smaili; Andrei Smertenko; Matthew D Smith; Stefaan J Soenen; Eun Jung Sohn; Sophia P M Sok; Giancarlo Solaini; Thierry Soldati; Scott A Soleimanpour; Rosa M Soler; Alexei Solovchenko; Jason A Somarelli; Avinash Sonawane; Fuyong Song; Hyun Kyu Song; Ju-Xian Song; Kunhua Song; Zhiyin Song; Leandro R Soria; Maurizio Sorice; Alexander A Soukas; Sandra-Fausia Soukup; Diana Sousa; Nadia Sousa; Paul A Spagnuolo; Stephen A Spector; M M Srinivas Bharath; Daret St Clair; Venturina Stagni; Leopoldo Staiano; Clint A Stalnecker; Metodi V Stankov; Peter B Stathopulos; Katja Stefan; Sven Marcel Stefan; Leonidas Stefanis; Joan S Steffan; Alexander Steinkasserer; Harald Stenmark; Jared Sterneckert; Craig Stevens; Veronika Stoka; Stephan Storch; Björn Stork; Flavie Strappazzon; Anne Marie Strohecker; Dwayne G Stupack; Huanxing Su; Ling-Yan Su; Longxiang Su; Ana M Suarez-Fontes; Carlos S Subauste; Selvakumar Subbian; Paula V Subirada; Ganapasam Sudhandiran; Carolyn M Sue; Xinbing Sui; Corey Summers; Guangchao Sun; Jun Sun; Kang Sun; Meng-Xiang Sun; Qiming Sun; Yi Sun; Zhongjie Sun; Karen K S Sunahara; Eva Sundberg; Katalin Susztak; Peter Sutovsky; Hidekazu Suzuki; Gary Sweeney; J David Symons; Stephen Cho Wing Sze; Nathaniel J Szewczyk; Anna Tabęcka-Łonczynska; Claudio Tabolacci; Frank Tacke; Heinrich Taegtmeyer; Marco Tafani; Mitsuo Tagaya; Haoran Tai; Stephen W G Tait; Yoshinori Takahashi; Szabolcs Takats; Priti Talwar; Chit Tam; Shing Yau Tam; Davide Tampellini; Atsushi Tamura; Chong Teik Tan; Eng-King Tan; Ya-Qin Tan; Masaki Tanaka; Motomasa Tanaka; Daolin Tang; Jingfeng Tang; Tie-Shan Tang; Isei Tanida; Zhipeng Tao; Mohammed Taouis; Lars Tatenhorst; Nektarios Tavernarakis; Allen Taylor; Gregory A Taylor; Joan M Taylor; Elena Tchetina; Andrew R Tee; Irmgard Tegeder; David Teis; Natercia Teixeira; Fatima Teixeira-Clerc; Kumsal A Tekirdag; Tewin Tencomnao; Sandra Tenreiro; Alexei V Tepikin; Pilar S Testillano; Gianluca Tettamanti; Pierre-Louis Tharaux; Kathrin Thedieck; Arvind A Thekkinghat; Stefano Thellung; Josephine W Thinwa; V P Thirumalaikumar; Sufi Mary Thomas; Paul G Thomes; Andrew Thorburn; Lipi Thukral; Thomas Thum; Michael Thumm; Ling Tian; Ales Tichy; Andreas Till; Vincent Timmerman; Vladimir I Titorenko; Sokol V Todi; Krassimira Todorova; Janne M Toivonen; Luana Tomaipitinca; Dhanendra Tomar; Cristina Tomas-Zapico; Sergej Tomić; Benjamin Chun-Kit Tong; Chao Tong; Xin Tong; Sharon A Tooze; Maria L Torgersen; Satoru Torii; Liliana Torres-López; Alicia Torriglia; Christina G Towers; Roberto