Literature DB >> 35939447

Regulation of rod photoreceptor function by farnesylated G-protein γ-subunits.

Alexander V Kolesnikov1,2, Elena Lobysheva3, Jaya P Gnana-Prakasam3,4, Vladimir J Kefalov1,2,5, Oleg G Kisselev3,4.   

Abstract

Heterotrimeric G-protein transducin, Gt, is a key signal transducer and amplifier in retinal rod and cone photoreceptor cells. Despite similar subunit composition, close amino acid identity, and identical posttranslational farnesylation of their Gγ subunits, rods and cones rely on unique Gγ1 (Gngt1) and Gγc (Gngt2) isoforms, respectively. The only other farnesylated G-protein γ-subunit, Gγ11 (Gng11), is expressed in multiple tissues but not retina. To determine whether Gγ1 regulates uniquely rod phototransduction, we generated transgenic rods expressing Gγ1, Gγc, or Gγ11 in Gγ1-deficient mice and analyzed their properties. Immunohistochemistry and Western blotting demonstrated the robust expression of each transgenic Gγ in rod cells and restoration of Gαt1 expression, which is greatly reduced in Gγ1-deficient rods. Electroretinography showed restoration of visual function in all three transgenic Gγ1-deficient lines. Recordings from individual transgenic rods showed that photosensitivity impaired in Gγ1-deficient rods was also fully restored. In all dark-adapted transgenic lines, Gαt1 was targeted to the outer segments, reversing its diffuse localization found in Gγ1-deficient rods. Bright illumination triggered Gαt1 translocation from the rod outer to inner segments in all three transgenic strains. However, Gαt1 translocation in Gγ11 transgenic mice occurred at significantly dimmer background light. Consistent with this, transretinal ERG recordings revealed gradual response recovery in moderate background illumination in Gγ11 transgenic mice but not in Gγ1 controls. Thus, while farnesylated Gγ subunits are functionally active and largely interchangeable in supporting rod phototransduction, replacement of retina-specific Gγ isoforms by the ubiquitous Gγ11 affects the ability of rods to adapt to background light.

Entities:  

Mesh:

Substances:

Year:  2022        PMID: 35939447      PMCID: PMC9359561          DOI: 10.1371/journal.pone.0272506

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.752


Introduction

The high sensitivity of rod photoreceptors is achieved by the activation of multiple copies of the heterotrimeric G-protein, Gt, by a single rhodopsin [1]. The Gtβγ (Gβ1γ1) complex is crucial for efficient signal amplification in mouse rods. Analysis of Gγ1-deficient rods has shown that although Gαt1 is sufficient for signal transduction, the efficient signal amplification required for nocturnal vision is achieved only in the presence of the Gtβγ-complex [2, 3]. Whether the isoform diversity among Gγ-subunits contributes to specific physiological characteristics of retinal photoreceptors remains unknown. For example, rod and cone Gt heterotrimers are considered unique and the sole signal transducers in rods and cones respectively, compared to other cell types that contain multiple G-protein isoforms. Replacing individual subunits in retinal photoreceptors is a powerful approach to address their functional differences. Each of the three subunits of transducin, rod Gαt1 vs. cone Gαt2, rod Gβ1 vs. cone Gβ3, and rod Gγ1 vs. cone Gγc, can potentially contribute to the observed lower rate of Gt activation in cones. With rare exception [4], the majority of the data obtained from Gαt1 replacement experiments point to close functional similarity and good interchangeability between Gαt1 and Gαt2 [5-7]. Thus, the lower visual sensitivity of cones compared to rods and reduced rate of signal transduction between the cone visual pigment and PDE cannot be explained by the differences in the Gtα subunits. G-protein γ-subunits are a protein family composed of twelve isoforms that are posttranslationally isoprenylated and carboxymethylated [8-11]. Only three Gγ subunits are modified by a 15-carbon farnesyl, while the rest contain a 20-carbon geranylgeranyl lipid moiety. The three farnesylated Gγ subunits are: rod-specific Gtγ1 (Gγ1, Gngt1) [12]; cone-specific Gtγc (Gγc, Gγ9, Gngt2) [13]; and the relatively ubiquitous Gγ11 (Gng11) [14]. Rod and cone subunits of transducin share fairly high levels of amino acid identity: Gαt1 is 78% identical to Gαt2, Gβ1 is 80% identical to Gβ3, while Gγ1 is 64% identical to Gγc (Fig 1). Despite their similarities, Gγ subunits differ dramatically in their tissue expression pattern and putative G-protein coupled receptor (GPCR) partners [15, 16]. The reason for this intriguing diversity of Gγ subunits and the contribution of their amino acid sequence and protein structure in G-protein signaling remain very poorly understood. Thus, it is still a mystery why Gγ1 is specifically expressed in the rod photoreceptors and Gγc is exclusive to the cones, while Gγ11 is excluded from both photoreceptor types.
Fig 1

Multiple amino acid sequence alignment of mouse rod Gγ1 (Gngt1), cone Gγc (Gngt2), and Gγ11 (Gng11).

The determination of physiological roles of Gγ subunits in non-photoreceptor cells is difficult due to the redundancy of G-protein mediated pathways [17]. Phototransduction in rods, however, is mediated by a single G-protein transducin, Gtαβγ (Gαt1, Gβ1, Gγ1). Deletion of Gngt1 to generate Gγ1-deficient mice results in rods with greatly reduced signal amplification and is associated with severe reduction in the expression of Gαt1 and Gβ1 [2]. To address how the specific properties of Gγ regulate the function of rods, we created transgenic mice expressing the rod Gγ1, the cone Gγc, or the ubiquitous Gγ11 in the Gngt1 line. This approach allowed us to determine whether substitution of Gγ1 by Gγc or Gγ11 restores rod function. We also analyzed how the expression of each Gγ affects the expression of Gαt1 and Gβ1, as well as their light-driven translocation within rods.

