Literature DB >> 35901009

Geneticin reduces mRNA stability.

Yavuz T Durmaz1, Alankrit Shatadal1, Kyle Friend1.   

Abstract

Messenger RNA (mRNA) translation can lead to higher rates of mRNA decay, suggesting the ribosome plays a role in mRNA destruction. Furthermore, mRNA features, such as codon identities, which are directly probed by the ribosome, correlate with mRNA decay rates. Many amino acids are encoded by synonymous codons, some of which are decoded by more abundant tRNAs leading to more optimal translation and increased mRNA stability. Variable translation rates for synonymous codons can lead to ribosomal collisions as ribosomes transit regions with suboptimal codons, and ribosomal collisions can promote mRNA decay. In addition to different translation rates, the presence of certain codons can also lead to higher or lower rates of amino acid misincorporation which could potentially lead to protein misfolding if a substituted amino acid fails to make critical contacts in a structure. Here, we test whether Geneticin-G418, an aminoglycoside antibiotic known to promote amino acid misincorporation-affects mRNA stability. We observe that G418 decreases firefly luciferase mRNA stability in an in vitro translation system and also reduces mRNA stability in mouse embryonic stem cells (mESCs). G418-sensitive mRNAs are enriched for certain optimal codons that contain G or C in the wobble position, arguing that G418 blunts the stabilizing effects of codon optimality.

Entities:  

Mesh:

Substances:

Year:  2022        PMID: 35901009      PMCID: PMC9333311          DOI: 10.1371/journal.pone.0272058

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.752


Introduction

mRNA stability is a key determinant of protein expression. Thus, cells tightly regulate mRNA stability, often via sequence-specific interactions with mRNA-binding proteins and/or miRNAs. Less specific to individual mRNAs, translation also promotes mRNA decay. Both prokaryotic and eukaryotic translation inhibitors broadly stabilize mRNAs [1-3], and a mutation that disrupts tRNA biogenesis similarly stabilizes mRNAs in yeast [4]. These findings implicate translation as a key determinant of mRNA stability. More recently, mRNA codon usage has been connected to mRNA stability. Most amino acids are encoded by synonymous codons which often have different usage rates. Within an organism, more prevalent codons are often, but not always, decoded by more abundant tRNAs [5, 6], leading to optimal as well as suboptimal codons whose identities vary between organisms. Over the last decade, it has been observed that optimal codons correlate with increased mRNA stability in both bacterial and eukaryotic systems [7-10]. Since suboptimal codons reduce translational speed in bacteria [11] and are thought to dwell in unoccupied ribosome acceptor sites (A sites) for longer, these empty A sites might be recognized by some component of the mRNA decay machinery. In fact, unoccupied A sites delay a conformational change in the ribosome, permitting Ccr4-Not complex binding. Due to its role in mRNA decay, binding between the Ccr4-Not complex and ribosomes with unoccupied A sites destabilizes yeast mRNAs with suboptimal codons [12]. In addition, other studies have identified ribosomal stall sites, often with sequential suboptimal codons, as locations where ribosomes collide on mRNAs leading to decay in yeast and mammalian systems [13-15]. In addition to translational optimality, codon nucleotide sequences have been connected to mRNA decay rates. The wobble position, in particular, matters with A/U at the wobble position (AU3) correlating with reduced mRNA stability and GC3 with higher mRNA stability in mammalian cells [16, 17]. These effects may be due in part to tRNA decoding since it is possible to improve translational efficiency either by changing suboptimal codons or cognate tRNAs to improve codon:anticodon base-pairing in yeast [18]. Clearly, both codon optimality and codon sequences play major roles in determining mRNA stability, but we hypothesized that an additional role could be played by amino acid misincorporation. In addition to effects on translation elongation rates, suboptimal codons are associated with higher bacterial amino acid misincorporation rates [19]. Incorrect codon:anticodon pairing is a common source of bacterial amino acid misincorporation and occurs at higher rates when G:U mismatches can allow for near-cognate tRNAs to bind a codon [20-22]. Near-cognate tRNAs are those tRNAs that can maintain two of three base-pairing interactions during anticodon:codon pairing. Since suboptimal codons typically correlate with lower abundance cognate tRNAs, the ribosome must reject more near-cognate tRNAs while waiting for a cognate tRNA to arrive. This process of tRNA rejection is imperfect, leading to higher amino acid misincorporation rates due to substitution of cognate tRNAs with near-cognate tRNAs [19]. Many of these experiments were potentiated with aminoglycoside translation inhibitors since that class of inhibitor can promote higher rates of amino acid misincorporation [20-22]. Here, we asked whether ribosomal errors affect mRNA stability in mammalian systems. We use G418, an aminoglycoside translation inhibitor that increases amino acid misincorporation rates in mammalian cells [23-25]. By measuring mRNA half-lives in a reporter system and mESCs, we observed that G418 drives mRNA destabilization. In vitro, we observe that G418 likely acts independently of ribosome collisions, arguing that its effects are via amino acid misincorporation. In vivo, G418 destabilizes mRNAs broadly, in that the majority of mRNAs in mESCs have reduced stability when mESCs are treated with G418. The mRNAs with half-lives that are most reduced by treatment with G418 are enriched for select optimal codons, containing G/C at the wobble position. Together, our results support a potential role for amino acid misincorporation as a regulator of mRNA stability.

Results

G418 destabilizes mRNA in rabbit reticulocyte lysate

We hypothesized that amino acid misincorporation events would promote mRNA decay. Since amino acid misincorporation occurs ~1 in 10,000 catalytic cycles, these events could lead to significant background levels of mRNA decay. To investigate our hypothesis, we employed three translation elongation inhibitors, each with unique modes of inhibition. G418 is an aminoglycoside translation inhibitor which promotes amino acid misincorporation and stop-codon readthrough [23-25]. Control translation inhibitors were puromycin and cycloheximide which promote abortive translation and ribosome stalling respectively [26, 27]. First, we titrated the translation inhibitors in rabbit reticulocyte lysate and quantified the levels of firefly luciferase produced from a reporter mRNA (Fig 1A); we identified concentrations of all three translation inhibitors where luciferase production was consistently, but modestly depressed. Using these intermediate inhibitor concentrations, we then quantified firefly luciferase mRNA levels during translation reactions. In all cases, ribosomal rRNA was used for normalization. Consistent with our hypothesis, we found that significantly less mRNA was present at the end of translation reactions containing G418 compared to uninhibited reactions (Fig 1B). Consistent with previous research [2, 3], we observed that cycloheximide stabilized mRNA levels relative to uninhibited reactions. The same was true for puromycin. These data suggest that mRNA decay is specific to G418. The contrast between residual mRNA levels and loss of firefly luciferase production was striking in that much more mRNA was degraded compared to lost protein in reactions treated with G418. Therefore, we performed a time course experiment monitoring firefly luciferase production to assess whether most firefly luciferase was produced at a point before significant levels of mRNA were degraded (Fig 1C). At early time points, very little protein is produced, but between 10 and 30 minutes, there is a rapid accumulation of firefly luciferase protein in control reactions and those treated with antibiotics (Fig 1C). Presumably, the lag in protein production is due to ribosomal loading onto firefly luciferase mRNA and translation elongation through the stop codon. Interestingly, at the antibiotic concentrations in use here, we do not observe a consistent delay in translation elongation by cycloheximide which would be expected given its role in ribosome stalling [27], although 10 minute intervals may not have enough resolution to observe small delays in translation elongation rates. Since G418 might delay translation elongation, we repeated our time course analysis with higher concentrations of all three antibiotics to probe whether G418 could delay elongation (S1 Fig). Under these conditions, both G418 and cycloheximide delay the initial production of firefly luciferase, suggesting both antibiotics delay translation elongation at higher concentrations. An important caveat with this experiment is that higher levels of G418 may compromise firefly luciferase activity, although residual activity still accumulates with delayed kinetics (S1 Fig). G418 is not known to cause ribosome collisions, but since cycloheximide can have this effect via a stalling mechanism [13], we sought to test whether G418 might promote ribosome collisions in our in vitro translation system.
Fig 1