Towns; Shinya Toyokuni; Vladimir Trajkovic; Donatella Tramontano; Quynh-Giao Tran; Leonardo H Travassos; Charles B Trelford; Shirley Tremel; Ioannis P Trougakos; Betty P Tsao; Mario P Tschan; Hung-Fat Tse; Tak Fu Tse; Hitoshi Tsugawa; Andrey S Tsvetkov; David A Tumbarello; Yasin Tumtas; María J Tuñón; Sandra Turcotte; Boris Turk; Vito Turk; Bradley J Turner; Richard I Tuxworth; Jessica K Tyler; Elena V Tyutereva; Yasuo Uchiyama; Aslihan Ugun-Klusek; Holm H Uhlig; Marzena Ułamek-Kozioł; Ilya V Ulasov; Midori Umekawa; Christian Ungermann; Rei Unno; Sylvie Urbe; Elisabet Uribe-Carretero; Suayib Üstün; Vladimir N Uversky; Thomas Vaccari; Maria I Vaccaro; Björn F Vahsen; Helin Vakifahmetoglu-Norberg; Rut Valdor; Maria J Valente; Ayelén Valko; Richard B Vallee; Angela M Valverde; Greet Van den Berghe; Stijn van der Veen; Luc Van Kaer; Jorg van Loosdregt; Sjoerd J L van Wijk; Wim Vandenberghe; Ilse Vanhorebeek; Marcos A Vannier-Santos; Nicola Vannini; M Cristina Vanrell; Chiara Vantaggiato; Gabriele Varano; Isabel Varela-Nieto; Máté Varga; M Helena Vasconcelos; Somya Vats; Demetrios G Vavvas; Ignacio Vega-Naredo; Silvia Vega-Rubin-de-Celis; Guillermo Velasco; Ariadna P Velázquez; Tibor Vellai; Edo Vellenga; Francesca Velotti; Mireille Verdier; Panayotis Verginis; Isabelle Vergne; Paul Verkade; Manish Verma; Patrik Verstreken; Tim Vervliet; Jörg Vervoorts; Alexandre T Vessoni; Victor M Victor; Michel Vidal; Chiara Vidoni; Otilia V Vieira; Richard D Vierstra; Sonia Viganó; Helena Vihinen; Vinoy Vijayan; Miquel Vila; Marçal Vilar; José M Villalba; Antonio Villalobo; Beatriz Villarejo-Zori; Francesc Villarroya; Joan Villarroya; Olivier Vincent; Cecile Vindis; Christophe Viret; Maria Teresa Viscomi; Dora Visnjic; Ilio Vitale; David J Vocadlo; Olga V Voitsekhovskaja; Cinzia Volonté; Mattia Volta; Marta Vomero; Clarissa Von Haefen; Marc A Vooijs; Wolfgang Voos; Ljubica Vucicevic; Richard Wade-Martins; Satoshi Waguri; Kenrick A Waite; Shuji Wakatsuki; David W Walker; Mark J Walker; Simon A Walker; Jochen Walter; Francisco G Wandosell; Bo Wang; Chao-Yung Wang; Chen Wang; Chenran Wang; Chenwei Wang; Cun-Yu Wang; Dong Wang; Fangyang Wang; Feng Wang; Fengming Wang; Guansong Wang; Han Wang; Hao Wang; Hexiang Wang; Hong-Gang Wang; Jianrong Wang; Jigang Wang; Jiou Wang; Jundong Wang; Kui Wang; Lianrong Wang; Liming Wang; Maggie Haitian Wang; Meiqing Wang; Nanbu Wang; Pengwei Wang; Peipei Wang; Ping Wang; Ping Wang; Qing Jun Wang; Qing Wang; Qing Kenneth Wang; Qiong A Wang; Wen-Tao Wang; Wuyang Wang; Xinnan