Literature DB >> 35905095

The selenoprotein P 3' untranslated region is an RNA binding protein platform that fine tunes selenocysteine incorporation.

Sumangala P Shetty1, Nora T Kiledjian1, Paul R Copeland1.   

Abstract

Selenoproteins contain the 21st amino acid, selenocysteine (Sec), which is incorporated at select UGA codons when a specialized hairpin sequence, the Sec insertion sequence (SECIS) element, is present in the 3' UTR. Aside from the SECIS, selenoprotein mRNA 3' UTRs are not conserved between different selenoproteins within a species. In contrast, the 3'-UTR of a given selenoprotein is often conserved across species, which supports the hypothesis that cis-acting elements in the 3'-UTR other than the SECIS exert post-transcriptional control on selenoprotein expression. In order to determine the function of one such SECIS context, we chose to focus on the plasma selenoprotein, SELENOP, which is required to maintain selenium homeostasis as a selenium transport protein that contains 10 Sec residues. It is unique in that its mRNA contains two SECIS elements in the context of a highly conserved 843-nucleotide 3' UTR. Here we have used RNA affinity chromatography and identified PTBP1 as the major RNA binding protein that specifically interacts with the sequence between the two SECIS elements. We then used CRISPR/Cas9 genome editing to delete two regions surrounding the first SECIS element. We found that these sequences are involved in regulating SELENOP mRNA and protein levels, which are inversely altered as a function of selenium concentrations.

Entities:  

Mesh:

Substances:

Year:  2022        PMID: 35905095      PMCID: PMC9337670          DOI: 10.1371/journal.pone.0271453

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.752


Introduction

The role of untranslated regions (UTRs) in post transcriptional gene regulation is well established. A pointed example of this is the requirement for a specific 3’ UTR sequence that directs selenocysteine (Sec) incorporation. Sec is incorporated into specific sites within 25 human proteins at specific UGA codons, which would otherwise signal translation termination. Sec incorporation requires a stem-loop structure in the 3‘ UTRs of mammalian selenoprotein mRNAs known as a Sec insertion sequence (SECIS) element. While the SECIS element is known to be necessary and sufficient for Sec incorporation, albeit with varying efficiency [1], the role of surrounding sequences in the extremely diverse array of selenoprotein 3’ UTRs has only recently been the subject of investigation. For example, the sequence upstream of the selenoprotein S (SELENOS) SECIS element regulates Sec incorporation via two adjacent but non-overlapping sequences that both positively and negatively impact Sec incorporation efficiency [2]. In terms of cellular context, SELENOS mRNA levels have been reported to change in response to cytokines [3], but a connection to modulation of Sec incorporation by regulatory sequences in the 3’ UTR has not yet been made. The potential for other examples of regulation is substantial considering that the size of selenoprotein mRNA 3’ UTRs range from ~300 to ~6000 nt [4]. All but one of the human selenoproteins contain one or two Sec codons in their coding region, and a single SECIS element in their 3’ UTRs. The exception to this is selenoprotein P (SELENOP), which in humans contains 10 Sec codons and 2 SECIS elements in the 3’ UTR. The two SECIS elements sit in the context of 843 nt of well-conserved sequence. As such, SELENOP provides a unique example to study the role of non-SECIS 3’ UTR sequences. As a hepatokine regulator of whole body selenium, SELENOP mRNA and protein levels are regulated by a multitude of physiological conditions including insulin levels, exercise and, of course, selenium availability [reviewed in 5]. Since SELENOP supports general selenoprotein synthesis by delivering selenium to the extrahepatic tissues, it is a key player in maintaining cellular selenium homeostasis and redox balance through the myriad of selenoenzymes that resolve oxidative stress. In addition, SELENOP itself has a thioredoxin motif that may directly be involved in maintaining redox balance [6]. Several previous studies have analyzed the effects of deletions in the SELENOP 3’ UTR but only in the context of transfected cells or in vitro translation, and no function could be ascribed to the non-SECIS portions of the UTR [7-9]. To date, no studies have revealed a specific role of 3’ UTR sequences in mediating regulation. Using RNA affinity chromatography, we have identified the polypyrimidine tract-binding protein (PTBP1) as one of several RNA binding proteins that interacts specifically with conserved regions of the SELENOP 3’ UTR. Coupling genomic mutagenesis, UV crosslinking and metabolic labeling with 75Se, we found that these regions are required for moderating SELENOP expression in response to varying selenium concentration and oxidative stress.

Material and methods

CRISPR/Cas9 genome editing

Two guide RNAs against the interSECIS region of SELENOP 3’ UTR (Table 1) were synthesized and cloned separately into pSpCas9(BB)-2A-Puro (PX459) V2.0 [10]. This vector was a gift from Feng Zhang (Addgene plasmid # 62988; http://n2t.net/addgene:62988; RRID:Addgene_62988). HepG2 cells were grown to 75% confluence in 10%FBS. 2.5 μg each of plasmid DNAs harboring the SELENOP targeting sgRNAs were electroporated using the Amaxa 4D Nucleofector protocol for HepG2 cells. The pmaxGFP plasmid (0.15 μg) was co-transfected to allow calculation of electroporation efficiency. After 48 hours, GFP positive (top 3%) cells were sorted as single cells into a 96 well plate containing 50% HepG2 conditioned media/ 50% DMEM F12 with 10% fetal bovine serum. The single cell clones were grown for 3 weeks and then split and screened for deletions by 75Se-selenite labeling. The genome editing was confirmed using genomic DNA PCR with Herculase II enzyme.
Table 1

Oligonucleotide sequences used in this study.

Δpre sgRNA 5’ ATTGTGTCTAGACTAAATTG
Δpre sgRNA 3’ TTTATGATGGAGCAACTGAA
Δinter sgRNA 5’ GAGATAAGTAAAGAAAAAAA
Δinter sgRNA 3’ GCTGTCTTAAAAGATATAAG
SELENOP qPCR Fwd CTAGGAGCTGATGCTGCCATT
SELENOP qPCR Rev GGTGATTGCAGACCCTGTTTTT
Actin qPCR Fwd GCGCGGCTACAGCTTCA
Actin qPCR Rev CTTAATGTCACGCACGATTTCC
Genomic PCR Primer Fwd ATATTTAAAATAGGACATACTCCCC
Genomic PCR Primer Rev CAGCTTTAAGGTTTTTATTGAATTTATTTG
MS2 sequence CTCGAGACTAGTAGATCTTTTTTTACTAGTAGATCTTTTTTTGATGAGGATTACCCATCACTAGTAGATCTTTTTTTGATGAGGATTACCCATCACTAGTAGATCTTTTTTTACTAGTAGATCTTTTTTTGATGAGGATTACCCATCACTAGTAGATCTTTTTTTACTAGTAGATCTTTTTTTCTCGAG
RNA-IP Fwd CAACTGAAAGGTGATTGCAGCTTTTGGT
RNA-IP Rev AGGAGGTCAGGTTTATAGGGTTTGGTT TACC

75Se labeling and oxidative stress

Cells were grown to 80% confluence and then switched to serum free media supplemented with 100 nM 75Se-selenite (Research Reactor Center, University of Missouri, Columbia). After 12 hours, the media were collected and centrifuged at 2500 x g for five minutes at 4°C. The top 80% of the centrifuged media were transferred into a new tube. 1.5% of the total centrifuged media were used for analysis by 12% SDS-PAGE. The adhered cells were then gently washed with cold PBS and lysed in 1% NP-40 lysis buffer (50mM Tris-HCl pH 8.0, 150 mM sodium chloride, 1% NP-40, Roche Complete protease inhibitor). The lysate was then cleared by centrifugation at 17,000 x g for 10 min at 4°C. For oxidative stress, 75Se-selenite was added 24 hours prior to lysis and the cells were treated with the indicated range hydrogen peroxide starting six hours prior to lysis. The conditioned media and cell lysates were analyzed as described above.