G418 destabilizes mRNA in vitro.

(A) Rabbit reticulocyte lysate was used to translate an mRNA encoding firefly luciferase in the presence of G418, cycloheximide, or puromycin at increasing inhibitor concentrations (concentrations were 0.5, 5.0, and 50 ng/μL for G418 and puromycin and 0.25, 2.5 ng/μL, and 25 ng/μL for cycloheximide) to identify concentrations with modest translation inhibition. (B) At intermediate antibiotic concentrations (5.0 ng/μL G418 and puromycin, 2.5 ng/μL cycloheximide), G418 destabilizes mRNA relative to control reactions and reactions with other translation elongation inhibitors. After 30 min, in vitro translation reactions containing G418 have significantly less mRNA (*, p < 0.01) compared to control reactions, and cycloheximide and puromycin both stabilize mRNA compared to control reactions without inhibitors (*, p < 0.01, p-values from Student’s t-test). (C) Translation reactions were prepared as in (B), but firefly luciferase protein levels were measured. Very little firefly luciferase production is observed at 10 minutes, but then firefly luciferase accumulates over the remaining time course. Antibiotics consistently reduce luciferase production at all time intervals. (D) Again, translation reactions were prepared as in (B) and (C). Reactions were quenched at 15 min and loaded onto a sucrose gradient for ribosome fractionation. Fractions were collected dropwise, and nucleic acid content was quantified at 260 nm. Absorbances for sequential fractions are plotted. Regardless of treatment, a large 80S monoribosome peak was observed with minimal polyribosome peaks. Therefore, the majority of ribosomes in reticulocyte lysate exist as monoribosomes. (E) Representative fractions from (D) were probed for firefly luciferase mRNA using RT-qPCR. Consistent with the overall profile in (D), the majority of firefly luciferase mRNA can be found in fractions from the top of the gradient (Free RNA) or the 80S monoribosome peak. Minimal, but detectable firefly luciferase mRNA can be isolated from fractions in the polyribosome region of the gradient. These data suggest that most mRNA in reticulocyte lysate is translated by monoribosomes. (F) Proteins from in vitro translation reactions were analyzed by western blotting for firefly luciferase. Only full-length protein was visible (*), indicating that G418 treatment did not cause high rates of stop codon readthrough. Due to its mechanism, it is unlikely that treatment with G418 would affect the total protein level as measured here since it promotes amino acid misincorporation. Altogether, these data suggest that G418 destabilizes mRNA.

G418 destabilizes mRNA in vitro.

(A) Rabbit reticulocyte lysate was used to translate an mRNA encoding firefly luciferase in the presence of G418, cycloheximide, or puromycin at increasing inhibitor concentrations (concentrations were 0.5, 5.0, and 50 ng/μL for G418 and puromycin and 0.25, 2.5 ng/μL, and 25 ng/μL for cycloheximide) to identify concentrations with modest translation inhibition. (B) At intermediate antibiotic concentrations (5.0 ng/μL G418 and puromycin, 2.5 ng/μL cycloheximide), G418 destabilizes mRNA relative to control reactions and reactions with other translation elongation inhibitors. After 30 min, in vitro translation reactions containing G418 have significantly less mRNA (*, p < 0.01) compared to control reactions, and cycloheximide and puromycin both stabilize mRNA compared to control reactions without inhibitors (*, p < 0.01, p-values from Student’s t-test). (C) Translation reactions were prepared as in (B), but firefly luciferase protein levels were measured. Very little firefly luciferase production is observed at 10 minutes, but then firefly luciferase accumulates over the remaining time course. Antibiotics consistently reduce luciferase production at all time intervals. (D) Again, translation reactions were prepared as in (B) and (C). Reactions were quenched at 15 min and loaded onto a sucrose gradient for ribosome fractionation. Fractions were collected dropwise, and nucleic acid content was quantified at 260 nm. Absorbances for sequential fractions are plotted. Regardless of treatment, a large 80S monoribosome peak was observed with minimal polyribosome peaks. Therefore, the majority of ribosomes in reticulocyte lysate exist as monoribosomes. (E) Representative fractions from (D) were probed for firefly luciferase mRNA using RT-qPCR. Consistent with the overall profile in (D), the majority of firefly luciferase mRNA can be found in fractions from the top of the gradient (Free RNA) or the 80S monoribosome peak. Minimal, but detectable firefly luciferase mRNA can be isolated from fractions in the polyribosome region of the gradient. These data suggest that most mRNA in reticulocyte lysate is translated by monoribosomes. (F) Proteins from in vitro translation reactions were analyzed by western blotting for firefly luciferase. Only full-length protein was visible (*), indicating that G418 treatment did not cause high rates of stop codon readthrough. Due to its mechanism, it is unlikely that treatment with G418 would affect the total protein level as measured here since it promotes amino acid misincorporation. Altogether, these data suggest that G418 destabilizes mRNA. During our time course assays, we observed an initial wave of protein synthesis during a more continuous reduction in mRNA levels (compare Fig 1B and 1C). We repeated our in vitro translation assays and quenched translation at 15 minutes to overlap with the initial burst in firefly luciferase production while firefly luciferase mRNA levels were decreasing, but not significantly different between reactions (see Fig 1B). We then performed polyribosome sedimentation on these reactions. Polyribosome sedimentation from rabbit reticulocyte lysate has previously been performed, yielding varied results where different groups have observed monoribosomes or polyribosomes engaged in translation [28, 29]. Within our assays, we observe a large monoribosome peak and minimal, if any, polyribosomes lower in the gradient (Fig 1D). It should be noted that we prepared our samples to focus on monoribosome and small polyribosome fractions meaning that our polyribosome sedimentation methodology may exclude very large polyribosome-mRNA complexes. We also isolated RNA and performed RT-qPCR from representative gradient fractions to determine the relative amounts of firefly luciferase mRNA across the gradient. We observed most firefly luciferase mRNA in the monoribosome fraction with very little mRNA in heavier fractions which would correspond to polyribosomes (Fig 1E). These data were consistent with the overall RNA gradient profile. We cannot formally rule out the possibility that G418 promotes ribosome collisions with a rapid loss of a di-ribosome peak, but we do not observe large quantities of di-ribosomes or polyribosomes in vitro. In addition to causing amino acid misincorporation, G418 promotes stop codon readthrough [25]. Since mRNAs with high levels of stop codon readthrough should be degraded by the non-stop decay pathway [30, 31], we tested whether firefly luciferase protein produced in reticulocyte lysate treated with G418 was the proper length. We did not observe detectable levels of extended protein on a western blot (Fig 1F), indicating that minimal stop codon readthrough occurred in translation reactions containing G418. Importantly, G418 drives amino acid misincorporation by the ribosome, and levels of firefly luciferase protein were similar between control reactions and those treated with G418. It is likely that some loss of enzyme activity is due to protein misfolding or loss-of-function due to amino acid substitution. Taken together, our results suggest that G418 can drive higher levels of mRNA decay in vitro. We cannot prove that this effect is independent of ribosome collisions, but our data are more consistent with a role for amino acid misincorporation.