Materials and methods

Generation of Gγ transgenic mouse lines

All experiments were performed in accordance with the Guide for the Care and Use of Laboratory Animals and were approved by the Saint Louis University Institutional Animal Care and Use Committee and the Washington University Animal Studies Committee. Unless otherwise specified, all mice were age-matched 2- to 3-month-old littermates of either sex; they were kept under the standard 12 h dark/light cycle and dark-adapted overnight before all experiments. We introduced three individual mouse Gγ-subunits into Gγ1-deficient rods [18]. All transgenic constructs included the 4.4 kb mouse opsin promoter (generous gift from Dr. Lem, Tufts Medical Center) [19], mouse Gngt1 cDNA, as well as appropriate intron and poly(A) sequences (Fig 2). An in-frame insertion of 3xFLAG-HA epitope at the N-terminus of all Gγ was designed to help with detection and quantification of the expressed proteins. The following nucleic acid sequence was present in all individual synthetic genes used to generate the three transgenic constructs: tttaaactgcagaagttggtcgtgaggcactgggcaggtaagtatcaaggttacaagacaggtttaaggagaccaatagaaactgggcttgtcgagacagagaagactcttgcgtttctgataggcacctattggtcttactgacatccactttgcctttctctccacaggtgtccactcccagttcaattacagctcttaaggctagagtacttaatacgactcactataggctagcctcgatcgagaattcacgcgtcttccctgacagaagatggactacaaagaccatgacggtgattataaagatcatgacatcgattacaaggatgacgatgacaagcttgcggccgcgaattcatacccatacgacgtaccagattacgct.
Fig 2

Gγ1 transgenic construct (left) and the PCR screening test (right). DNA gel: 1) Molecular weight markers; 2) 349 bp PCR product using universal F/R primers; 3) 1011 bp PCR product using 1F/1R primers. Similar design was employed to generate Gγc and Gγ11 transgenic constructs.

Gγ1 transgenic construct (left) and the PCR screening test (right). DNA gel: 1) Molecular weight markers; 2) 349 bp PCR product using universal F/R primers; 3) 1011 bp PCR product using 1F/1R primers. Similar design was employed to generate Gγc and Gγ11 transgenic constructs. It included part of the intron and 3xFLAG-HA epitope, and was used for developing genotyping assay at Transnetyx, Inc. The genotyping strategy is available for sharing upon request. The purified BamH1 insertion fragment was microinjected into fertilized mouse eggs and re-implanted in pseudopregnant C57Bl/6 female mice. Founders expressing Gγ1, Gγc, and Gγ11 transgenes were bred with our existing Gγ1-deficient line, Gngt1, to generate GγGngt1, GγGngt1, and GγGngt1 mice.

Western blotting and antibodies

Retinas from 2-month-old dark-adapted mice were dissected, flash-frozen in liquid nitrogen, and stored at -80°C until protein quantification or biochemical experiments. Bio-Rad precast 12% Mini-Protean TGX were used for all SDS-gels. Protein transfer was performed using Trans-Blot SD semi-dry cell on PVDF membrane. Rabbit antibodies sc-389-Gαt1, sc-15382-rhodopsin were from Santa Cruz Biotechnology (Santa Cruz, CA). Mouse FLAG M2 F1804 were from Sigma-Aldrich. Rabbit HA TA150084 were from Origene. Rabbit PDE6A PA1-720, PDE6G PA1-723 and beta Actin PA1-16889 and secondary HRP antibodies were from Invitrogen. Rabbit antibodies against Gβ1 and Gγ1 were a gift from N. Gautam (Washington University, St. Louis, MO). Primary antibody dilution was 1:1,000. Secondary antibody dilution was 1:10,000. All gels/blots were developed and analyzed in compliance with the digital image and integrity policies. Prior to blocking non-specific binding by 5% BSA in TBST, the PVDF membranes were cut to size using Amersham Rainbow molecular weight markers as a guide. For proteins with significantly different molecular weights, such as Gαt1 and Gγ1, the membrane was cut in half horizontally into the upper and lower portions, which were stained with individual antibodies. After staining with primary and secondary antibodies, blots were developed using Amersham ECL Prime detection kit. Chemiluminescence was visualized using Li-COR C-DiGit® Blot Scanner that was setup to collect and save time-lapse data in the high-sensitivity mode. Quantitation was performed using Image Studio software. The pixel saturation tool was used to ensure that optical density (OD) of protein bands is not saturated, and only unsaturated bands in a linear range of protein band intensities were used for quantitation. Local background was subtracted.

Light microscopy and immunohistochemistry

For immune labeling, eyes were cryo-preserved in Tissue-Tek O.C.T. compound. Semi-thin 0.9-μm sections were cut in the dorsal-to-ventral direction through the optic nerve and immunostained as previously described [20]. Images were taken on a Leica DM 5500 D microscope using DFC360 FX camera. For the Gαt1 translocation experiment, mice were dark-adapted overnight, their eyes were dilated with one drop of 1% atropine sulfate and then exposed for 15 minutes to steady white background light of various intensities, measured by Sper Scientific Advanced Light Meter 840022, followed by euthanasia by CO2 and eye cryo-preservation. Unsaturated pictures of cross-sections of the retina immunolabelled with anti-Gαt1 antibody were analyzed in Adobe Photoshop CS4 Extended using the analysis module. Integrated density (ID) was measured in the rod outer segment (OS), and combined area of rod inner segment (IS), rod outer nuclear layer (ONL) and outer plexiform layer (OPL) in three independent sections. IDOS+(IDIS+ODONL+ODOPL) was taken as 100% followed by the calculation of the proportion of Gαt1 in OS as IDOS in percent.

In vivo electroretinography (ERG)

Animals were dark-adapted overnight and anesthetized by subcutaneous injection of ketamine (80 mg/kg) and xylazine (15 mg/kg). Pupils were dilated with 1% atropine sulfate. During testing, a heating pad controlled by a rectal temperature probe maintained body temperature at 37–38°C. Full-field ERGs were recorded using a UTAS BigShot apparatus (LKC Technologies) and corneal cup electrodes, as described [21]. The reference electrode needle was inserted under the skin at the skull. Test flashes of white light ranging from 2.5x10-5 cd∙s m-2 to 700 cd∙s m-2 were applied in darkness (scotopic conditions). Responses from several trials were averaged and the intervals between trials were adjusted so that responses did not decrease in amplitude over the series of trials for each step. The recorded responses were low-pass filtered at 500 Hz.