Quantitative RT-PCR

Total RNA was purified using the RNAeasy kit (Qiagen). 200 ng of total RNA were converted to oligo dT primed cDNA using SuperScript III (Applied Biosystems). Gene specific forward and reverse primers were designed to amplify 57–71 base long reference and target amplicons (Table 1). Actin was used as the reference target. qRT-PCR was performed using an ABI Step One Plus Real Time PCR System (Applied Biosystems) and PCR Master Mix (ABI) with Power SYBR Green (Invitrogen) and ROX reference Dye (Invitrogen). The total reaction volume was 20 μl with 5 μl of 1:5 diluted RT reaction. Working concentration of the primers in the reaction was 0.25 μM. Thermal cycling conditions were 95°C for 10 min followed by 40 cycles of 95°C for 15 sec, 60°C for 1 min. Melt curve analysis was performed for each sample to ensure a single amplification product. Samples were analyzed in triplicate for both the reference gene and the target gene. Quantitation was performed using the comparative ΔΔCt method. We used actin as the normalizer and the calibrator sample was the endogenous human SELENOP from untreated samples. Primers in the acceptable efficiency range (90–110%) were determined using the standard curve method.

Immunoblot analysis

For SELENOP immunoblots, 15 μl of the lysate (10% of the total cell lysate which is ~30 μg total protein) as described above were resolved by 12% SDS-PAGE, blotted to nitrocellulose membrane (Amersham Biosciences), blocked in 5% nonfat dried milk for 1 hour at room temperature and probed using a monoclonal horseradish peroxidase-conjugated (HRP) anti-SELENOP antibody (Thermo-Fisher 37A1) at a 1:1,000 dilution overnight. Signal was detected using the SuperSignal West Femto kit (Pierce) according to the manufacturer’s protocol. For PTBP1 immunoblot a mouse monoclonal antibody (Thermo Fisher 32–4800) was used at a 1:1000 dilution.

Affinity chromatography

The entire rat SELENOP 3’ UTR was cloned into the pcDNA3.1 vector using the TOPO-TA cloning kit (Invitrogen). 3 copies of the viral RNA MS2 sequence separated by random sequence were synthesized commercially from IDT technologies (Table 1). These synthetic constructs were ligated downstream of the rat SELENOP 3’ UTR sequence at a Xho I restriction site. As a control, we also ligated viral MS2 sequence to the 3’ end of a non-specific sequence corresponding to a fragment of the coding region for SECISBP2L, which has a similar GC content and is of similar length as SELENOP 3’ UTR (39% GC versus 31% for the SELENOP 3’ UTR). The SELENOP 3’ UTR and the control plasmid were linearized using Bsb 1 and in vitro transcribed using the Ribomax kit (Promega). The RNA was then purified using p30 size exclusion columns (Bio-Rad) and quantified. The GST-MS2 protein was derived from a clone obtained from Rachel Green (HHMI) and was purified as described earlier [11]. For Bead preparation, 10 μl of magnetic glutathione beads (Pierce) were incubated with 100 μg of purified GST-MS2 protein for 2 hours at 4˚C in buffer A (20 mM Tris-OAc, pH 7.5, 100 mM KOAc, 2 mM DTT, 2.5 mM Mg(OAc)2, 0.25 mM spermidine, 0.4 mM GTP). The protein-bound beads were then washed with buffer A three times (10 minutes each) and then incubated with 10 μg of in vitro transcribed MS2 tagged RNA in buffer A containing 1 U/μl RNAsin for an hour and again washed with buffer A. The beads were then incubated with precleared cell lysate for 2 hours at 4˚C and then washed buffer A three times (10 minutes each) and eluted with Buffer A plus 1 M NaCl for 20 minutes. The elution was sent for LC MS/MS analysis for peptide identification at the Rutgers Biological Mass Spectrometry Facility where MudPIT analysis was performed as previously described [12].

UV crosslinking

Plasmids containing the SELENOP 3’ UTR fragments or mutants were linearized with Not I and transcribed with T7 RNA polymerase in the presence of [32P]-α-UTP (Perkin Elmer). Recombinant GST-PTBP1 was incubated with 20 fmol [32P]-α-UTP labeled fragments. Following incubation, complexes were UV irradiated at 254 nm for 10 min on ice and subsequently treated with 20 μg RNase A for 15 min at 37°C. Samples were resolved by 10% SDS-PAGE, and visualized by phosphorimaging. For the mutants in this study, we replaced the U-rich stretches in the interSECIS with either of the other 3 nucleotides. In addition, we also created a version where most of the U residues in the interSECIS were changed to A (see S1 Fig for sequences).

Recombinant GST-PTBP1 preparation

GST-PTBP1 was expressed and purified from a construct provided by Lori Covey (Rutgers University). The protein was produced in E. coli similar to the GST-MS2 procedure [11] and then purified on a glutathione-Sepharose column (GE Healthcare). Following elution, the purified GST-PTB was dialyzed against dilution buffer (50 mM HEPES, pH 7.6, 1 mM DTT, 1 mM MgCl2 and 20% glycerol) and stored at -80°C.

RNA-immunoprecipitation (RNA-IP)

Wild type and CRISPR mutated HepG2 cells were grown in EMEM complete media and collected at 80% confluence. Cells were placed on ice and washed three times with ice cold PBS, then lysed for 10 min on ice with IP lysis buffer (10 mM Tris-HCl pH 7.6, 150 mM NaCl, 0.5% NP-40, 5% Glycerol and Roche protease inhibitor). Lysates were centrifuged at 17,000 × g for 10 min and supernatant incubated overnight at 4°C with 2 μg of anti-PTBP1 antibody (monoclonal-ThermoFisher) or anti-FLAG antibody (monoclonal-Sigma). Bound proteins were pulled down using the Dynabeads Protein G Kit (Life Technologies). After pull-down, 10% of beads were boiled for 5 minutes at 95°C in SDS sample buffer and proteins were resolved on a 12% SDS-PAGE gel. The gel was blotted onto nitrocellulose and probed with 1:1000 anti-PTBP1 antibody. The remaining beads were used for total RNA extraction using Trizol reagent. cDNA synthesis was performed with both gene specific primers and oligo dT and PCR amplified using the RNA-IP primers shown in Table 1.

Statistical analysis

Gel quantitation was performed using Imagequant IQTL 8.1 using the rolling ball background correction. All experiments were performed as at least 3 biological replicates and significance was determined using the Student’s t-test. Graphical data shows the means with error bars representing standard deviation.