G418 destabilizes mRNAs in mESCs

Our in vitro results confirmed our expectations, but reticulocyte lysate is unusual in that mRNAs are turned over in minutes, rather than hours as has been observed in mammalian cells (discussed in ref. [24]). For this reason, we sought to extend our findings to mESCs. As with our in vitro experiments, we first identified translation inhibitor concentrations that would have a modest effect on total protein synthesis. Here, we focused on puromycin as a control translation inhibitor since it stabilized mRNA levels in our in vitro experiments (Fig 1B), but it functions similarly to G418 in that it does not stall ribosomes on the mRNA during translation [26]. Using azidohomoalanine to label newly-made proteins and Click chemistry to conjugate a fluorophore onto those newly made proteins [32], we identified intermediate concentrations of G418 and puromycin that modestly inhibited translation in mESCs (Fig 2A).
Fig 2

Amino acid misincorporation drives mRNA instability in mESCs.

(A) mESCs were treated with increasing concentrations of G418 and puromycin in the presence of azidohomoalanine (AHA). AHA incorporation was monitored by fluorescence after conjugating AlexaFluor 488 to AHA using Click chemistry. At the indicated concentrations (*), G418 and puromycin both significantly depressed new protein synthesis (p < 0.01, Student’s t-test). (B) SLAM-seq analysis was used to calculate mRNA half-lives in mESCs, comparing control cells to those grown in the presence of G418 (higher amino acid misincorporation rates) and puromycin (abortive translation elongation). Shown are violin plots for ~10,600 mRNA half-lives in the three conditions. P-values (*, p = 1.1 e-5, **, p = 3.3 e-16, and ***, p = 8.9 e-36) were calculated using the Mann-Whitney U-test. (C) Shown are codon stability scores for the fraction of codons in an mRNA correlated with mRNA half-lives. Positive correlations mean that an amino acid codon is more likely to be present in a stable mRNA (Stabilizing) and vice-versa (Destabilizing). Codons are arranged by increasing CSCs for mESCs grown under control conditions, and codon sequences are given in the graph with coloring according to wobble position nucleotide (green are AU3 codons, and purple are GC3 codons). In all cases, mESCs treated under various conditions had similar correlation coefficients, and there is a general trend with stabilizing GC3 codons. (D) mRNAs were divided into G418-sensitive (Sensitive) mRNAs and all other mRNAs (Insensitive) by calculating the ratio between mRNA half-lives in G418-treated versus puromycin-treated mESCs (see Materials and Methods). Then average codon optimality (CSC score) was calculated for each group. There is no significant difference in CSC scores between groups. (E) Similarly, ribosome density (from ref. [28]) was compared for G418-sensitive mRNAs to all other mRNAs. We again observed no difference in average ribosome density.

Amino acid misincorporation drives mRNA instability in mESCs.