Single-cell suction recordings

Mice were dark-adapted overnight, sacrificed by CO2 asphyxiation, and their retinas were removed under infrared illumination. Retinas were chopped into small pieces with a razor blade and transferred to a perfusion chamber on the stage of an inverted microscope. A single rod outer segment on the edge of a retina piece was drawn into a glass microelectrode filled with solution containing 140 mM NaCl, 3.6 mM KCl, 2.4 mM MgCl2, 1.2 mM CaCl2, 3 mM HEPES (pH 7.4), 0.02 mM EDTA, and 10 mM glucose. The perfusion solution contained 112.5 mM NaCl, 3.6 mM KCl, 2.4 mM MgCl2, 1.2 mM CaCl2, 10 mM HEPES (pH 7.4), 20 mM NaHCO3, 3 mM Na succinate, 0.5 mM Na glutamate, 0.02 mM EDTA, and 10 mM glucose. The solution was bubbled with 95% O2 / 5% CO2 mixture and its temperature was maintained at 37°C with an in-line ceramic heater. Rods were stimulated with 20-ms test flashes of calibrated 500 nm light. The light intensity was controlled with neutral density filters in 0.5 log unit steps. Photoresponses were amplified, low-pass filtered (30 Hz, 8-pole Bessel), and digitized (1 kHz). Data were analyzed using Clampfit 10.6 and Origin 8.5 software. Intensity-response relationships were fitted with Naka-Rushton hyperbolic function: where R is the transient-peak amplitude of the rod response, Rmax is the maximal response amplitude, I is the flash intensity, n is the Hill coefficient (exponent), and I1/2 is the half-saturating light intensity. Normalized rod flash sensitivity (S) was calculated from the linear part of the intensity-response curve, as follows: where R is the amplitude of dim flash response, R is the maximal response amplitude for that cell, and I is the flash strength used to elicit the dim flash response. The amplification of the rod phototransduction cascade was evaluated from test flash intensities that produced identical rising phases of dim flash responses. This approach was preferred to calculation of the amplification constant by the method of Lamb and Pugh [22], due to the relatively long duration of test flashes and the effect of low-pass filtering on the response front. Integration time (Tintegr.) was calculated as the integral of the dim flash response with the transient peak amplitude normalized to unity. The time constant of the dim flash response recovery (τrec) was derived from single-exponential fit to the falling phase of the response. The dominant recovery time constant (τD) was determined from supersaturating flashes [23], using a 10% criterion for recovery of the photocurrent from saturation.

Transretinal ERG recordings

Mice were dark-adapted overnight and sacrificed by CO2 asphyxiation. The whole retina was removed from each mouse eyecup under infrared illumination and stored in oxygenated aqueous L15 (13.6 mg/ml, pH 7.4) solution (Sigma-Aldrich) containing 0.1% BSA, at RT. The retina was mounted on filter paper with the photoreceptor side up and placed in a perfusion chamber [24] between two electrodes connected to a differential amplifier. The tissue was perfused with bicarbonate-buffered Locke’s solution supplemented with 2 mM L-glutamate and 10 μM DL-2-amino-4-phosphonobutyric acid to block postsynaptic components of the photoresponse [25], and with 20 μM BaCl2 to suppress the slow glial PIII component [26]. The perfusion solution was continuously bubbled with a 95% O2 / 5% CO2 mixture and heated to 36–37°C. The photoreceptors in the retina were stimulated with 20-ms test flashes of calibrated 505 nm LED light. The light intensity was controlled by a computer in 0.5 log unit steps. The prolonged (> 1 h) background illumination was achieved with the same 505 nm LED activating ~830 rhodopsin molecules (R*) per rod per second initially. Photoresponses were amplified by a differential amplifier (DP-311, Warner Instruments), low-pass filtered at 30 Hz (8-pole Bessel), and digitized at 1 kHz. Data were analyzed with Clampfit 10.6 and Origin 8.5 software.

Statistical analysis

For all experiments, data were expressed as mean ± SEM and analyzed with the independent two-tailed Student’s t-test (using an accepted significance level of p < 0.05).

Results

Generation of the three transgenic Gγ lines

The transgenic mice were generated using the construct shown in Fig 2. We used the mouse opsin promoter to target the expression of each of the three transgenic Gγ subunits selectively in rod photoreceptors. We also included a 3xFLAG and an HA tag to facilitate detection of the transgenic protein in the retina. Upon the successful generation of the three Gγ1, Gγc, and Gγ11 transgenic strains, we crossed them with the rod Gγ1-deficient (Gngt1) line to effectively substitute the rod Gγ1 with each of the transgenic Gγ subunits. As we have shown previously, deletion of rod Gγ1 in mice results in dramatic suppression of rod sensitivity and reduction in the expression of the other two rod transducin subunits, Gαt1 and Gβ1 [2], see also [3]. Thus, generating GγGngt1, GγGngt1, and GγGngt1 mice allowed us to investigate how the substitution of the endogenous rod Gγ1 subunit with transgenic Gγ1 (as a control), or with Gγc or Gγ11 will affect the Gt expression profile and functional properties of mouse rods. We began our analysis by investigating the expression localization of the Gγ1, Gγc, and Gγ11 γ-subunits in their respective transgenic mouse retinas. To prevent light-driven translocation and ensure that all Gt subunits were properly localized in the outer segments of rods, these experiments were performed after dark-adapting the animals overnight. Using an anti-FLAG antibody staining of retinal sections, we found, as expected, that no transgenic protein was found in wild type or Gngt1 retinas (Fig 3A and 3B). Transgenic Gγ1, Gγc, and Gγ11 subunits were all, indeed, localized in the outer segments of rods (Fig 3C–3E). Thus, in addition to the transgenically reintroduced Gγ1, both cone Gγc and the non-photoreceptor Gγ11 were targeted properly to the rod outer segments following dark adaptation.
Fig 3

Immunohistochemical analysis of the transgenic protein expression using anti-FLAG antibodies (green), with DAPI counterstaining (blue), at P30.

(A) and (B) are also counterstained with wheat germ agglutinin (red) to highlight ROS/RIS. Cryo-sections, 40x. (A) wild type, (B) Gngt1, (C) GγGngt1, (D) GγGngt1, (E) GγGngt1 retinas. ROS–rod outer segments, RIS–rod inner segments, ONL–outer nuclear layer, OPL–outer plexiform layer.

Immunohistochemical analysis of the transgenic protein expression using anti-FLAG antibodies (green), with DAPI counterstaining (blue), at P30.

(A) and (B) are also counterstained with wheat germ agglutinin (red) to highlight ROS/RIS. Cryo-sections, 40x. (A) wild type, (B) Gngt1, (C) GγGngt1, (D) GγGngt1, (E) GγGngt1 retinas. ROS–rod outer segments, RIS–rod inner segments, ONL–outer nuclear layer, OPL–outer plexiform layer. The level of transducin in rod outer segments is directly proportional to the amplification of rod phototransduction [27], making its proper translocation crucial for the function of rods. Our finding that all three transgenic Gγ subunits localized properly to the rod outer segments was critical for enabling us to perform the subsequent physiological analysis of the three transgenic mouse lines and to compare directly their functional properties. Notably, our immunohistochemical analysis also showed that all three transgenic lines retained normal retina morphology and uniform expression of the transgenic proteins in the Gγ1-deficient rods.