Results

Identification of interSECIS RNA binding proteins

The 843 nucleotide (nt) human SELENOP 3’ UTR is highly conserved among mammals (76% identity) and as shown in Fig 1 can be divided into 5 regions: 1) the sequence upstream of SECIS-1, hereafter the “preSECIS” region (254 nt); 2) SECIS-1 (83 nt); 3) the sequence between the two SECIS elements, hereafter the “interSECIS” region (358 nt); 4) SECIS-2 (81 nt); 5) the sequence downstream of SECIS-2 (63 nt). Since large, conserved AU-rich 3’ UTRs are a hallmark of post-transcriptional regulation, it is very likely that the AU-rich SELENOP 3’ UTR (overall 71% AU) is targeted by one or more RNA binding proteins. With an initial focus on the sequence between the two SECIS elements, we performed RNA affinity chromatography based on the MS2 RNA/MS2 coat protein interaction [13]. Three MS2-tagged RNAs were used as bait (Fig 2A): 1) full-length rat SELENOP 3’ UTR, 2) a mutant SELENOP 3’ UTR with the interSECIS region deleted (ΔinterSECIS) and an unrelated control RNA that had a similar GC content and the same length. These RNAs were synthesized in vitro and attached to glutathione agarose magnetic beads that had been pre-bound with GST-tagged MS2 coat protein, which binds with high affinity to the MS2 RNA sequence tag. The RNA-bound beads were incubated with rat liver extract and the bound proteins were eluted with high salt after extensive washing. Fig 2B shows SDS PAGE analysis of the proteins that eluted from the SELENOP 3’ UTR and control RNA. We observed a series of bands at ~65 kDa that specifically eluted from the wild-type SELENOP 3’ UTR but not the control RNA or the ΔinterSECIS mutant. To identify these proteins, the bands were excised from the gel and subjected to LC MS/MS. The predominant peptides corresponded to the polypyrimidine tract binding protein 1 (PTBP1). It is likely that the other bands correspond to some of the known PTBP1 isoforms (there are 7 transcript variants listed in the NCBI RefSeq database). To verify the identity of these bands, we repeated the RNA affinity chromatography using human hepatoma cell (HepG2) lysate. Fig 2C shows that we obtained a similar result with three bands in the ~65 kDa range eluting specifically from the SELENOP 3’ UTR. Immunoblot analysis using anti-PTBP1 monoclonal antibody confirmed that the eluted proteins are recognized by the antibody (Fig 2D).
Fig 1

Conservation in the SELENOP 3’ UTR.

A) Diagram and multiple sequence alignment of the mammalian SELENOP 3’ UTR. The alignment of sequences from the species indicated was performed using the MUSCLE algorithm, identical positions are black.

Fig 2

RNA affinity chromatography identifies PTBP1 and other SELENOP 3’ UTR binding proteins.

A) Diagram of the components used for glutathione agarose affinity chromatography and RNA constructs used. B) SDS PAGE analysis of rat liver proteins eluted from a GST-MS2 column bound with either control RNA, SELENOP 3’ UTR (FL 3’ UTR), and the interSECIS deletion mutant (ΔInter). The gel was stained with Coomassie and the bands of interest excised from the gel for LC MS/MS analysis. C) SDS PAGE and D) immunoblot analysis of proteins eluted from RNA affinity experiments as described in A) except that HepG2 lysate was used. The immunoblot was probed with anti-PTBP1 antibody. E) Peptide counts and cognate genes that were identified by LC MS/MS MudPIT analysis after RNA chromatography using control RNA (Cntl), wild-type SELENOP 3’ UTR (WT) and an RNA lacking the first 273 nt of the SELENOP 3’ UTR (Δ273). The ratio of peptide counts from WT UTR versus control RNA is shown (WT:Cntr). The genes shown here correspond to those with a ratio of 5 or above and a peptide count of 10 or above.

Conservation in the SELENOP 3’ UTR.

A) Diagram and multiple sequence alignment of the mammalian SELENOP 3’ UTR. The alignment of sequences from the species indicated was performed using the MUSCLE algorithm, identical positions are black.

RNA affinity chromatography identifies PTBP1 and other SELENOP 3’ UTR binding proteins.

A) Diagram of the components used for glutathione agarose affinity chromatography and RNA constructs used. B) SDS PAGE analysis of rat liver proteins eluted from a GST-MS2 column bound with either control RNA, SELENOP 3’ UTR (FL 3’ UTR), and the interSECIS deletion mutant (ΔInter). The gel was stained with Coomassie and the bands of interest excised from the gel for LC MS/MS analysis. C) SDS PAGE and D) immunoblot analysis of proteins eluted from RNA affinity experiments as described in A) except that HepG2 lysate was used. The immunoblot was probed with anti-PTBP1 antibody. E) Peptide counts and cognate genes that were identified by LC MS/MS MudPIT analysis after RNA chromatography using control RNA (Cntl), wild-type SELENOP 3’ UTR (WT) and an RNA lacking the first 273 nt of the SELENOP 3’ UTR (Δ273). The ratio of peptide counts from WT UTR versus control RNA is shown (WT:Cntr). The genes shown here correspond to those with a ratio of 5 or above and a peptide count of 10 or above. In an effort to identify additional SELENOP 3’ UTR binding proteins, we repeated the RNA affinity chromatography using the control RNA, the full length 3’ UTR and also mutant UTR lacking the first 273 nt of the 3’ UTR, thus deleting the preSECIS region plus the 5’ portion of SECIS-1 (Δ273). These RNAs were incubated with rat hepatoma (McArdle 7777) cell lysate and the entire chromatographic eluate was submitted for LC MS/MS Multidimensional Protein Identification Technology (MudPIT) analysis. Fig 2E shows the list of proteins that showed significant selectivity for the SELENOP 3’ UTR (those with 10 more peptides detected). Besides the expected recovery of both SECIS binding proteins as well as PTBP isoforms, abundant peptides were recovered from other RNA binding proteins. Both RAVER1 and MATR3 are known PTBP1 cofactors, but ELAV1 and RBM47 may be independently interacting with the SELENOP 3’ UTR. All of the PTBP isoforms and known PTBP interacting proteins [14]; RAVER1 and MATR3) were also recovered by the Δ273 mutant RNA confirming that the interSECIS region is primarily responsible for assembly of the PTBP-dependent RNP. Interestingly, there were some proteins identified that appear to be specifically interacting with the preSECIS region (e.g. ELAV1, RBM47, HNRNPLL, CCAR2 and HNRNPK), which are candidates for factors that regulate the efficiency of SELENOP translation. Overall these results confirm the initial identification of PTBP1 as a SELENOP 3’ UTR binding protein, and expand the list of candidates that may play roles in fine tuning SELENOP expression either through modulating translation or mRNA stability. Notably, most of the proteins identified are primarily nuclear, raising the possibility that the SELENOP mRNP is assembled in the nucleus prior to export.