(A) mESCs were treated with increasing concentrations of G418 and puromycin in the presence of azidohomoalanine (AHA). AHA incorporation was monitored by fluorescence after conjugating AlexaFluor 488 to AHA using Click chemistry. At the indicated concentrations (*), G418 and puromycin both significantly depressed new protein synthesis (p < 0.01, Student’s t-test). (B) SLAM-seq analysis was used to calculate mRNA half-lives in mESCs, comparing control cells to those grown in the presence of G418 (higher amino acid misincorporation rates) and puromycin (abortive translation elongation). Shown are violin plots for ~10,600 mRNA half-lives in the three conditions. P-values (*, p = 1.1 e-5, **, p = 3.3 e-16, and ***, p = 8.9 e-36) were calculated using the Mann-Whitney U-test. (C) Shown are codon stability scores for the fraction of codons in an mRNA correlated with mRNA half-lives. Positive correlations mean that an amino acid codon is more likely to be present in a stable mRNA (Stabilizing) and vice-versa (Destabilizing). Codons are arranged by increasing CSCs for mESCs grown under control conditions, and codon sequences are given in the graph with coloring according to wobble position nucleotide (green are AU3 codons, and purple are GC3 codons). In all cases, mESCs treated under various conditions had similar correlation coefficients, and there is a general trend with stabilizing GC3 codons. (D) mRNAs were divided into G418-sensitive (Sensitive) mRNAs and all other mRNAs (Insensitive) by calculating the ratio between mRNA half-lives in G418-treated versus puromycin-treated mESCs (see Materials and Methods). Then average codon optimality (CSC score) was calculated for each group. There is no significant difference in CSC scores between groups. (E) Similarly, ribosome density (from ref. [28]) was compared for G418-sensitive mRNAs to all other mRNAs. We again observed no difference in average ribosome density. Next, we sought to globally measure mRNA half-lives in mESCs, and we elected to use SLAM-Seq, a recently published technique that allows pulse-chase analysis with 4-thiouracil which should minimally disrupt protein-RNA interactions and mRNA translation rates [33-35]. Briefly, we pulsed mESCs for one day with 4-thiouracil to accumulate a reservoir of labeled mRNAs and then cultured the mESCs for varied times in the presence of uridine/translation inhibitors for the chase. Since 4-thiouracil mispairs with G after chemical alkylation, U → C conversions are probable sites of 4-thiouracil incorporation that can be detected by sequencing [35]. By quantitating the time-dependent, decreasing fractions of sequencing reads containing U → C conversions, half-lives can be calculated. Under our three growth conditions (control, G418-treated, and puromycin-treated), we were able to determine the half-lives of ~10,300 mRNAs (Fig 2B, S1 Table). Importantly, we observed a destabilizing effect on mRNA half-lives for G418 and a stabilizing effect for puromycin (Fig 2B), consistent with our in vitro results (see Fig 1). It should be noted that effects on mRNA stability were modest, but significant. Higher concentrations of the antibiotics might have elicited a more robust difference in mRNA half-lives, but would have a side-effect of significantly disrupting cellular homeostasis due to loss of protein production. Given that mRNA half-life calculations require time points over multiple hours, we elected to use less disruptive inhibitor concentrations, but this may have weakened our observed effects on mRNA half-lives. That being said, G418 does significantly reduce mRNA half-lives, and this is not a general effect of translation inhibitors since puromycin (Fig 2B) and cycloheximide [3] both increase mRNA stability. Given these initial results, we next correlated mRNA half-lives with codon optimality, both to validate our approach and to ask whether translation inhibition has a mitigating or intensifying effect. Codon Stabilization Coefficients (CSCs) for each codon were calculated using the method in Presnyak et al. [7]. Note that positive CSCs indicate a stabilizing effect, and negative CSCs indicate a destabilizing effect. When organized by CSC score, neither G418 nor puromycin significantly changes CSC values for all codons (Fig 2C), but rather individual correlations are often slightly shifted by the antibiotics. Separately, there is a general trend (with some clear exceptions) between increasing codon optimality and increasing mRNA half-lives consistent with prior publications (see S2 Table and refs. [4-7]), although it should be emphasized that the tRNA adaptation index (tAI) which we use as a metric for codon optimality [5] can vary depending on cellular growth conditions [36]. We next sought to identify a group of mRNAs whose half-lives most responded to G418. We compared mRNA half-lives from G418-treated cells to either control or puromycin-treated cells, focusing on mRNAs whose half-lives progressively decreased when comparing puromycin-treated to control and then G418-treated mESCs (see Materials and Methods). In analyzing G418-sensitive mRNAs, we do not observe a statistically significant difference in codon optimality between G418-sensitive mRNAs and the remaining mRNAs (Fig 2D). Together with Fig 2C, these data confirm the role of individual codons in regulating mRNA stability in mESCs, but also suggest that translation inhibitors regulate mRNA stability via an independent mechanism. The use of translation inhibitors might also suggest that G418-sensitive mRNAs were simply more heavily translated, but this was not the case. Global mRNA translation levels have already been measured in mESCs [37]. Using those data, we confirmed that G418-sensitive mRNAs do not have higher ribosome density compared to insensitive mRNAs (Fig 2E). We also performed Gene Ontology analysis and analyzed G418-sensitive mRNA lengths, neither of which yielded strong differences between G418-sensitive mRNAs and the remaining mRNAs (most significant Gene Ontology category: pre-mRNA splicing, p = 0.0018; mRNA lengths: sensitive—2067 nt, insensitive—2064 nt, p = 0.22). In summary, we do identify a population of G418-sensitive mRNAs, but they are not characterized by differences in codon optimality, ribosome density, length, or encoded protein function. Since codon nucleotide sequences have been correlated with mRNA half-lives, we also sought to correlate codon sequences within mRNA half-lives. Wobble position nucleotides can have stabilizing (GC3) or destabilizing (AU3) effects on mRNA stability [16], so we analyzed all three codon positions for potential stabilizing or destabilizing effects on mRNA half-lives (Fig 3A). Our results are consistent with Hia et al., although we do see greater effects from specific nucleotides such as A in the wobble position, which correlates with greater mRNA instability compared to U. As with codon optimality, G418 and puromycin shift the correlations between wobble position nucleotides and mRNA stabilities, but the effect is modest.
Fig 3

G418 preferentially destabilizes mRNAs with G/C nucleotides in the wobble position.

(A) We calculated the fraction of nucleotides at each codon position and correlated those fractions with mRNA half-lives. Consistent with published results [16], we observed destabilizing effects if the wobble position was occupied with either an A or U. Treatment with G418 or puromycin yielded results that were consistent with control mESCs. (B) We analyzed individual codons to see which were overrepresented or underrepresented in the pool of G418-sensitive mRNAs. Many of the codons with a U in the wobble position and encoding hydrophobic amino acids were underrepresented in the G418-sensitive mRNAs. Additionally, AU3 Asp and AU3 Asn codons were found. These did not consistently align with suboptimal codons. Since the Asp and Asn codons are known to have higher rates of amino acid misincorporation [38], they may act as a sensitized background to observe effects of amino acid misincorporation. Overrepresented codons contained GC3 in the wobble position. Codons were only labeled as overrepresented or underrepresented if p < 0.01 (from a Mann-Whitney U-test).

G418 preferentially destabilizes mRNAs with G/C nucleotides in the wobble position.

(A) We calculated the fraction of nucleotides at each codon position and correlated those fractions with mRNA half-lives. Consistent with published results [16], we observed destabilizing effects if the wobble position was occupied with either an A or U. Treatment with G418 or puromycin yielded results that were consistent with control mESCs. (B) We analyzed individual codons to see which were overrepresented or underrepresented in the pool of G418-sensitive mRNAs. Many of the codons with a U in the wobble position and encoding hydrophobic amino acids were underrepresented in the G418-sensitive mRNAs. Additionally, AU3 Asp and AU3 Asn codons were found. These did not consistently align with suboptimal codons. Since the Asp and Asn codons are known to have higher rates of amino acid misincorporation [38], they may act as a sensitized background to observe effects of amino acid misincorporation. Overrepresented codons contained GC3 in the wobble position. Codons were only labeled as overrepresented or underrepresented if p < 0.01 (from a Mann-Whitney U-test). So, how do G418 and puromycin act? Both significantly change mRNA half-lives, with G418 destabilizing mRNAs and puromycin stabilizing mRNAs (Fig 2B). Since G418 may act at the level of amino acid misincorporation, we hypothesized that certain codons, and thus certain amino acids, would be more sensitive to G418. Rather than focus on all mRNA half-lives, we separated out the G418-sensitive mRNAs for further analysis as above. In doing so, we observed an intersection between codon optimality and nucleotide preferences. All codons enriched in G418-sensitive mRNAs contained G or C in the wobble position, and some were optimal (see Fig 3B and S3 Table). In addition to a G or C in the wobble position, G418-sensitive mRNA codons also contained another G or C in the first or second position. Among codons that were underrepresented in the G418-sensitive mRNAs, the plurality encoded a hydrophobic amino acid with the exceptions being those encoding Asn and Asp. The underrepresented codons for Asp and Asn are known sites of amino acid misincorporation [38]. These codons are likely already destabilizing leading G418 to have a weaker effect on these mRNAs. One caveat with these analyses is the lack of a reporter gene with GC3 or AU3 codons to directly assess the role of G418 and puromycin in regulating mRNA stability, but these would be interesting future analyses. As mentioned above, we do observe that most G418-sensitive mRNAs are enriched for codons with G or C in the wobble position. The structure of a yeast ribosome bound to G418 is solved, and it was observed that G418 promoted near-cognate tRNA accumulation within the ribosomal A site [39]. Prokhorova et al. did not systematically check all A site tRNA:codon pairs, but it is tempting to speculate that G418 may preferentially allow near-cognate tRNA usage with codons containing greater GC content. Ultimately, if near-cognate tRNAs are used in translation, it would be expected to disrupt protein folding. Consistent with a model where protein misfolding may connect to G418’s mode of action, cells treated with G418 are known to contain higher concentrations of protein aggregates [40] and have induced ER stress pathways [41], suggesting that G418 may drive protein misfolding. It is important to note that our in vitro experiments do show that G418 can delay translation elongation, potentially leading to ribosome collisions in vivo. Here, we cannot formally rule out this possibility, but our in vitro assays would favor a model where G418 acts via an independent mechanism, likely at the level of amino acid misincorporation. Taken together, G418 preferentially dampens the protective role of codons containing G/C in the wobble position.