Restoration of transducin complement in all Gγ-expressing lines

Quantitative Western blot analysis was performed in the linear portion of the dose escalation plots of the total retina protein vs. optical densities of the protein bands to assure the Western signal is not saturated, typically in the 5–20 μg range. It showed that expression levels of general cellular protein actin and rhodopsin in the retina were comparable in GγGngt1, GγGngt1, and GγGngt1 mice (Fig 4A and 4B), a finding consistent with the normal morphology and lack of degeneration in these retinas (Fig 3). Direct protein expression comparison in Fig 4C used 10 μg of retina protein in each sample. Gγ1, Gγc, and Gγ11 transgenic proteins were easily identified by both anti-FLAG and anti-HA staining (Fig 4C). Expression levels of the three γ-subunits also appeared similar by this test. Gγ1-specific antibodies stained transgenic Gγ1 stronger, compared to the native Gγ1 in WT samples (Fig 4C, bottom), which may be explained either by higher level of transgenic protein whose expression is driven by the strong rhodopsin promoter compared to the Gngt1 promoter in wild type retinas, or possibly by better accessibility of the N-terminal epitope in the transgenic protein. Western blots also showed that expression of each of the transgenic Gγ subunits restores the amounts of Gαt1 to wild type levels (Fig 4C). Restoration of Gαt1 expression in all transgenic lines was also corroborated by the robust staining and proper Gαt1 localization to the rod outer segments in dark adapted retinas, discussed separately in Fig 8. The expression levels of Gβ1 were also recovered (Fig 4C). As expected, all three transgenic retinas expressed equal amounts of the effector protein PDE6, as judged by the similar intensities of protein bands for PDE6α and PDE6γ (Fig 4C). Thus, transgenic retinas appeared to express the full and equal sets of rhodopsin, transducin, and PDE.
Fig 4

Western blot analysis of retina homogenates obtained from indicated transgenic mice.

Representative staining for actin (A) and rhodopsin (B) in samples with progressively increasing amounts of loaded retina homogenate obtained from GγGngt1, GγGngt1, and GγGngt1 mice. Graph shows optical density of Western blot bands against amount of total retina protein (n = 3). Linearity of plots demonstrates sub-saturating ECL signal ensuring direct quantitative comparison. (C) Comparative staining of samples from the GγGngt1, GγGngt1, and GγGngt1 retina homogenates using indicated antibodies against rhodopsin, Gαt1, Gβ1, Gγ1, HA, FLAG, PDEα, and PDEγ subunits.

Fig 8

Translocation of Gαt1-subunit in Gγ transgenic retinas under various background light conditions.

Immunohistochemical analysis of retinas stained with anti-Gαt1 antibody (green) and counterstained with DAPI (blue). Gαt1 distribution in retinas from the GγGngt1 (A), GγGngt1 (B), and GγGngt1 retinas (C). ROS–rod outer segments, RIS–rod inner segments, ONL–outer nuclear layer, OPL–outer plexiform layer. (D) Proportion of Gαt1 in OS vs. IS+ONL+OPL, percent integrated density (n = 3).

Western blot analysis of retina homogenates obtained from indicated transgenic mice.

Representative staining for actin (A) and rhodopsin (B) in samples with progressively increasing amounts of loaded retina homogenate obtained from GγGngt1, GγGngt1, and GγGngt1 mice. Graph shows optical density of Western blot bands against amount of total retina protein (n = 3). Linearity of plots demonstrates sub-saturating ECL signal ensuring direct quantitative comparison. (C) Comparative staining of samples from the GγGngt1, GγGngt1, and GγGngt1 retina homogenates using indicated antibodies against rhodopsin, Gαt1, Gβ1, Gγ1, HA, FLAG, PDEα, and PDEγ subunits.

Restoration of scotopic visual function in all Gγ-expressing lines

To determine how the expression of each of the three Gγ-subunits affects the functional properties of rods, we first performed electroretinography (ERG) analysis of control wild type and Gngt1 mice and the transgenic GγGngt1, GγGngt1, and GγGngt1 mice in vivo (Fig 5A–5E). As we have previously shown [2], deletion of the rod Gγ1-subunit results in substantial desensitization and reduction in the maximal ERG a-wave response (Fig 5F, open light grey circles). Notably, expression of Gγ1, Gγc, or Gγ11 in the Gngt1 mice (Fig 5F, filled circles) all restored robust scotopic function essentially to the wild type level (Fig 5F, open black circles; see also [28] for the reference to wild type data). Thus, not only did the transgenic expression of Gγ1 rescue scotopic vision in the Gγ1-deficient mice, but the same effect could be achieved by expressing the cone Gγc or the non-photoreceptor Gγ11.
Fig 5

Families of in vivo ERG responses from wild type (A), Gngt1-/- (B), GγGngt1 (C), GγGngt1 (D), and GγGngt1 (E) mice. Waveforms are color coded according to the white flash of indicated intensity. (E) Averaged scotopic in vivo ERG intensity-response functions (mean ± SEM) for wild type (n = 3), Gngt1-/- (n = 3), GγGngt1 (n = 3), GγGngt1 (n = 3), and GγGngt1 (n = 3) mouse lines.

Families of in vivo ERG responses from wild type (A), Gngt1-/- (B), GγGngt1 (C), GγGngt1 (D), and GγGngt1 (E) mice. Waveforms are color coded according to the white flash of indicated intensity. (E) Averaged scotopic in vivo ERG intensity-response functions (mean ± SEM) for wild type (n = 3), Gngt1-/- (n = 3), GγGngt1 (n = 3), GγGngt1 (n = 3), and GγGngt1 (n = 3) mouse lines.

Restoration of rod photosensitivity and response kinetics in all Gγ-expressing lines

Next, we analyzed by suction electrode recordings whether the transgenic expression of the three different Gγ-subunits in individual Gngt1 mouse rods would restore their photosensitivity and response kinetics. In agreement with the similar length of their outer segments at the age of 4–5 weeks (Fig 2) and normal ERG responses in vivo (Fig 5), GγGngt1, GγGngt1, and GγGngt1 rods produced saturated responses of similar amplitudes, not different from these in wild type and Gngt1 cells (Fig 6A–6F and Table 1). Remarkably, compared to the dramatically desensitized (~70-fold) Gγ1-deficient rods, the light sensitivity of all transgenic photoreceptors was restored to wild type levels (Fig 6F). It should be noted, however, that the average sensitivity of GγGngt1 rods was slightly (~20%) higher than that in the other two Gγ-expressing lines (Table 1).
Fig 6

Light responses of rods in control and transgenic mouse lines expressing different Gγ-subunits.

(A–E) Representative families of flash responses from 4–5-week-old control Gngt1-/- (A), GγGngt1 (B), GγGngt1 (C), GγGngt1 (D), and wild type (E) mouse rods. Test flashes of 500 nm light with intensities of 160, 560, 1.8x103, 5.8x103, 1.8x104, 5.1x104, and 1.6x105 photons μm-2 (for Gngt1 rods) or 2, 6, 19, 50, 160, 560, 1.8x103, and 5.8x103 photons μm-2 (for wild type and all transgenic rods) were delivered at time 0. Red traces show responses to identical light intensity (560 photons μm-2). (F) Averaged intensity-response relationships (mean ± SEM) for Gngt1-/- (n = 11), GγGngt1 (n = 31), GγGngt1 (n = 30), GγGngt1 (n = 24), and wild type (n = 8) mouse rods. Data were fitted with hyperbolic Naka-Rushton functions that yielded half-saturating light intensities (I1/2) indicated in Table 1. Error bars are smaller than the symbol size for most data points.