Direct binding of PTBP1 to the SELENOP 3’ UTR

In order to determine if PTBP1 directly binds to the SELENOP 3’ UTR, we performed UV crosslinking analysis using purified recombinant GST-tagged PTBP1 (GST-PTBP1). For this assay we generated [32P]-UTP-labeled RNA fragments corresponding to full length SELENOP 3’ UTR and 4 other versions with targeted substitutions. Fig 3A shows the canonical PTBP1 binding sites (UCUU) in the human SELENOP 3’ UTR (green arrows), indicating a broad spectrum of potential interaction sites. In this case we are using UV crosslinking as a non-quantitative approach that reveals the location of binding rather than affinity. We sought to narrow down the location of PTBP1 binding by generating three mutated versions of the SELENOP 3’ UTR with the patches of U-rich sequences changed to random U-free sequences. In addition, we generated a fourth mutant in which nearly all of the U residues in the interSECIS region were changed to A (Mut1-4, S1 Fig). These fragments were labeled with 32P UTP and subjected to UV crosslinking analysis with GST-PTB. Fig 3B shows that mutating individual patches of PTB binding sites did not eliminate binding but the alteration of all three sites (Mut 4) significantly reduced crosslinking signal. The low level of signal for Mut4 indicates that the remaining labeled U residues in the preSECIS region are not the primary binding sites for PTBP1. However, the residual signal that is observed in the mut4 lane may represent low affinity interactions in this region. This is consistent with the slight reduction of PTBP1 peptides recovered from the Δ273 mutant in the mass spectrometric analysis shown in Fig 2E. This result establishes that the primary binding site of PTBP1 in vitro is in the interSECIS region rather than at the sites upstream of SECIS 1.
Fig 3

Recombinant PTBP1 binds directly to the SELENOP 3’ UTR.

A) Line diagram of the SELENOP 3’ UTR with canonical U-rich PTBP1 binding sites (UCUU) annotated as green arrows. The four regions that were mutated are indicated with arrows. B) SDS PAGE of recombinant GST-PTBP1 protein UV-crosslinked to 32P-UTP labeled RNA fragments as indicated in A). As a negative control, GST-MS2 coat protein was used as indicated.

Recombinant PTBP1 binds directly to the SELENOP 3’ UTR.

A) Line diagram of the SELENOP 3’ UTR with canonical U-rich PTBP1 binding sites (UCUU) annotated as green arrows. The four regions that were mutated are indicated with arrows. B) SDS PAGE of recombinant GST-PTBP1 protein UV-crosslinked to 32P-UTP labeled RNA fragments as indicated in A). As a negative control, GST-MS2 coat protein was used as indicated.

Deletion analysis using CRISPR/Cas9

In order to reveal regulatory functions for the non-SECIS regions of the SELENOP 3’ UTR in vivo, we generated genomic deletions of these sequences in HepG2 cells using CRISPR/Cas9. For the preSECIS region we used single guide RNAs (sgRNAs) targeting the sequence 26 nt downstream of the stop codon and 55 nt upstream of SECIS-1. This created a deletion slightly shorter than the Δ273 mutant above due to sgRNA constraints. For the interSECIS region we used a set of sgRNAs targeting the sequence 37 nts downstream of SECIS-1 and 45 nts upstream of SECIS-2 (Fig 4A). The sgRNAs were electroporated along with a GFP vector into HepG2 cells and after 48 hours, the top 3% of fluorescent cells were sorted into a 96-well plate in a single-cell format. Upon confluence, the clonal populations were analyzed for genomic deletion by PCR of genomic DNA. As shown in Fig 4A, sequencing of PCR fragments confirmed that the expected fragments were eliminated, and genomic PCR verified the deletion (Fig 4B, left panel). We also confirmed the genomic deletions by RT-PCR of RNA derived from the deletion clones (Fig 4B, right panel). To determine whether the mutated versions of SELENOP mRNA were compromised in their ability to bind PTBP1, we performed RNA immunoprecipitation (RNA-IP). HepG2 lysates from wild-type and mutated lines were incubated with anti-PTBP1 antibody or anti-FLAG antibody as a control. RNA was extracted from the immunoprecipitated material and limited-cycle RT-PCR was performed to estimate the recovery of SELENOP mRNA. Fig 4C shows that SELENOP mRNA was easily detectable from the wild-type and to a lesser extent from the ΔpreSECIS sample, but it was barely detectable from the ΔinterSECIS sample. While this assay is only semi-quantitative, it illustrates a substantial defect in PTBP1 binding in the ΔinterSECIS cells.
Fig 4

Editing of the SELENOP gene in HepG2 cells.

A) Diagram of the SELENOP 3’ UTR indicating the sequences deleted by CRISPR/Cas9 genome editing. Sequence traces of the deleted regions are shown below. B) genomic PCR (left panel) and RT-PCR (right panel) with primers flanking the deletion sites. C) Lysates from wild-type (WT) and interSECIS deletion (ΔInter) and preSECIS deletion (ΔPre) HepG2 cells were subjected to RNA-IP using the anti-PTBP1 or anti-FLAG control antibodies. RNA was extracted from immunoprecipitates and analyzed for SELENOP mRNA levels by limited-cycle RT-PCR.

Editing of the SELENOP gene in HepG2 cells.

A) Diagram of the SELENOP 3’ UTR indicating the sequences deleted by CRISPR/Cas9 genome editing. Sequence traces of the deleted regions are shown below. B) genomic PCR (left panel) and RT-PCR (right panel) with primers flanking the deletion sites. C) Lysates from wild-type (WT) and interSECIS deletion (ΔInter) and preSECIS deletion (ΔPre) HepG2 cells were subjected to RNA-IP using the anti-PTBP1 or anti-FLAG control antibodies. RNA was extracted from immunoprecipitates and analyzed for SELENOP mRNA levels by limited-cycle RT-PCR.

Role of the non-SECIS regions during oxidative stress

Considering the role of selenoproteins in responding to oxidative stress, we hypothesized that SELENOP expression would be modulated by peroxide stress as has been shown for other selenoproteins [15]. We chose peroxide stress as a tool for inducing ROS in mammalian cell culture since it is a well-established method to induce stress in HepG2 cells [16]. To assess the effect of peroxide stress on SELENOP expression, we treated wild type and deletion mutant HepG2 cells with a range of hydrogen peroxide concentrations (5–1000 μM) in the presence of 75Se-selenite. Fig 5A shows immunoblot and phosphorimage analysis of the conditioned media. Note, in most cell types, two forms of SELENOP are expressed from the same mRNA: the full-length protein and a truncated version resulting from translation termination at the 2nd UGA (Sec) codon. These migrate at 62 and 55 kDa, respectively, due to glycosylation. In order to improve electrophoretic resolution of the SELENOP bands, the medium was treated with PNGAseF, which removes both N- and O-linked glycosylation. After such treatment, the full length and truncated versions of SELENOP migrate at 42 and 37 kDa respectively (Fig 5A). Quantification of the radiolabeled SELENOP revealed a slight but consistent increase in full length protein expression in both the preSECIS and interSECIS deletion mutants, particularly at the 5 μM peroxide level (Fig 5B). Although this difference was observed for both mutants, only deletion of the preSECIS region resulted in a statistically significant increase in SELENOP expression at 5 μM peroxide treatment. While we did not attempt to perform quantitative immunoblot analysis, the blots revealed that the ratio of full length to truncated SELENOP did not significantly decrease as a result of peroxide treatment, and the mutations did not cause a substantive change in the ratio. In addition, the peroxide treatment did not affect intracellular selenoprotein synthesis as shown by examining the 75Se-selenite-labeled cell lysates (S2 Fig). These results indicate that the pre- and interSECIS sequences may be required to fine-tune SELENOP expression but that SELENOP expression is not substantively impacted by peroxide exposure under these conditions.
Fig 5

Hydrogen peroxide treatment reveals a regulatory role for the interSECIS sequence.