Discussion

To study the connection between translation dynamics and mRNA stability, we used different translation inhibitors with separate modes of action to alter global mRNA stability. Depressing translation elongation with cycloheximide or puromycin leads to enhanced mRNA stability, but targeting the ribosome with an aminoglycoside that drives higher rates of amino acid misincorporation promotes mRNA decay. We observe these effects in vitro as well as in mESCs. In vitro, G418 destabilizes mRNAs that are largely bound by monoribosomes, but can depress translation elongation rates. Our observations are more consistent with a model where G418 operates via amino acid misincorporation, but we cannot exclude the possibility that G418 promotes ribosome collisions. By examining G418-sensitive mRNAs, we observe an enrichment of codons that terminate in a G or C in the wobble position with a concomitant reduction in codons terminating with A or U in the wobble position. Since GC3 codons are often associated with enhanced mRNA stability and AU3 codons with reduced mRNA stability, G418 dampens codon effects at the wobble position. Based on our findings, a key question is why G418 destabilizes mRNAs that are enriched with select GC3 codons. In mESCs, these may be less readily translated. It has been observed that proliferating cells differentially express tRNAs compared to nonproliferating cells [36]. In particular, proliferating cells are enriched for tRNAs that decode AU3 codons whereas nonproliferating cells express higher concentrations of tRNAs that decode GC3 codons [36]. Since our mESCs were cultured to maintain high rates of proliferation, we would expect GC3 codons to be less readily translated. That would increase the probability of near-cognate tRNAs outcompeting cognate tRNAs and could serve as a more sensitive background in which G418 could act. Given that aminoglycoside antibiotics deform the decoding center at the wobble position [39], that might explain the nucleotide bias we observe in G418-sensitive mRNAs. How might G418 promote mRNA instability? In vitro, we observe that G418 likely acts on mRNAs that are bound to single ribosomes. These observations would suggest a connection between protein misfolding and mRNA decay since G418 is known to drive higher error rates in the ribosome. For some time, it has been known that protein misfolding can be coupled to mRNA instability under specific circumstances. When signal sequences are altered, secreted or membrane protein-encoding mRNAs are rapidly and efficiently degraded by the regulation of aberrant protein production pathway [42, 43]. We do not observe that G418-sensitive mRNAs are enriched for secreted or membrane proteins, suggesting an additional cytosolic mechanism connecting protein misfolding to mRNA decay. Ubr1 is a ubiquitin ligase that co-translationally recognizes misfolded proteins and leads to their ubiquitination [44, 45]. It is not known to directly regulate mRNA decay, but it was identified in a complex with one of the major deadenylases in the cell, Ccr4, in a yeast high-throughput screening assay [46]. It is tempting to speculate that G418-sensitive mRNAs are degraded by this or a similar pathway. Importantly, we do observe that G418 can delay translation elongation, and G418 destabilizes mRNAs in vivo. In this setting, it is certainly possible that G418 promotes ribosome collisions which are known to destabilize mRNAs [13-15]. Perhaps ribosome collisions and amino acid misincorporation act synergistically to destabilize mRNAs. This would be an interesting future research question. In summary, we show that G418 treatment leads to mRNA instability, with an implied connection between codon identity and mRNA decay.

Materials and methods

In vitro translation and ribosome sedimentation

18 μL of nuclease-treated rabbit reticulocyte lysate (Promega) was incubated with 0.5 μg of the supplied firefly luciferase mRNA and 1 μL of 1 mM amino acids in a final volume of 20 μL. Where indicated, antibiotics were added at 5.0 ng/μL puromycin, 2.5 ng/μL cycloheximide, and 5.0 ng/μL G418. For reactions with higher concentrations of antibiotics, 50 ng/μL puromycin, 25 ng/μL cycloheximide, and 50 ng/μL G418 were used respectively. Reactions with lower concentrations of antibiotics had 0.5 ng/μL puromycin, 0.25 ng/μL cycloheximide, and 0.5 ng/μL G418. For antibiotic titration experiments, reactions were incubated for 30 min at 30 °C, and for time course experiments, reactions were incubated for the indicated times at 30 °C. In all cases, a zero time point control sample was also prepared and placed on ice. Half the reaction volume was used to determine firefly luciferase protein expression, and the remaining volume was used for RT-qPCR as outlined in the next paragraph. For firefly luciferase protein expression, 40 μL of pre-warmed Luciferase Assay Substrate (Promega) was added. Luminescence was monitored on a Tecan M1000 Pro microplate reader. Background luminescence was calculated by averaging the zero time point samples and subtracted from each non-zero time point. Statistical significance was determined using a Student’s t-test. For ribosome sedimentation, in vitro translation reactions were performed as indicated above. Where indicated, antibiotics were added at 5.0 ng/μL puromycin, 2.5 ng/μL cycloheximide, and 5.0 ng/μL G418. After 15 minutes of incubation, translation reactions were quenched with ribosome homogenization buffer (10 mM Tris, HCl, pH 7.5, 1.5 mM MgCl2, 10 mM KCl, 2 mM DTT, and 100 ng/μL cycloheximide). We quenched reactions at this time point since it corresponded to a period between first production of firefly luciferase and a large burst of firefly luciferase production at 20 minutes while mRNA decay was ongoing. Reactions were then overlaid onto a 10%—50% sucrose step gradient (10 mM Tris, HCl, pH 7.5, 1.5 mM MgCl2, 10 mM KCl, 2 mM DTT with 10%, 20%, 30%, 40%, or 50% sucrose w/v). Gradients were then centrifuged at 39,000 rpm for 3 hrs in a SW41 rotor. Fractions were collected dropwise into the wells of a 96-well plate after puncturing the bottom of the polyallomer centrifuge tube with an 18G needle. Absorbance was then quantified on a NanoDrop spectrophotometer.