Table 1

Parameters of single-cell responses from dark-adapted mouse rods.

Response parameterGngt1-/- (n = 11)1+Gngt1-/- (n = 31)c+Gngt1-/- (n = 30)11+Gngt1-/- (n = 24)WT (n = 8)
Rmax (pA)13.2 ± 0.6 NS14.1 ± 0.3 NS13.5 ± 0.3 NS13.2 ± 0.3 NS14.0 ± 0.4
Tpeak (ms)108 ± 6 ***153 ± 4 NS162 ± 5 NS152 ± 3 NS157 ± 5
Tintegr. (ms)177 ± 18 ***286 ± 17 NS290 ± 15 NS278 ± 17 NS297 ± 19
Sf (μm2 ph-1)1.7x10-4 ± 2.0x10-5 ***1.6x10-2 ± 8.9x10-4 NS1.6x10-2 ± 1.1x10-3 NS1.7x10-2 ± 1.2x10-3 NS1.7x10-2 ± 1.0x10-3
I1/2 (ph μm-2)3007 ± 308 ***45 ± 2 NS46 ± 3 NS38 ± 2 NS40 ± 3
τrec (ms)146 ± 13 **223 ± 16 NS214 ± 14 NS226 ± 16 NS236 ± 13
τD (ms)162 ± 15 ***207 ± 11 **240 ± 15 *301 ± 16 NS324 ± 17

Rmax, maximal dark current measured from saturated responses; time-to-peak (Tpeak), integration time (Tintegr.), and normalized flash sensitivity (Sf) refer to responses whose amplitudes were ∼0.2∙Rmax and fell within the linear range; I1/2, half-saturating light intensity; τrec, time constant of single-exponential decay of the dim flash response recovery phase; τD, dominant time constant of recovery after supersaturating flashes determined from the linear fit to time in saturation vs. intensity semilog (Pepperberg) plots [23]. Data are presented as mean ± SEM. Student’s t-test, NS (not significant) indicates p > 0.05

* indicates p < 0.05

** indicates p < 0.01

*** indicates p < 0.001, all compared to wild type values.

Light responses of rods in control and transgenic mouse lines expressing different Gγ-subunits.

(A–E) Representative families of flash responses from 4–5-week-old control Gngt1-/- (A), GγGngt1 (B), GγGngt1 (C), GγGngt1 (D), and wild type (E) mouse rods. Test flashes of 500 nm light with intensities of 160, 560, 1.8x103, 5.8x103, 1.8x104, 5.1x104, and 1.6x105 photons μm-2 (for Gngt1 rods) or 2, 6, 19, 50, 160, 560, 1.8x103, and 5.8x103 photons μm-2 (for wild type and all transgenic rods) were delivered at time 0. Red traces show responses to identical light intensity (560 photons μm-2). (F) Averaged intensity-response relationships (mean ± SEM) for Gngt1-/- (n = 11), GγGngt1 (n = 31), GγGngt1 (n = 30), GγGngt1 (n = 24), and wild type (n = 8) mouse rods. Data were fitted with hyperbolic Naka-Rushton functions that yielded half-saturating light intensities (I1/2) indicated in Table 1. Error bars are smaller than the symbol size for most data points. Rmax, maximal dark current measured from saturated responses; time-to-peak (Tpeak), integration time (Tintegr.), and normalized flash sensitivity (Sf) refer to responses whose amplitudes were ∼0.2∙Rmax and fell within the linear range; I1/2, half-saturating light intensity; τrec, time constant of single-exponential decay of the dim flash response recovery phase; τD, dominant time constant of recovery after supersaturating flashes determined from the linear fit to time in saturation vs. intensity semilog (Pepperberg) plots [23]. Data are presented as mean ± SEM. Student’s t-test, NS (not significant) indicates p > 0.05 * indicates p < 0.05 ** indicates p < 0.01 *** indicates p < 0.001, all compared to wild type values. We then evaluated the kinetics of activation of the rod phototransduction cascade in all three mutant mouse strains by directly comparing the light intensities required to produce identical initial phases of response activation (Fig 7A). In accordance with their restored sensitivity, the phototransduction amplification in GγGngt1 rods was increased by ~34-fold compared to that in cells lacking Gγ1 and reached wild type level, as evident from the analysis of rising phases of their dim flash responses during the first 40 ms after the test flash. The cascade activation was only slightly (~10%) lower in GγGngt1 rods and higher (by ~10%) in GγGngt1 cells than in the Gγ1-expressing transgenic rods, thus showing a comparable degree of restoration in all three transgenic lines.
Fig 7

Activation and inactivation of rod phototransduction cascade in control and transgenic mice expressing different Gγ subunits.

(A) Amplification of phototransduction in mouse rods. Dim flash responses (to light intensities of 560 photons μm-2 for Gngt1-/- rods and 6 photons μm-2 for wild type and all transgenic Gγ-expressing rods) were normalized to maximum dark currents (Rmax) of the respective cells and population-averaged (mean ± SEM). Then, the Gngt1-/-, GγGngt1, and GγGngt1 responses were scaled to make their initial rising phase to coincide with that of the wild type response. Correspondingly scaled light intensities were 0.03:1:0.9:1.1:1 (Gngt1:GγGngt1-/-:GγGngt1:GγGngt1:WT), indicating ~30-fold higher gain in the Gγ-expressing rods. (B) Phototransduction shutoff in mouse rods. Dim flash responses (to light intensities of 560 photons μm-2 for control Gngt1-/- rods and 6 photons μm-2 for wild type and all Gγ-expressing rods) were normalized to their own maximums and population-averaged (mean ± SEM). (C) Supersaturated responses (to light intensities of 1.6x105 photons μm-2 for control Gngt1-/- rods and 5.8x103 photons μm-2 for wild type and all Gγ-expressing rods) were normalized to their amplitudes (Rmax) and population-averaged (mean ± SEM). (D) Determination of the dominant recovery time constant (τD) from a series of supersaturating flashes for Gngt1-/- (n = 11), GγGngt1 (n = 31), GγGngt1 (n = 30), GγGngt1 (n = 23), and wild type (n = 8) mouse rods. Linear fits yielded τD-values indicated in Table 1. Values are means ± SEM (smaller than the symbol size for some data points).

Activation and inactivation of rod phototransduction cascade in control and transgenic mice expressing different Gγ subunits.