A) Wild-type (wt) or interSECIS deletion mutant HepG2 cells were treated with the hydrogen peroxide concentrations indicated and 100 nM 75Se-selenite for 6 hours. 30 μl of conditioned medium was analyzed by SDS PAGE followed by immunoblot (top) or phosphorimaging (bottom). Full length (FL) and truncated (term) SELENOP resulting from early termination at the second UGA codon are indicated with arrows. B) Quantitation of the band corresponding to full length (FL) SELENOP from the phosphorimage normalized to quantitation of bands from the stained gel. C) Total RNA was isolated from these cells and analyzed by qRT-PCR normalized to actin and the wt set to 1. For B and C, data were plotted as the mean with error bars showing standard deviation. A Student’s t-test was used to calculate the p values shown on three biological replicates.

Hydrogen peroxide treatment reveals a regulatory role for the interSECIS sequence.

A) Wild-type (wt) or interSECIS deletion mutant HepG2 cells were treated with the hydrogen peroxide concentrations indicated and 100 nM 75Se-selenite for 6 hours. 30 μl of conditioned medium was analyzed by SDS PAGE followed by immunoblot (top) or phosphorimaging (bottom). Full length (FL) and truncated (term) SELENOP resulting from early termination at the second UGA codon are indicated with arrows. B) Quantitation of the band corresponding to full length (FL) SELENOP from the phosphorimage normalized to quantitation of bands from the stained gel. C) Total RNA was isolated from these cells and analyzed by qRT-PCR normalized to actin and the wt set to 1. For B and C, data were plotted as the mean with error bars showing standard deviation. A Student’s t-test was used to calculate the p values shown on three biological replicates. In order to determine the contribution of RNA concentration to the change in SELENOP expression, we performed qRT-PCR. Fig 5C shows that the deletions had opposing effects where the preSECIS deletion caused a ~25% reduction in mRNA levels while the interSECIS deletion caused ~75% increase. These opposing effects indicate that the efficiency of SELENOP protein production is increased when the preSECIS sequence is deleted and decreased for the interSECIS deletion. Interestingly, we reproducibly observed a spike of ΔpreSECIS mRNA expression at the 5 μM dose of peroxide but this spike was not observed for the ΔinterSECIS mutant mRNA. This finding further supports a complex interplay between regulation of mRNA levels and translation efficiency to allow SELENOP regulation.

Selenium supplementation reveals a role for PTB binding sites in regulating translational efficiency

In addition to peroxide stress, we also analyzed the effect of altered selenium concentrations. Since standard HepG2 culture conditions are typically selenium deficient, we first determined the effect of cold selenium supplementation on SELENOP expression. Fig 6A shows immunoblot analysis of SELENOP over a range of selenium supplementation from 10 to 100 nM. We observed a striking increase in SELENOP expression that was similar in the wild-type and mutated cell lines, highlighting the fact that standard culture conditions are extremely selenium deficient. Additionally, we observed a significant increase in full length SELENOP production from the ΔpreSECIS versus wild-type cell line (compare lanes 3 and 7). To get a more quantitative picture of the effect of selenium supplementation on the amounts of full length and truncated SELENOP, we used 75Se-selenite in varying amounts. Interestingly we observed a peak of labeling at 50 nM (Fig 6B), likely due to this being the optimal specific activity for detecting incorporation of labeled selenium while the overall concentration is still limiting (i.e., all or most of the supplemental selenium is being incorporated at the 50 nM concentration). When comparing the amount of labeling between wild-type and mutant versions of SELENOP, we observed about 50% more total signal in the ΔpreSECIS mutant than in the wild-type or ΔinterSECIS mutant cells at the 50 nM level (Fig 6C). Analysis of the lysate did not reveal any statistically significant changes in incorporation that correlated with either of the mutations (Fig 6B, lower panel and Fig 6D). Interestingly, the corresponding RNA analysis by qRT-PCR revealed a significant drop in RNA levels for the ΔpreSECIS mutant cells (Fig 6E) such that the inferred translational efficiency (protein:RNA ratio) was almost 3 times higher for the ΔpreSECIS condition (Fig 6F). These results further reveal roles for the non-SECIS regions of the SELENOP 3’ UTR in fine tuning SELENOP expression.
Fig 6

Limiting selenium reveals a role for the PreSECIS region.

A) HepG2 cells were incubated with increasing concentrations of sodium selenite as indicated. 30 μl of conditioned medium was analyzed by SDS PAGE followed by immunoblot probed with anti-SELENOP antibody. B) Same as in A) except 75Se-selenite was used to supplement. SDS-PAGE of conditioned media (top panel) or lysate (bottom panels) was analyzed by phosphorimage analysis and Coomassie Stain (top panel), normalized to quantitation of bands from the stained gel. C) Quantitation of the phosphorimage data derived from conditioned media. D) Quantitation of all radioactive bands in the phosphorimage data derived from lysate. E) Total RNA was isolated from the cell lines indicated with and without 50 nM selenium supplementation and analyzed by qRT-PCR normalized to actin and the wt set to 1. F) A plot of the inferred translational efficiency based on the RNA:protein ratio normalized to wild-type. For all quantification, a Student’s t-test was used to calculate the p values shown on three biological replicates.

Limiting selenium reveals a role for the PreSECIS region.

A) HepG2 cells were incubated with increasing concentrations of sodium selenite as indicated. 30 μl of conditioned medium was analyzed by SDS PAGE followed by immunoblot probed with anti-SELENOP antibody. B) Same as in A) except 75Se-selenite was used to supplement. SDS-PAGE of conditioned media (top panel) or lysate (bottom panels) was analyzed by phosphorimage analysis and Coomassie Stain (top panel), normalized to quantitation of bands from the stained gel. C) Quantitation of the phosphorimage data derived from conditioned media. D) Quantitation of all radioactive bands in the phosphorimage data derived from lysate. E) Total RNA was isolated from the cell lines indicated with and without 50 nM selenium supplementation and analyzed by qRT-PCR normalized to actin and the wt set to 1. F) A plot of the inferred translational efficiency based on the RNA:protein ratio normalized to wild-type. For all quantification, a Student’s t-test was used to calculate the p values shown on three biological replicates.