RT-qPCR

For RT-qPCR, first total RNA was prepared from the in vitro translation reactions or ribosome sedimentation fractions. In both cases, 200 μL of G25 buffer was added (300 mM NaOAc, 1% SDS, 10 mM Tris, and 1 mM EDTA with pH adjusted to 7.5). For ribosome sedimentation experiments, it was necessary to normalize to a spike-in mRNA control. 20 fmol of in vitro transcribed CFP-encoding RNA was added to provide a normalization control. Samples were mixed and extracted with 300 μL PCA (phenol:chloroform:isoamyl alcohol, 25:24:1). To the supernatant, 1 μL of 5 mg/mL glycogen and 2.5 volumes of ethanol were added. Samples were incubated at -80 °C and pelleted at 14,000 rpm for 15 min. Pellets were washed with 100 μL of ice-cold 70% ethanol and dried. Dried RNA pellets were then resuspended in 10 μL TE buffer (10 mM Tris, 1 mM EDTA with pH adjusted to 7.5). 500 ng of RNA was used for reverse transcription with random nonamers (Sigma) and MMLV reverse transcriptase (Invitrogen) according to the manufacturer’s protocol. For the RT reaction, RNA, water and primers were pre-incubated at 25 °C for 10 min; the remaining reverse transcriptase mixture was added; and reactions were incubated at 42 °C for 1 hr. After reaction, 0.5 μL of RNase H (Invitrogen) was added, and reactions were incubated for 15 min at 37 °C. qPCR reactions were prepared using iTAQ Universal SYBR Green Supermix (Bio-Rad) and gene-specific primers (rabbit 18S rRNA primers (3′ end): CCAAATGTCTGAACCTGCGG and GTGAAGCAGAATTCACCAAGC, firefly luciferase primers (in CDS): TCTTGCGTCGAGTTTTCCGG and GCACGGAAAGACGATGACGG, CFP primers (in CDS): AGATGCCACGTACGGGAAAC and AATCGTGCTGTTTCATGTGG). qPCR reactions were monitored on a Bio-Rad CFX Connect Real-Time System (Bio-Rad) with a 56 °C annealing temperature. Quantitation was performed by the ΔΔCq method. As above, statistical significance was determined using a Student’s t-test.

Western blotting

In vitro translation reactions were prepared as indicated above. Where indicated, antibiotics were added at 5.0 ng/μL puromycin, 2.5 ng/μL cycloheximide, and 5.0 ng/μL G418. Reactions were then separated on an 8% SDS-PAGE gel and western blotted for firefly luciferase (Mouse monoclonal antibody, CS 17, Invitrogen).

Azidohomoalanine labeling

mESCs were cultured in methionine-free, ESGRO 2i medium (Millipore) with antibiotics (1, 0.5, 0.1, and 0.05 μg/mL puromycin or 1, 0.5, 0.1, and 0.05 μg/mL G418) for 4 hrs. Azidohomoalanine was added at 25 μM to the medium during the incubation period [35]. mESCs were harvested as above, and cell pellets were resuspended in lysis buffer (50 mM Tris, 0.1% SDS with pH adjusted to 8.0). Proteins were labeled with Alexa 488-alkyne and the Click-iT Protein Reaction Buffer Kit according to the manufacturer’s protocol (Thermo Fisher). After reaction, proteins were precipitated with two volumes of ice-cold acetone, and pellets were resuspended in 100 μL PBS containing 8 M urea. Fluorescence was measured in a microplate reader (M1000 Pro, Tecan).

mESC culture and SLAM-Seq

Mouse embryonic stem cells (E14Tg2a, ATCC) were cultured in ESGRO-2i medium (Millipore) to maintain pluripotency with daily medium exchanges under standard growth conditions [47]. When appropriate, mESCs were passaged using ESGRO Complete Accutase (Millipore) according to manufacturer’s instructions. 100 μM 4-thiouracil (Sigma) was incubated with the cells over a 24 hour period as described [35] except medium was exchanged every 8 hours. Medium containing antibiotics (0.1 μg/mL puromycin or 0.1 μg/mL G418) along with uridine (at 10 mM, Sigma) was added during the chase period, and cells were harvested at various time points (0, 1, 2, 4, 8, and 24 hrs after medium change) with two replicates per sample. For harvesting, mESCs were first washed one time in PBS and then treated with ESGRO Complete Accutase (Millipore) before centrifugation at 500 g for 2 min. Cell pellets were washed 2 times in PBS, and the pellets were frozen in liquid nitrogen for storage. For SLAM-Seq analysis, Trizol reagent was used to prepare total RNA from mESCs labeled with 4-thiouracil according to the manufacturer’s instructions (Invitrogen). RNAs were then alkylated as previously described using iodoacetamide [35]. Paired end RNA sequencing was then performed by Genewiz using an Illumina HiSeq 2000. Sequencing reads were then aligned to the mouse transcriptome using the Bowtie2 algorithm [48] and the mm10 reference genome. Once aligned, custom scripts were used to analyze alignment files for U → C conversion, and the fraction of reads containing converted U were calculated for each mRNA (see custom scripts). The fractions of labeled transcripts were then fit to an exponential decay curve to calculate mRNA half-lives.

Half-life analysis

Again using custom scripts, we first calculated codon optimality for every mRNA in our dataset according to ref. [7]. Using the Scipy package, we then calculated a Pearson correlation coefficient between codon optimality and mRNA half-lives. For nucleotide position analysis, we calculated the fraction of codons containing a specific nucleotide at each of the three codon positions, and as above, we calculated Pearson correlation coefficients for these fractions and mRNA half-lives. To identify the G418-sensitive mRNAs, we calculated the ratio of G418-treated mESC mRNA half-life to puromycin-treated half-life for every mRNA. mRNAs that had half-lives two-fold lower in G418-treated mESCs relative to puromycin-treated cells were further evaluated. Those mRNAs whose half-lives were greatest in puromycin-treated cells, an intermediate value in control cells, and lowest in G418-treated cells were labeled as G418-sensitive. In analyzing these mRNAs for codon optimality, codon composition, and codon nucleotide sequences, we used the Mann-Whitney U-test to determine p values comparing G418-sensitive mRNAs to the remaining mRNAs.

G418 can delay translation elongation.

(A) Rabbit reticulocyte lysate was used to translate an mRNA encoding firefly luciferase in the presence of high concentrations of translation inhibitors (50 ng/μL G418, 25 ng/μL cycloheximide, or 50 ng/μL puromycin). Translation reactions were incubated for the indicated time points, and firefly luciferase protein levels were measured by luminescence. Very little firefly luciferase production is observed at 10 minutes, but then firefly luciferase accumulates over the remaining time course. Antibiotics consistently reduce luciferase production at all time intervals, but G418 and cycloheximide both delay the onset of firefly luciferase protein production. This is best observed in (B) where control reaction data are removed from the plot. At 10 min, almost no firefly luciferase protein is observed in reactions with G418 or cycloheximide, but reactions with puromycin do exhibit firefly luciferase protein. By 30 minutes, all three inhibitors yield similar levels of firefly luciferase protein. These data suggest G418 and cycloheximide detectably delay translation elongation at higher inhibitor concentrations. (EPS) Click here for additional data file.