(A) Amplification of phototransduction in mouse rods. Dim flash responses (to light intensities of 560 photons μm-2 for Gngt1-/- rods and 6 photons μm-2 for wild type and all transgenic Gγ-expressing rods) were normalized to maximum dark currents (Rmax) of the respective cells and population-averaged (mean ± SEM). Then, the Gngt1-/-, GγGngt1, and GγGngt1 responses were scaled to make their initial rising phase to coincide with that of the wild type response. Correspondingly scaled light intensities were 0.03:1:0.9:1.1:1 (Gngt1:GγGngt1-/-:GγGngt1:GγGngt1:WT), indicating ~30-fold higher gain in the Gγ-expressing rods. (B) Phototransduction shutoff in mouse rods. Dim flash responses (to light intensities of 560 photons μm-2 for control Gngt1-/- rods and 6 photons μm-2 for wild type and all Gγ-expressing rods) were normalized to their own maximums and population-averaged (mean ± SEM). (C) Supersaturated responses (to light intensities of 1.6x105 photons μm-2 for control Gngt1-/- rods and 5.8x103 photons μm-2 for wild type and all Gγ-expressing rods) were normalized to their amplitudes (Rmax) and population-averaged (mean ± SEM). (D) Determination of the dominant recovery time constant (τD) from a series of supersaturating flashes for Gngt1-/- (n = 11), GγGngt1 (n = 31), GγGngt1 (n = 30), GγGngt1 (n = 23), and wild type (n = 8) mouse rods. Linear fits yielded τD-values indicated in Table 1. Values are means ± SEM (smaller than the symbol size for some data points). One characteristic feature of Gngt1 rods is the significantly faster inactivation of their signaling cascade, an effect contributing to their reduced photosensitivity [2]. In contrast, normal inactivation rate of dim flash responses was achieved in the rods of all transgenic lines expressing a Gγ-subunit, as judged from their normal time-to-peak, integration time, and single-exponential dim flash response recovery time constant (τrec) (Fig 7B and Table 1). Coincidentally, the response recovery following supersaturating flashes was also slower in all transgenic lines than in Gγ1-deficient controls, as evident from comparing the kinetics of their maximal rod responses (Fig 7C) and the corresponding dominant recovery time constants (τD) (Fig 7D and Table 1). All these parameters were also comparable to those typically observed in wild type mouse rods (Table 1 and [2]). It should be mentioned that the rods expressing Gγ11 had the slowest τD among all transgenic cells (Table 1) although the molecular mechanisms behind their slight response deceleration remain unclear. Taken together, these results indicate that the transgenic expression of various G-protein γ-subunits with distinct amino acid sequences rescues equally well the expression level of rod transducin α-subunit in Gγ1-deficient mouse rods and effectively restores their signaling, although with slightly different photoresponse kinetics.

Light-driven translocation of Gtα1 in Gγ-expressing rods

Finally, we investigated how the expression of each of the three transgenic Gγ subunits in rods affects the light-driven translocation of Gαt1 from the outer segment to the inner segment of these photoreceptors. We examined the distribution of Gαt1 across the rods in 5 different background light conditions: darkness and at 1, 10, 100, and 1000 lux of steady background illumination. To allow translocation to occur, dark-adapted animals were exposed to the background light for 15 minutes, and then were rapidly euthanized and their eyes were dissected, cryo-preserved, sectioned, and stained with the Gαt1 antibody for immunohistochemical analysis of its distribution. Consistent with the localization of the transgenic Gγ1, Gγc, and Gγ11 subunits to the outer segments of rods in dark-adapted retinas (Fig 3), we found that Gαt1 was also properly localized in the rod outer segments in darkness (0 lux; Fig 8A–8C, left panels, and 8D). In GγGngt1 and GγGngt1 mice, approximately 90% of Gtαt1 remained in the outer segments in dim background illumination of 1 and 10 lux, and eventually translocated to the inner segments when the retinas were illuminated with 100 and 1000 lux of light (Fig 8A and 8B, right two panels). This is qualitatively consistent with previous work showing that in wild type mouse rods the threshold for transducin translocation is near 4.6x103 R* rod-1 s-1 [29], and indistinguishable from the Gtαt1 translocation in wild type and Gngt1 retinas under identical conditions. The Gngt1 control contains one Gngt1-wild type copy and one Gngt1 copy and could be used as a closer genetic match for GγGngt1 containing one copy of the Gngt1 transgene and two Gngt1 copies. In contrast, translocation of Gαt1 in GγGngt1 retinas was triggered with illumination as low as 1 lux (Fig 8C and 8D, blue circles). At 1 lux, only 10% of Gαt1 remained in the outer segments of the GγGngt1 retinas compared to 90% for the other two Gγ transgenes in respective lines (Fig 8D). The highly robust Gαt1 staining in the outer nuclear layer that is evident at 100 and 1000 lux in the GγGngt1 retinas is typically observed in wild type and Gngt1 controls only at background illumination levels above 1000 lux. Thus, surprisingly, despite the essentially identical functional properties of dark-adapted rods expressing the three transgenic Gγ subunits, translocation of transducin during continuous light exposure was initiated at substantially lower light intensity in transgenic Gγ11 rods compared to transgenic Gγ1 or Gγc cells.

Translocation of Gαt1-subunit in Gγ transgenic retinas under various background light conditions.

Immunohistochemical analysis of retinas stained with anti-Gαt1 antibody (green) and counterstained with DAPI (blue). Gαt1 distribution in retinas from the GγGngt1 (A), GγGngt1 (B), and GγGngt1 retinas (C). ROS–rod outer segments, RIS–rod inner segments, ONL–outer nuclear layer, OPL–outer plexiform layer. (D) Proportion of Gαt1 in OS vs. IS+ONL+OPL, percent integrated density (n = 3). It was recently shown that the gradual translocation of transducin from the outer to the inner segments of rods under continuous illumination results in partial recovery of the rod response after its initial suppression by the background light [30]. Thus, we sought to determine whether the lower threshold for Gαt1 translocation found in GγGngt1 retinas affects the amplitude of the rod response over the course of 1-h exposure to background light. We used transretinal (ex vivo ERG) recordings to obtain and monitor the rod-driven responses. We exposed control Gngt1 and transgenic GγGngt1 retinas to a moderate sub-saturating background light activating ~830 visual pigment molecules (R*) per rod per second at onset. This light would be expected to trigger transducin translocation in Gγ11 transgenic retinas but not in control retinas (Fig 8, see also [29]). As expected, in control retinas, the onset of the background light caused a rapid partial suppression of the rod maximal response (Fig 9, black symbols), which then persisted largely unchanged for the 60-min duration of the experiment, only slightly affected by a gradual rundown. The onset of an identical background light in GγGngt1 retinas produced comparable initial suppression of the rod maximal response. However, in stark contrast to the control case, the rod response then gradually recovered over the course of the 60 min of the experiment (Fig 9, blue symbols). As recently argued, this gradual increase reflects the translocation of Gαt1 away from the rod outer segments, which would effectively reduce the activation of the rod phototransduction by the steady background light, allowing the rods to recover partially their dark current [30]. Thus, the gradual recovery of rod responses in transgenic GγGngt1 retinas but not in control retinas in moderate background light is consistent with our observation that in these conditions transducin translocation takes place only in the transgenic GγGngt1 rods but not in controls (Fig 8).
Fig 9

Changes of rod-driven maximal ex vivo transretinal ERG responses in control (Gngt1) (n = 4) and transgenic Gγ11+Gngt1 (n = 4) retinas.