Wang; Xuejun Wang; Yan Wang; Yanchang Wang; Yanzhuang Wang; Yen-Yun Wang; Yihua Wang; Yipeng Wang; Yu Wang; Yuqi Wang; Zhe Wang; Zhenyu Wang; Zhouguang Wang; Gary Warnes; Verena Warnsmann; Hirotaka Watada; Eizo Watanabe; Maxinne Watchon; Anna Wawrzyńska; Timothy E Weaver; Grzegorz Wegrzyn; Ann M Wehman; Huafeng Wei; Lei Wei; Taotao Wei; Yongjie Wei; Oliver H Weiergräber; Conrad C Weihl; Günther Weindl; Ralf Weiskirchen; Alan Wells; Runxia H Wen; Xin Wen; Antonia Werner; Beatrice Weykopf; Sally P Wheatley; J Lindsay Whitton; Alexander J Whitworth; Katarzyna Wiktorska; Manon E Wildenberg; Tom Wileman; Simon Wilkinson; Dieter Willbold; Brett Williams; Robin S B Williams; Roger L Williams; Peter R Williamson; Richard A Wilson; Beate Winner; Nathaniel J Winsor; Steven S Witkin; Harald Wodrich; Ute Woehlbier; Thomas Wollert; Esther Wong; Jack Ho Wong; Richard W Wong; Vincent Kam Wai Wong; W Wei-Lynn Wong; An-Guo Wu; Chengbiao Wu; Jian Wu; Junfang Wu; Kenneth K Wu; Min Wu; Shan-Ying Wu; Shengzhou Wu; Shu-Yan Wu; Shufang Wu; William K K Wu; Xiaohong Wu; Xiaoqing Wu; Yao-Wen Wu; Yihua Wu; Ramnik J Xavier; Hongguang Xia; Lixin Xia; Zhengyuan Xia; Ge Xiang; Jin Xiang; Mingliang Xiang; Wei Xiang; Bin Xiao; Guozhi Xiao; Hengyi Xiao; Hong-Tao Xiao; Jian Xiao; Lan Xiao; Shi Xiao; Yin Xiao; Baoming Xie; Chuan-Ming Xie; Min Xie; Yuxiang Xie; Zhiping Xie; Zhonglin Xie; Maria Xilouri; Congfeng Xu; En Xu; Haoxing Xu; Jing Xu; JinRong Xu; Liang Xu; Wen Wen Xu; Xiulong Xu; Yu Xue; Sokhna M S Yakhine-Diop; Masamitsu Yamaguchi; Osamu Yamaguchi; Ai Yamamoto; Shunhei Yamashina; Shengmin Yan; Shian-Jang Yan; Zhen Yan; Yasuo Yanagi; Chuanbin Yang; Dun-Sheng Yang; Huan Yang; Huang-Tian Yang; Hui Yang; Jin-Ming Yang; Jing Yang; Jingyu Yang; Ling Yang; Liu Yang; Ming Yang; Pei-Ming Yang; Qian Yang; Seungwon Yang; Shu Yang; Shun-Fa Yang; Wannian Yang; Wei Yuan Yang; Xiaoyong Yang; Xuesong Yang; Yi Yang; Ying Yang; Honghong Yao; Shenggen Yao; Xiaoqiang Yao; Yong-Gang Yao; Yong-Ming Yao; Takahiro Yasui; Meysam Yazdankhah; Paul M Yen; Cong Yi; Xiao-Ming Yin; Yanhai Yin; Zhangyuan Yin; Ziyi Yin; Meidan Ying; Zheng Ying; Calvin K Yip; Stephanie Pei Tung Yiu; Young H Yoo; Kiyotsugu Yoshida; Saori R Yoshii; Tamotsu Yoshimori; Bahman Yousefi; Boxuan Yu; Haiyang Yu; Jun Yu; Jun Yu; Li Yu; Ming-Lung Yu; Seong-Woon Yu; Victor C Yu; W Haung Yu; Zhengping Yu; Zhou Yu; Junying Yuan; Ling-Qing Yuan; Shilin Yuan; Shyng-Shiou F Yuan; Yanggang Yuan; Zengqiang Yuan; Jianbo Yue; Zhenyu Yue; Jeanho Yun; Raymond L Yung; David N