SLAM-Seq mRNA half-lives.

mRNA half-lives from the SLAM-Seq protocol are reported. Transcript identifiers are given along with mRNA half-lives calculated according to ref. [35]. mESCs were cultured either under control conditions (ESGRO 2i medium, Millipore) or in ESGRO 2i medium containing 0.1 μg/mL G418 or puromycin with half-lives calculated in minutes. All results were determined using two biological replicates, corresponding to 6 total samples. The average number of sequencing reads used to calculate each mRNA half-life are given in the final column. (XLSX) Click here for additional data file.

Codon stability scores for individual codons.

Individual codons are listed with calculated CSC scores for mRNA half-lives determined using the SLAM-Seq protocol. mESCs were cultured under control conditions or were treated with 0.1 μg/mL G418 or puromycin as indicated. Note that negative values indicate codons that are destabilizing whereas positive values indicate codons that are stabilizing. Codon adaptation indices are given to reflect codon optimality where low values indicate suboptimal codons, and higher values indicate more optimal codons. Lastly, the wobble position nucleotide is separated out to show that most codons with negative CSC values end in A or U, whereas stabilizing codons more often end in G or C. (XLSX) Click here for additional data file.

G418-sensitive mRNAs are enriched for specific codons.

The raw data are provided corresponding to Fig 3B. The average percentage of individual codons are given in the G418-sensitive and insensitive mRNAs. A Mann-Whitney U-test was used to compare the distribution of codon percentages in the G418-sensitive and insensitive mRNAs, with p-values indicated. (XLSX) Click here for additional data file. 17 Feb 2022
PONE-D-22-00848
Amino acid misincorporation reduces mRNA stability
PLOS ONE
Dear Dr. Friend, Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process. Below you will find evaluation of three reviewers who all agree that the manuscript presents experimental data that addresses an important question and will be a valuable contribution. However, the reviewers also express significant concerns about the experimental approach, data analysis, data presentation, data interpretation and overall conclusions. We invite you to revise your manuscript in light of these comments. Here are some key points that should be addressed in the revision: As reviewers also emphasize, there is no direct evidence provided in the manuscript for link between amino acid misincorporation and mRNA stability. The observations described can be explained via alternative models. Thus, the current title and undue focus on this one mechanism is unwarranted. Either more direct evidence will be needed to support the current model, or the title and text should be extensively revised to present a more balanced interpretation of data reported in the manuscript. In any scenario, various possible modes by which translation can impact mRNA stability should be discussed. New experiments have been suggested to obtain data for more direct support of the conclusions regarding G418 effects on mRNA stability in a codon dependent manner (reviewer 1, comments 2 and 3; reviewer 2, major comment 2). One possible way to address this could be to perform new experiments focused on select G418 sensitive and insensitive RNAs. Another possibility is to acknowledge the lack of direct evidence for such a mechanism and extensively revise the conclusions while clearly stating limitations of the data and possible alternate explanations for the observations. Both reviewer 1 and 2 point out the need to address the discrepancy between small effect on luciferase activity but significant impact on reporter RNA stability by intermediate levels of G418. Reviewer 2 suggests a possible source of this discrepancy that can be experimentally tested. Another way to address this issue could be to note this discrepancy with a discussion of possible caveats and limitations of the experimental approach. Both reviewers 2 and 3 express concerns about data analysis and data presentation. All comments concerning these issues should be addressed with more thorough analysis of the available data and its appropriate presentation so that data on which conclusions are based is readily accessible to readers. In addition, all other comments should be carefully considered to revise the manuscript accordingly. A point-by-point response to reviewer’s concerns should be included in the revised submission. Please submit your revised manuscript by Apr 03 2022 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. Please include the following items when submitting your revised manuscript:
A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'. If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter. If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols. We look forward to receiving your revised manuscript. Kind regards, Guramrit Singh Academic Editor PLOS ONE Journal Requirements: When submitting your revision, we need you to address these additional requirements. 1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf 2. Thank you for stating the following in the Acknowledgments Section of your manuscript: "We thank the Jeffress Memorial Trust for funding this research (to K.F.). Y.D., A.S., and K.F. designed and performed experiments. A.S. and K.F. wrote this manuscript with support from Y.D." We note that you have provided funding information. However, funding information should not appear in the Acknowledgments section or other areas of your manuscript. We will only publish funding information present in the Funding Statement section of the online submission form. Please remove any funding-related text from the manuscript and let us know how you would like to update your Funding Statement. Currently, your Funding Statement reads as follows: "K. Friend Jeffress Memorial Trust https://hria.org/tmf/jeffress/ NO" Please include your amended statements within your cover letter; we will change the online submission form on your behalf. 3. We note that you have stated that you will provide repository information for your data at acceptance. Should your manuscript be accepted for publication, we will hold it until you provide the relevant accession numbers or DOIs necessary to access your data. If you wish to make changes to your Data Availability statement, please describe these changes in your cover letter and we will update your Data Availability statement to reflect the information you provide. 4. Please include captions for your Supporting Information files at the end of your manuscript, and update any in-text citations to match accordingly. Please see our Supporting Information guidelines for more information: http://journals.plos.org/plosone/s/supporting-information. [Note: HTML markup is below. Please do not edit.] Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Partly Reviewer #2: Partly Reviewer #3: Partly ********** 2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: Yes Reviewer #2: Yes Reviewer #3: Yes ********** 3. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes Reviewer #2: Yes Reviewer #3: Yes ********** 4. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes Reviewer #2: Yes Reviewer #3: Yes ********** 5. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: The article titled “Amino acid misincorporation reduces mRNA stability” by Durmaz et al., addresses an important aspect of RNA Biology. Earlier reports suggest the role of codon optimality and codon sequences in determining mRNA stability. Here the authors tried to suggest a hypothesis where the mRNA stability is affected by misincorporation of amino acid during the process of translation. In this article the authors mimicked the process of amino acid misincorporation using G418 (Geneticin). They further hypothesize that misincorporation of amino acid by ribosome leads to misfolded protein response resulting in protein degradation, where authors wanted to connect this process with mRNA stability. The article addresses an interesting question and can be considered for publication. However the following issues need to be addressed. Major comments: 1. G418 treatment reduced the stability of firefly luciferase mRNA in vitro (Figure 1 B). But it did not affect the protein level of firefly luciferase in Figure 1C. It is unclear why this would be the case and authors did not comment about the same. 2. To strengthen the hypothesis proposed by author connecting G418 treatment and mRNA stability, it would be important to test and validate the stability of couple of G418 sensitive mRNA targets with specific codon features. 