Retinas were exposed to prolonged moderate non-saturating 505-nm background light activating ~830 visual pigment molecules (R*) per rod per second initially. All maximal responses were normalized to corresponding dark-adapted response amplitudes (ADAmax) and population-averaged. The onset and duration of background light are shown in green.

Changes of rod-driven maximal ex vivo transretinal ERG responses in control (Gngt1) (n = 4) and transgenic Gγ11+Gngt1 (n = 4) retinas.

Retinas were exposed to prolonged moderate non-saturating 505-nm background light activating ~830 visual pigment molecules (R*) per rod per second initially. All maximal responses were normalized to corresponding dark-adapted response amplitudes (ADAmax) and population-averaged. The onset and duration of background light are shown in green.

Discussion

Heterotrimeric G-proteins are the main transducers and amplifiers of extracellular signals from GPCRs to the intracellular effectors. It is now firmly established that specificity of the GPCR signaling and fine-tuning of the resulting physiological responses are regulated by the diversity of the Gα subunits, comprised of sixteen family members subdivided into four sub-families (Gs, Gi/o, Gq/11, and G12/13), as well as by multiple combinations of five Gβ (Gβ1–5) and twelve Gγ (Gγ1–13) subunits. In many cell types containing various G-protein combinations, their interplay contributes to the rich gamut of cellular responses with defined spatio-temporal characteristics. Retinal rod and cone photoreceptors provide a fascinating example of highly specialized sensory neurons that, while employing similar signaling architecture, differ drastically in their light sensitivity, photoresponse kinetics, and light adaptation properties. Being on the other side of the spectrum from a typical cell that contains multiple G-protein types, rods and cones rely on conserved cell-specific G-protein heterotrimers: Gαt1/Gβ1γ1 and Gαt2/Gβ3γc, respectively [31]. While trace expression levels of Gγ2 and Gγ3 subunits were detected in rods, their physiological contribution in phototransduction is negligible [32]. This property makes rods a unique model system to study the physiological roles of G-protein subunits in visual transduction by substituting individual rod-specific G-protein subunits with their cone-specific or ubiquitous isoforms. This experimental design was successful to show that when Gαt1 was replaced by Gαt2 in rods, while retaining native rod Gβ1γ1 complex, the phototransduction was largely unaffected [5-7]. To determine the physiological role of Gβγ in photoreceptor function, we previously genetically removed the gene Gngt1 encoding rod Gγ1 subunit and demonstrated that the high light sensitivity of rods and their robust signal amplification are severely compromised in mice [2]. The Gngt1 model provided an excellent starting point to pose the next question of the possible physiological difference between various Gγ isoforms. Specifically, what is the reason for the selective use of Gγ1 and Gγc in rods and cones, respectively, and the exclusion of otherwise ubiquitously expressed Gγ11 from both photoreceptor types? This question is especially intriguing considering the fact that these three Gγ proteins belong to the same Class I Gγ subunits that are post-translationally modified by the shorter isoprenoid lipid farnesyl, as opposed to class II-IV Gγ subunits that are geranylgeranylated [33]. Farnesylation is required for proper targeting of G-proteins to the outer segment and full biological activity [34, 35]. Thus, replacing native rod Gγ1 with cone Gγc or Gγ11 subunit ensures highly controlled experimental conditions not affected by the Gγ class or isoprenylation differences. Here, we generated three individual transgenic mouse lines expressing Gγc, Gγ11, and control Gγ1 on the Gngt1 background (Fig 2). Immunohistochemical staining of retina cross-sections for the FLAG epitope that was included in all transgenic constructs showed similarly healthy retina morphology, uniform expression of these Gγ proteins and their proper targeting to the rod outer segments (Fig 3). The levels of expression of other major phototransduction proteins, such as rhodopsin, transducin subunits, and PDE were identical between the experimental and control retinas (Fig 4). Transgenic re-introduction of Gγ1, Gγc, or Gγ11 also completely restored the levels of endogenous Gαt1 (Fig 4) that is known to be severely reduced by the deletion of native Gγ1 [2, 3]. This result is of particular importance because signal amplification in mammalian rods is directly proportional to the level of expression of their Gαt1 subunit [27]. Thus, morphological and protein expression data argue that rods from the Gγ1, Gγc, and Gγ11 transgenic lines are indistinguishable in their structure and protein complement. Because Gβγ complexes function natively as inseparable heterodimers, the deletion of Gγ1 in rods is expected to lead to accumulation of misfolded Gβ1 protein. Slow progressive retinal degeneration in the Gγ1 deficient mice was proposed to be the result of proteostatic stress, or inability of the rod cell ubiquitin-proteasome system to degrade un-complexed Gβ1 protein effectively [36-39]. Expression of Gγ1, Gγc, and Gγ11 in the Gγ1 deficient mice appears to rescue the retina degeneration phenotype independent of the type of the Gγ subunit, which argues for the productive complex formation of Gβ1γ1, Gβ1γc, and Gβ1γ11 dimers and confirms previous biochemical results [40]. In addition, equal levels of the Gαt1 expression in transgenic retinas (Fig 4) and effective delivery of Gαt1 to the rod outer segments under dark adapted conditions (Fig 8) are consistent with normal heterotrimer formation and its proper subcellular localization. There is a growing body of evidence that Gβγ-complexes contribute to the complexity and diversity of GPCR-mediated signaling that is shaped by specificity and response kinetics of GPCR/G-protein interactions at the plasma membrane, via direct interactions with effector molecules, as well as by acting at distant sites such as intracellular organelles [40, 41]. Thus, we examined whether Class I Gγ1, Gγc, and Gγ11 modified by posttranslational farnesylation (Fig 1) would restore scotopic visual function, and to what extent they would determine rod photosensitivity and response kinetics. This question is especially intriguing while comparing and contrasting rod Gγ1 and cone Gγc, as retinal rods respond to light at significantly lower light levels compared to cones, and rod response kinetics are markedly slower [42]. The results from our in vivo ERG experiments and single-cell suction electrode recordings conclusively demonstrate that despite minor variations, all three Class I Gγ subunits can support essentially normal scotopic rod photoresponses (Figs 5–7). Thus, the differences in Gγ composition between rods and cones cannot explain their unique activation properties in dark-adapted conditions. This also implies that Gγ involvement in the activation properties of photoreceptors per se has unlikely contributed to the evolutionary selection of Gγ1 for rods, Gγc for cones, and Gγ11 for other tissues. The physiological features determining selective expression of Gγ1 and Gγc in rods and cones is still to be determined. Our results mirror a previous observation obtained by replacing rod Gαt1 by cone Gαt2 that these two Gαt isoforms are functionally interchangeable [5]. Knowing that neither Gαt2 nor Gγc makes the rod cascade activation cone-like, it remains quite possible that unique properties of cone phototransduction are determined by the Gγc counterpart Gβ3 as part of the unique cone Gβ3γc complex, as deletion of Gβ3 alone in cones doesn’t affect cone response kinetics [43]. Alternatively, differences in upstream and downstream phototransduction components [44-46], as well as structural differences between rods and cones could account for their unique functional characteristics. In stark contrast to the functional interchangeability of Gγ1, Gγc, and Gγ11 in dark-adapted rod phototransduction, we observed a significant effect by the Gγ composition on the cell responsiveness in steady background light. Upon increasing the intensity of background illumination rod responses saturate quickly, the process accompanied by massive light-driven translocation of Gαt1 from the rod outer to the rod inner segment [27]. While Gαt1 translocation was similar in Gγ1 and Gγc transgenic retinas, substitution of Gγ1 with Gγ11 shifted the light threshold that triggers translocation to lower background light intensity by 2–3 orders of magnitude (Fig 8). We observed that transducin in Gγ11 transgenic rods began to translocate at a light intensity of just 1 Lux, while Gγ1 and Gγc transgenic rods were still deeply dark-adapted. This remarkable effect had profound implications on rod function, as only Gγ11 transgenic rods recovered their response amplitudes under a moderate steady background light, as observed in our transretinal ERG recordings (Fig 9). While Gγ11 is normally excluded from rods and cones [15], and thus transducin heterotrimer Gαt1Gβ1γ11 is likely not physiologically relevant, our results clearly demonstrate that in principle, the type of Gγ isoform can have significant implications for light adaptation and the kinetics of photoreceptors’ escape from physiological saturation. Because Gγ1, Gγc, and Gγ11 belong to the same class of farnesylated Gγ subunits, the observed effect must be attributed to the unique amino acid sequence of Gγ11 (Fig 1). Interestingly, a previous study utilizing the knock-in of the geranylgeranylated mutant of Gγ1 demonstrated normal photoresponses but impaired photoresponse recovery caused by the stronger interaction of the mutant protein with lipid membranes and compromised light-driven translocation of Gt [47], a predictably opposite effect to what we observed with Gγ11. Similarly, a recent study with mutant Gαt1 that associates more strongly with Gβ1γ1 and as a result does not translocate efficiently in comparable background light, showed a suppressed recovery of the rod dark current under those conditions [30]. In the context of these findings, our results suggest that Gαt1 associates more weekly with Gβ1γ11 than with the endogenous Gβ1γ1, causing easier dissociation and translocation upon light exposure. This conclusion is also supported by the comprehensive biochemical analysis of the heterotrimeric G-protein complex formation that demonstrated significantly weaker association of Gβ1γ11 compared to Gβ1γ1 with Gαi1, a close relative of Gαt1 [48]. Taken together, it appears that the Gγ-subunit amino acid sequence and the prenylation identity contribute to the unique physiological properties of rod photoreceptors under continuous illumination.