Discussion

All selenoprotein 3’ UTRs contain an approximately 100 nt SECIS element required for recoding a UGA to allow Sec incorporation. However, most selenoprotein 3’ UTRs contain long sequences adjacent to the SECIS element with no known function. It is therefore likely that selenoprotein 3’ UTRs contain regulatory motifs in their 3’ UTRs. Such motifs in a broad spectrum of mammalian mRNAs have been revealed over the last several decades as key regulators of translation, mRNA localization and mRNA decay [reviewed in 17]. Naturally, RNA binding proteins are key players in most 3’ UTR-mediated regulatory processes, many serving as a platform for highly complex ribonucleoprotein complexes. One of the many pleiotropic RNA binding proteins that falls in this category is polypyrimidine tract binding protein (PTBP1), which has demonstrated roles in regulating pre-mRNA splicing, translation, NMD resistance and mRNA stability [reviewed in 18]. Here, we have found that the SELENOP 3’ UTR is a platform that binds PTBP1 and other RNA binding proteins that are likely playing a role in regulating the efficiency of SELENOP synthesis. The human SELENOP mRNA contains multiple U-rich sequences, many of which are canonical PTBP1 binding sites (Fig 3). The fact that these sites cluster in the region upstream and downstream of SECIS-1 is consistent with our experimental determination that PTBP1 directly interacts with these regions, although the sites upstream of SECIS1 do not seem to play a major role in direct PTBP1 binding. The genomic deletion of regions containing PTBP1 binding sites revealed potential roles in regulating translation since we observed significant changes in the protein/mRNA ratios. While we cannot rule out transcriptional and protein stability components to this result, a role in translation regulation is consistent with prior roles assigned to PTBP1 outside of its canonical role in pre-mRNA splicing. The observed change in protein/mRNA ratios was driven to some extent by changes in steady state mRNA levels with preSECIS deletion causing a decrease in mRNA and interSECIS causing a general increase. Interestingly, we observed a disconnect between the demonstrated PTBP1 binding sites in the interSECIS region and the stronger effects on expression when the preSECIS region was deleted. This likely points to the importance of other RNA binding proteins in the 5’ portion of the 3’ UTR that may function independently of PTBP1. This point also underlies our decision not to pursue PTBP1 loss of function studies, which would be impossible to interpret given its ubiquitous roles in multiple cellular processes. Although the magnitude of effects observed were relatively small, the reproducible changes observed as a result of peroxide exposure suggest that stress response is an important aspect of SELENOP regulation. We expect future work to reveal conditions where PTBP1 function is required to regulate SELENOP levels in vivo. For example, SELENOP mRNA levels have been reported to dramatically increase in response to exercise stress in mice fed a normal diet but not those fed a high fat diet [19]. We expect the molecular pathways that regulate such a response to work at least in part through the mechanisms uncovered in this report. It is also important to consider the potential for the regulation of PTBP1 levels or isoforms in the context of its SELENOP-related role. Although we are unaware of any known direct correlations between SELENOP and PTBP1 regulation, the pleiotropism of PTBP1 function and regulation was recently delineated in a single cell-type (HEK293), revealing profound complexity and potential for coordinate regulation [20]. This study has also revealed a role for the non-SECIS sequences in response to varying selenium levels. As the major carrier of blood-borne selenium, SELENOP synthesis is necessarily tightly linked to the available selenium concentration. Notably, we observed that the ΔpreSECIS mutation caused a ~2-fold reduction in steady state mRNA levels with a concomitant and unexpected 50% increase in protein production. This apparent increased translational efficiency may suggest that the efficiency of SELENOP production is kept at a moderate level in order to balance the consumption of limiting selenium to allow adequate intracellular selenoprotein production. Alternatively, the attenuation of SELENOP expression as a function of the preSECIS region may be required to maximize the processivity of multiple Sec incorporation events, considering the prior work that showed significant ribosomal pausing at the first UGA codon [8, 21]. Since we also observed a loss of stead-state SELENOP mRNA levels when the PTBP1 binding sites were compromised, we must also pursue the possibility that the PTB RNP may play a role in preventing the recruitment of NMD factors, which are known to play a role in regulating some selenoprotein mRNAs when translation efficiency is compromised [22]. It will be challenging to determine the mechanism of action for these sequences because extensive analysis of SELENOP synthesis in vitro and in transfected cells has failed to reveal a role for the sequences surrounding the SECIS elements [9, 23]. Considering that the results obtained here indicate a regulatory role for the region surrounding SECIS-1, it is likely that the functional RNP complex may form co-transcriptionally and coincident with RNA splicing. Considering the high concentration of PTBP1 in the nucleus and its role in splicing, it is logical that it binds to SELENOP pre-mRNA and stays associated to be exported in a conformation that is able to respond to cellular conditions. In the case of oxidative stress, it is possible that the complex constituents are altered, allowing regulated SELENOP expression. The idea that an active SELENOP mRNP may form during pre-mRNA processing may explain why we have been unsuccessful in trying to express detectable protein from transfected cDNA [24]. One of the most likely mechanisms by which 3’ UTR sequences would affect selenoprotein expression is by modulating SECIS function, either by blocking or possibly even enhancing SBP2 access or affinity. The proximity of the PTBP1 binding sites to SECIS-1, which is sufficient to support full length SELENOP synthesis in vitro and in transfected cells [9], certainly supports this hypothesis. However, if SECIS access were a general mechanism of regulation, then one would expect the sequences and binding proteins to be conserved. The stark lack of conservation among selenoprotein 3’ UTR sequences strongly suggests that independent mechanisms evolved to respond to very specific regulatory demands.

Sequence alignments to illustrate the mutations made for UV-crosslinking analysis in Fig 3.

(TIF) Click here for additional data file.

SELENOP 3’ UTR mutations do not affect intracellular selenoprotein production.

Cell lysates derived from the 75Se-selenite labeling described for Fig 5 were analyzed by SDS-PAGE followed by phosphorimage analysis. (TIF) Click here for additional data file.

This file contains raw uncropped images used to generate the figures in this manuscript.

The numbers below gels correspond to loading order shown in figures. (PDF) Click here for additional data file. 7 Jun 2022
PONE-D-22-10327
The Selenoprotein P 3' untranslated region is an RNA binding protein platform that fine tunes selenocysteine incorporation
PLOS ONE Dear Dr. Copeland, Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.
 