Zacks; Gabriele Zaffagnini; Vanessa O Zambelli; Isabella Zanella; Qun S Zang; Sara Zanivan; Silvia Zappavigna; Pilar Zaragoza; Konstantinos S Zarbalis; Amir Zarebkohan; Amira Zarrouk; Scott O Zeitlin; Jialiu Zeng; Ju-Deng Zeng; Eva Žerovnik; Lixuan Zhan; Bin Zhang; Donna D Zhang; Hanlin Zhang; Hong Zhang; Hong Zhang; Honghe Zhang; Huafeng Zhang; Huaye Zhang; Hui Zhang; Hui-Ling Zhang; Jianbin Zhang; Jianhua Zhang; Jing-Pu Zhang; Kalin Y B Zhang; Leshuai W Zhang; Lin Zhang; Lisheng Zhang; Lu Zhang; Luoying Zhang; Menghuan Zhang; Peng Zhang; Sheng Zhang; Wei Zhang; Xiangnan Zhang; Xiao-Wei Zhang; Xiaolei Zhang; Xiaoyan Zhang; Xin Zhang; Xinxin Zhang; Xu Dong Zhang; Yang Zhang; Yanjin Zhang; Yi Zhang; Ying-Dong Zhang; Yingmei Zhang; Yuan-Yuan Zhang; Yuchen Zhang; Zhe Zhang; Zhengguang Zhang; Zhibing Zhang; Zhihai Zhang; Zhiyong Zhang; Zili Zhang; Haobin Zhao; Lei Zhao; Shuang Zhao; Tongbiao Zhao; Xiao-Fan Zhao; Ying Zhao; Yongchao Zhao; Yongliang Zhao; Yuting Zhao; Guoping Zheng; Kai Zheng; Ling Zheng; Shizhong Zheng; Xi-Long Zheng; Yi Zheng; Zu-Guo Zheng; Boris Zhivotovsky; Qing Zhong; Ao Zhou; Ben Zhou; Cefan Zhou; Gang Zhou; Hao Zhou; Hong Zhou; Hongbo Zhou; Jie Zhou; Jing Zhou; Jing Zhou; Jiyong Zhou; Kailiang Zhou; Rongjia Zhou; Xu-Jie Zhou; Yanshuang Zhou; Yinghong Zhou; Yubin Zhou; Zheng-Yu Zhou; Zhou Zhou; Binglin Zhu; Changlian Zhu; Guo-Qing Zhu; Haining Zhu; Hongxin Zhu; Hua Zhu; Wei-Guo Zhu; Yanping Zhu; Yushan Zhu; Haixia Zhuang; Xiaohong Zhuang; Katarzyna Zientara-Rytter; Christine M Zimmermann; Elena Ziviani; Teresa Zoladek; Wei-Xing Zong; Dmitry B Zorov; Antonio Zorzano; Weiping Zou; Zhen Zou; Zhengzhi Zou; Steven Zuryn; Werner Zwerschke; Beate Brand-Saberi; X Charlie Dong; Chandra Shekar Kenchappa; Zuguo Li; Yong Lin; Shigeru Oshima; Yueguang Rong; Judith C Sluimer; Christina L Stallings; Chun-Kit Tong Journal: Autophagy Date: 2021-02-08 Impact factor: 13.391
Authors: Rie R Yotsu; Koichi Suzuki; Rachel E Simmonds; Roger Bedimo; Anthony Ablordey; Dorothy Yeboah-Manu; Richard Phillips; Kingsley Asiedu Journal: Curr Trop Med Rep Date: 2018-09-28
Authors: Guanghui Zong; Zhijian Hu; Sarah O'Keefe; Dale Tranter; Michael J Iannotti; Ludivine Baron; Belinda Hall; Katherine Corfield; Anja O Paatero; Mark J Henderson; Peristera Roboti; Jianhong Zhou; Xianwei Sun; Mugunthan Govindarajan; Jason M Rohde; Nicolas Blanchard; Rachel Simmonds; James Inglese; Yuchun Du; Caroline Demangel; Stephen High; Ville O Paavilainen; Wei Q Shi Journal: J Am Chem Soc Date: 2019-05-15 Impact factor: 15.419