Conclusion

By replacing the native Gγ1 subunit in mouse rod photoreceptors with cone-specific Gγc or ubiquitous Gγ11 isoforms, we examined the contribution of Gγ to the unique physiological properties of rods. Our results unequivocally show that while Class I Gγ subunits are functionally interchangeable in rod phototransduction, they control the light threshold for transducin translocation and the physiological light adaptation properties of rods.

Annotated Western blot images.

(TIF) Click here for additional data file.
  46 in total

1.  Breaking the covalent bond--a pigment property that contributes to desensitization in cones.

Authors:  Vladimir J Kefalov; Maureen E Estevez; Massahiro Kono; Patrice W Goletz; Rosalie K Crouch; M Carter Cornwall; King-Wai Yau
Journal:  Neuron       Date:  2005-06-16       Impact factor: 17.173

2.  Light responses and light adaptation in rat retinal rods at different temperatures.

Authors:  S Nymark; H Heikkinen; C Haldin; K Donner; A Koskelainen
Journal:  J Physiol       Date:  2005-07-21       Impact factor: 5.182

3.  Tissue-specific and developmental regulation of rod opsin chimeric genes in transgenic mice.

Authors:  J Lem; M L Applebury; J D Falk; J G Flannery; M I Simon
Journal:  Neuron       Date:  1991-02       Impact factor: 17.173

Review 4.  Structural determinants involved in the formation and activation of G protein betagamma dimers.

Authors:  William E McIntire
Journal:  Neurosignals       Date:  2009-02-12

Review 5.  Rod and cone photoreceptors: molecular basis of the difference in their physiology.

Authors:  Satoru Kawamura; Shuji Tachibanaki
Journal:  Comp Biochem Physiol A Mol Integr Physiol       Date:  2008-04-26       Impact factor: 2.320

Review 6.  The G-protein betagamma complex.

Authors:  N Gautam; G B Downes; K Yan; O Kisselev
Journal:  Cell Signal       Date:  1998-07       Impact factor: 4.315

7.  Studies on the mass receptor potential of the isolated frog retina. I. General properties of the response.

Authors:  A J Sillman; H Ito; T Tomita
Journal:  Vision Res       Date:  1969-12       Impact factor: 1.886

8.  Transducin translocation in rods is triggered by saturation of the GTPase-activating complex.

Authors:  Ekaterina S Lobanova; Stella Finkelstein; Hongman Song; Stephen H Tsang; Ching-Kang Chen; Maxim Sokolov; Nikolai P Skiba; Vadim Y Arshavsky
Journal:  J Neurosci       Date:  2007-01-31       Impact factor: 6.167

9.  Replacing the rod with the cone transducin subunit decreases sensitivity and accelerates response decay.

Authors:  C-K Chen; M L Woodruff; F S Chen; H Shim; M C Cilluffo; G L Fain
Journal:  J Physiol       Date:  2010-07-05       Impact factor: 5.182

10.  Comparative analysis of cone and rod transducins using chimeric Gα subunits.

Authors:  Kota N Gopalakrishna; Kimberly K Boyd; Nikolai O Artemyev
Journal:  Biochemistry       Date:  2012-02-16       Impact factor: 3.162

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.