Your manuscript has been reviewed by three experts. All of them found it interesting and it merits publication after responding to their concerns. Please revise your manuscript according to their suggestions.
One major concern about it is, as one of the reviewers pointed out, there might be a potential duplication of images, phospho imager images of Figure S2. Please investigate this issue, correct it, if necessary, and report how this incident occurred in the revised manuscript. Please submit your revised manuscript by Jun 26 2022 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. Please include the following items when submitting your revised manuscript: A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'. If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.
If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols. We look forward to receiving your revised manuscript. Kind regards, Hodaka Fujii, M.D., Ph.D. Academic Editor PLOS ONE Journal Requirements: When submitting your revision, we need you to address these additional requirements. 1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf 2. Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice. 3. We note that the grant information you provided in the ‘Funding Information’ and ‘Financial Disclosure’ sections do not match. When you resubmit, please ensure that you provide the correct grant numbers for the awards you received for your study in the ‘Funding Information’ section. 4. Thank you for stating the following in the Acknowledgments Section of your manuscript: "This work was supported by the National Institutes of Health [GM077073 to P.R.C]" We note that you have provided funding information that is not currently declared in your Funding Statement. However, funding information should not appear in the Acknowledgments section or other areas of your manuscript. We will only publish funding information present in the Funding Statement section of the online submission form. Please remove any funding-related text from the manuscript and let us know how you would like to update your Funding Statement. Currently, your Funding Statement reads as follows: "No, The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript." Please include your amended statements within your cover letter; we will change the online submission form on your behalf. 5. In your Data Availability statement, you have not specified where the minimal data set underlying the results described in your manuscript can be found. PLOS defines a study's minimal data set as the underlying data used to reach the conclusions drawn in the manuscript and any additional data required to replicate the reported study findings in their entirety. All PLOS journals require that the minimal data set be made fully available. For more information about our data policy, please see http://journals.plos.org/plosone/s/data-availability. Upon re-submitting your revised manuscript, please upload your study’s minimal underlying data set as either Supporting Information files or to a stable, public repository and include the relevant URLs, DOIs, or accession numbers within your revised cover letter. For a list of acceptable repositories, please see http://journals.plos.org/plosone/s/data-availability#loc-recommended-repositories. Any potentially identifying patient information must be fully anonymized. Important: If there are ethical or legal restrictions to sharing your data publicly, please explain these restrictions in detail. Please see our guidelines for more information on what we consider unacceptable restrictions to publicly sharing data: http://journals.plos.org/plosone/s/data-availability#loc-unacceptable-data-access-restrictions. Note that it is not acceptable for the authors to be the sole named individuals responsible for ensuring data access. We will update your Data Availability statement to reflect the information you provide in your cover letter. 6. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels. In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions. Additional Editor Comments: Please correct the following typos: p. 7, the 2nd last line of the 1st section: "shwon" to "shown". [Note: HTML markup is below. Please do not edit.] Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Yes Reviewer #2: Yes Reviewer #3: Yes ********** 2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: Yes Reviewer #2: Yes Reviewer #3: Yes ********** 3. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes Reviewer #2: Yes Reviewer #3: Yes ********** 4. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes Reviewer #2: Yes Reviewer #3: Yes ********** 5. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: PONE-D-22-10327 The Selenoprotein P 3' untranslated region is an RNA binding protein platform that fine tunes selenocysteine incorporation The manuscript is very well written, the experiments are appropriate and effective. Results convincing, statistical analyses appropriate. Nice to see using both rat and human cell models used, and that extra bands were validated. There are only very minor comments: Suggest italicizing SELENOP to indicate the gene/nucleotide sequence and non-italicized when referring to the protein, as this would provide clarity. It appears to be used once on p. 6, but inconsistently so. Technically, only human gene would be SELENOP, whereas mouse and rat would be selenop. Please change uM to µM (e.g., bottom of p. 8 and a couple of instances within the text on p. 9 and in Figure 5), and ug to µg (p. 16), and uL to µL (p17). Please bracket ‘respectively’ by commas (p. 9), and change ‘media was’ to either ‘medium was’ or ‘media were’ (on p. 9 and also a couple of times in the methods section, and in legends for Figure 5 & 6) Insert comma after i.e. (p. 10) Be consistent in use of either UTRs or UTR’s. Both are used (see first few sentences of discussion) interchangeably. Similarly, spacing between 3’UTR and 3’ UTR should be consistent. End of first paragraph of discussion: Here, we have found…… (comma missing) P 15: 200 ng … were…. P 16: 15 µL…. were… P, 18: E. coli should be italicized p-values should always be with the zero preceding the period (e.g., p=0.037 in figure 5B, not p=.037) The only actual questions concerns Figure S2 – can the authors please verify that the same images weren’t accidentally used for both (left and right) or that we are not misinterpreting the use of it? The images seem identical, down to the same artifacts in the phosphor imager bands that are slightly broken the same way. Reviewer #2: This is a very interesting manuscript that deepens our knowledge of the regulatory frame of selenoprotein P (SELENOP) translation, an intriguingly unique mRNA that contains 2 SECIS elements that direct insertion of up to 10 selenocysteines in the polypeptide chain. The authors identified for the first time an RNA binding protein, PTBP1, that binds to an intermediate region between the 2 SECIS elements and regulates translation efficiency of this mRNA. The manuscript is clearly written, and the logical flow of findings is very straightforward to follow, with the adequate experiments needed and appropriate controls. It will add valuable information to the field of selenoprotein translation. Nevertheless, some minimal comments below would, if addressed, enrich further the manuscript quality prior to publication. COMMENTS Introduction: • "All but one of the human selenoproteins contain a single Sec codon in their coding region" - There is a second UGA sometimes recognized as Sec in Deiodinase type 2 (see PMID: 11425850). Please rephrase. Methods: • Has the SELENOP antibody used in this manuscript been validated? • Statistical Analysis used in experiments is embedded in figure legends. It will be best organized if shown as a subsection of the Methods. Discussion: • "For example, SELENOP mRNA levels have been reported to dramatically increase in response to exercise stress in mice fed a normal diet but not those fed a high fat diet [16]." Is PTBP1 regulated by exercise? A discussion on common potential regulators of PTBP1 should be incorporated to enrich the discussion. • "(...) it is likely that the 14 functional RNP complex may form co-transcriptionally and coincident with RNA splicing." Has any of the proteins recognized by the screening related to RNA splicing that are below the threshold chosen for the selection of peptides? This could be an interesting point to discuss further. • This manuscript showed that mutation in the preSECIS1 sequence reduces translational efficiency. PTBP1 could, via binding to an NMD partner, contribute also to nonsense-mediated decay of SELENOP mRNA according to Se conditions. This possibility would also enrich the discussion. Figures: • Legend of Fig. 2 has "D" when it should be "E" for the peptide counts data. Reviewer #3: This study reports investigation of conserved sequences in the 3’UTR of selenoprotein P, using RNA affinity chromatography and mass spec. The overall premise is sound, and the experimental rationale is well thought out, with appropriate controls. The authors report identification of PTBP1 as the major RNA binding protein specifically interacting with the inter-SECIS region. They further use CRISPR/Cas9 genome editing to assess functional role, and report regulation in response to oxidative stress and selenium concentration. They further report that the ΔpreSECIS mutation caused a ~2-fold reduction in steady state mRNA levels with a concomitant increase in protein production. This intriguing finding highlights avenues for future investigation into the complex regulatory mechanisms required for expressing this critically important but translationally challenging and perplexing protein. A minor point that should be corrected on p. 7, line 12 – mutating is misspelled in this sentence, “Figure 3C shows that mutatng individual patches…” ********** 6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #2: No Reviewer #3: No [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.
13 Jun 2022 Dear Dr. Fujii, Thank you for taking the time to handle the review of our manuscript (PONE-D-22-10327 The Selenoprotein P 3' untranslated region is an RNA binding protein platform that fine tunes selenocysteine incorporation). Below please find responses to the points raised by reviewers. First and foremost, to address the issue of the duplicated image. Many thanks to Reviewer #1 for noticing this. Yes, I can confirm and was horrified that the gel images for the right side of figure S2 (right panel) are a duplicate of the gels in the left side. As the reviewer pointed out, the duplication is readily apparent, and although I don’t know how it escaped my attention during the submission process, I will explain how it likely happened. The workflow for manuscripts from my lab is that the person generating data puts “rough” labeled images as a page in the illustration program we use, which is called Sketch. It is then my job to create the final labeled figures for submission. In this case I went back to the original Sketch file that the first author (Suma Shetty) put together and found that the two panels for Figure S2 started off as two separate figures. What likely happened is that I created the labels for one image, and went back and accidentally grabbed the same images instead of going to the other figure. I would be happy to provide the original Sketch file if that is desired. In any event, I hope it is obvious that there was no intent to deceive as the corrected data reveals the same result. Regarding the funding statement, the current wording is correct: "No, The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript." Funding Information: NIH NIGMS R01GM077073 Regarding Data Availability, the minimal data set underlying the results described in the manuscript are fully contained with the main and supplementary figures. Reviewer #1: Thank you for the insightful comments and careful reading. All of the suggested corrections were made (proper gene nomenclature for SELENOP, units and punctuation). See above for the issue with duplicated images for Figure S2 Reviewer #2: Again, thank you for the insightful comments and careful reading. All of the suggested minor corrections were made. Regarding the SELENOP antibody validation, it is a commercial antibody that the manufacturer has stated was validated with purified human selenoprotein P. In addition, there are two validating features of the published data: 1) the bands detected only appear when adequate selenium is included in the medium (Figure 6A), and those bands resolve at their expected molecular weights before (Figure 6A) and after (Figure 5A) PNGAse F treatment. Statistical methods have been added to the methods section. A statement about the potential for coordinate PTBP1 regulation has been added to page 13 (we could not find any evidence for directly correlated regulation, but instead point to a very thorough analysis of PTBP1 isoforms and their regulation from Jamie Cate’s group in 2019). Regarding the potential for having identified additional splicing factors in the mass spec data, unfortunately it is not really possible to extrapolate function from this group as there are hundreds of proteins encompassing many cellular processes that are below the cutoff. Regarding the mention of PTBP1 regulating NMD, this is an excellent suggestion that we have added to the Discussion. Reviewer #3: Again, thank you for the insightful comments and careful reading. All of the suggested corrections were made. 1 Jul 2022 The Selenoprotein P 3' untranslated region is an RNA binding protein platform that fine tunes selenocysteine incorporation PONE-D-22-10327R1 Dear Dr. Copeland, We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements. Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication. An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org. If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org. Kind regards, Hodaka Fujii, M.D., Ph.D. Academic Editor PLOS ONE Additional Editor Comments (optional): Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation. Reviewer #1: All comments have been addressed Reviewer #2: All comments have been addressed Reviewer #3: All comments have been addressed ********** 2. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Yes Reviewer #2: Yes Reviewer #3: Yes ********** 3. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: Yes Reviewer #2: Yes Reviewer #3: Yes ********** 4. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes Reviewer #2: Yes Reviewer #3: Yes ********** 5. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes Reviewer #2: Yes Reviewer #3: Yes ********** 6. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: Very interesting paper, and the revisions look good. Thank you for taking the time to verify the image source. Reviewer #2: The Authors have addressed all comments appropriately. Without further issues to be raised, this manuscript seems acceptable to publication into PLOS ONE. Reviewer #3: (No Response) ********** 7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #2: No Reviewer #3: No ********** 8 Jul 2022 PONE-D-22-10327R1 The Selenoprotein P 3' untranslated region is an RNA binding protein platform that fine tunes selenocysteine incorporation Dear Dr. Copeland: I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org. If we can help with anything else, please email us at plosone@plos.org. Thank you for submitting your work to PLOS ONE and supporting open access. Kind regards, PLOS ONE Editorial Office Staff on behalf of Dr. Hodaka Fujii Academic Editor PLOS ONE
  24 in total

Review 1.  The molecular biology of selenocysteine.

Authors:  Jonathan N Gonzalez-Flores; Sumangala P Shetty; Aditi Dubey; Paul R Copeland
Journal:  Biomol Concepts       Date:  2013-08

Review 2.  Selenocysteine incorporation: A trump card in the game of mRNA decay.

Authors:  Sumangala P Shetty; Paul R Copeland
Journal:  Biochimie       Date:  2015-01-23       Impact factor: 4.079

3.  Genome engineering using the CRISPR-Cas9 system.

Authors:  F Ann Ran; Patrick D Hsu; Jason Wright; Vineeta Agarwala; David A Scott; Feng Zhang
Journal:  Nat Protoc       Date:  2013-10-24       Impact factor: 13.491

4.  Multiple RNA structures affect translation initiation and UGA redefinition efficiency during synthesis of selenoprotein P.

Authors:  Marco Mariotti; Sumangala Shetty; Lisa Baird; Sen Wu; Gary Loughran; Paul R Copeland; John F Atkins; Michael T Howard
Journal:  Nucleic Acids Res       Date:  2017-12-15       Impact factor: 16.971

5.  Genetic variation in selenoprotein S influences inflammatory response.

Authors:  Joanne E Curran; Jeremy B M Jowett; Kate S Elliott; Yuan Gao; Kristi Gluschenko; Jianmin Wang; Dalia M Abel Azim; Guowen Cai; Michael C Mahaney; Anthony G Comuzzie; Thomas D Dyer; Ken R Walder; Paul Zimmet; Jean W MacCluer; Greg R Collier; Ahmed H Kissebah; John Blangero
Journal:  Nat Genet       Date:  2005-10-09       Impact factor: 38.330

6.  Sepp1(UF) forms are N-terminal selenoprotein P truncations that have peroxidase activity when coupled with thioredoxin reductase-1.

Authors:  Suguru Kurokawa; Sofi Eriksson; Kristie L Rose; Sen Wu; Amy K Motley; Salisha Hill; Virginia P Winfrey; W Hayes McDonald; Mario R Capecchi; John F Atkins; Elias S J Arnér; Kristina E Hill; Raymond F Burk
Journal:  Free Radic Biol Med       Date:  2014-01-14       Impact factor: 7.376

7.  Effects of exercise on biological trace element concentrations and selenoprotein P expression in rats with fructose-induced glucose intolerance.

Authors:  Namika Miya; Asuka Uratani; Keita Chikamoto; Yuki Naito; Keiji Terao; Yutaka Yoshikawa; Hiroyuki Yasui
Journal:  J Clin Biochem Nutr       Date:  2020-01-17       Impact factor: 3.114

8.  Multiple determinants of splicing repression activity in the polypyrimidine tract binding proteins, PTBP1 and PTBP2.

Authors:  Niroshika M Keppetipola; Kyu-Hyeon Yeom; Adrian L Hernandez; Tessa Bui; Shalini Sharma; Douglas L Black
Journal:  RNA       Date:  2016-06-10       Impact factor: 4.942

Review 9.  Selenoprotein P as an in vivo redox regulator: disorders related to its deficiency and excess.

Authors:  Yoshiro Saito
Journal:  J Clin Biochem Nutr       Date:  2019-11-12       Impact factor: 3.114

10.  Novel structural determinants in human SECIS elements modulate the translational recoding of UGA as selenocysteine.

Authors:  Lynda Latrèche; Olivier Jean-Jean; Donna M Driscoll; Laurent Chavatte
Journal:  Nucleic Acids Res       Date:  2009-08-03       Impact factor: 16.971

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.