3. To confirm that amino acid mis-incorporation leads to ribosome slow-down and affect mRNA stability. An important experiment could be to express firefly luciferase mRNA containing optimal codons and non-optimal codons in vivo, check for its translation and stability. Reviewer #2: In this manuscript, Durmaz YT, Shatadal A and Friend K, studied the impact of different translation inhibitors on modulating mRNA stability in vitro and in mouse embryonic stem cells. Using an in vitro translation system programmed with a luciferase reporter mRNA in the presence of G418 (an aminoglycoside that alters translation elongation and termination), cycloheximide (which interferes with the translocation step and blocks elongating ribosomes on the mRNA) or puromycin (an aminonucleoside that induces premature chain termination, releasing elongating ribosomes from the mRNA), the authors measured transcript stability in a 30 minutes time course. Their results indicate a significant stabilization of the reporter mRNA in the presence of cycloheximide and puromycin (compared to the untreated control), while G418 leads to accelerated mRNA degradation (compared to the untreated control). Slam-seq experiments performed in mouse embryonic stem cells validate their in vitro results, showing a global stabilization of cellular transcripts when cells are incubated in puromycin, while incubation with G418 is associated with transcript destabilization. Calculation of codon stabilization coefficients (CSCs) using the Slam-seq datasets from control cells also recapitulates previous findings obtained in other cell-types and in particular the observed GC content bias for stabilizing and destabilizing codons described in Hia et al 2019. Interestingly, addition of puromycin or G418, although having an impact on global mRNA stability, does not appear to significantly affect the CSCs values, even though a small effect is apparent on most codons. Finally, analysis of codon usage on G418-sensitive mRNAs revealed an enrichment of codons with G or C in the wobble position, which are typically stabilizing codons. Furthermore, codons under-represented in the G418-sensitive mRNAs correspond to hydrophobic amino-acids. Based on their results and in ribosome crystal structures obtained in the presence of G418, the authors conclude that G418 could preferentially affect near-cognate tRNA usage in GC rich codons leading to increase amino-acid mis-incorporation and inducing mRNA degradation. Overall, the manuscript is very well written. The introduction is well documented and relevant to the study as it allows readers to place the study in the current context of the field while highlighting open questions that have not been addressed yet. The authors have generate an interesting dataset using the state-of-the-art Slam-seq protocol. However, the analyses performed on this dataset are sometimes cryptic and superficial and could be largely improved. Moreover, there is room for improving the overall clarity of the figures to facilitate the interpretation of the results by readers. Below you will find some major and minor points that, in my opinion, should be addressed by the authors. Major points: - I am surprised that the low concentrations of translation inhibitors used in the in vitro time course (Figure 1B), have such a profound impact on the reporter mRNA stability while leading to a decrease of less than 10% of the luciferase activity at 30 minutes as shown in Figure 1A. This could be due to the accumulation of most of the luciferase protein during the first minutes of the translation reaction followed by a plateau in its abundance at later points. It would therefore be important for the authors to include a new time-course figure where firefly luciferase is measured for each sample at each time-point so readers can compare the dynamics of mRNA levels and protein accumulation. - Authors decided to perform the Slam-seq protocol in the presence of small amounts of G418 or Puromycin which have modest effects on total translation rates (20% inhibition based on the results presented in Figure 2A). It is therefore not surprising that the effects obtained are very mild. Although translation is an important determinant of mRNA stability, it is probable that only a small fraction of all translating ribosomes are involved in inducing mRNA degradation. It would be interesting to include an additional experiment using a higher concentration of G418 in the analysis to obtain a clearer and robust picture of the impact of G418 on codon-dependent mRNA stability. I also think it would be important to perform a sucrose gradient experiment at the different doses of translation inhibitors to look at their effect on the polysome profile. In any case, contrary to what it is stated in the results section, I do not think (at least for puromycin) that the effect of the translational inhibitors on modulating mRNA stability are independent from codon optimality. There is robust evidence from the work of Olivia Rissland and Ariel Bazzini laboratories showing that translation inhibition leads to a loss of the effect of codon-optimality on mRNA stability. - Figure 2B: Instead of displaying a bar plot with the half-lives of cellular transcripts, it would be preferable to use a density plot so readers can have a clearer view of the distribution of half-lives in each condition. - G418-sensitive transcripts were obtained by calculating the ratio of mRNA half-lives in the G418 treated samples against Puromycin-treated samples (as described in the Material and Methods section). I supposed this was done to maximize the difference in half-lives since the effect of each drug are mild compared to the control condition. However, this strategy might introduce a bias as puromycin also has a small effect on CSC values which are different from that of G418. In my opinion it would be preferable to use the control condition to identify G418-sensitive transcripts. I also think that authors should show a plot with the distribution of the obtained ratios and the two-fold cutoff chosen to define G418-sensitive transcripts. - Are G418-sensitive transcripts enriched in a specific functional category? Are transcripts with the longer open reading frames more sensitive to G418 since they will potentially accumulate more mis-incorporated amino-acids in their nascent chains? Is the Ribosome-associated quality control machinery recruited to polysomes upon G418 incubation? - Figure 3B is an important figure supporting one of the main biological findings of the manuscript. However, it lacks any quantitative aspect of the degree of codon enrichment and depletion among G418-sensitive transcripts. Table1, which should contain the supporting raw information for the figure lacks a header to describe what each column corresponds to. The authors should include the name of each column in the supplementary table and show a plot displaying the extent of codon enrichment and depletion among G418-sensitive transcripts compared to the mean values of codon frequency obtained from a set (of similar number) of randomly chosen transcripts among the G418-insensitive transcripts (random sampling with replacement). Authors should also indicate in the figure which codons correspond to hydrophobic amino-acids. Minor comments: - Authors mention in the introduction that the more prevalent codons are typically decoded by the more abundant tRNAs. Although this is the case in some bacteria species as well as in yeast and some metazoans such as C.elegans, it is not the case in mammals (this reference is a good evidence for the lack of translational selection in organisms with large genomes and a small set of tRNA coding genes https://academic.oup.com/nar/article/32/17/5036/1333956). The sentence should therefore be corrected to indicate that in some organisms, but not all, there is a correlation between codon occurrence in the transcriptome and tRNA abundance. - The concentrations of each translation inhibitor tested in Figure 1A and Figure 1B should be mentioned in the legend or directly in the plot and not only in the Material & Methods section. The authors should also clearly confirm that the lowest translation inhibitor concentrations described in figure 1A (5ng/µl of Puromycin, 2.5ng/µl of cycloheximide and 5ng/µl of G418) are the ones used in Figure 1B. - Figure 2B. The choice of symbols to display the p-values corresponding to the comparison of the mRNA half-lives between the different conditions tested is misleading because the number of stars is usually correlated to the p-value (p-value *>**>***). The authors should change their nomenclature and either choose a different color for each comparison made or directly display the associated p-value in the chart. - Figure 2C. Authors should display the codon sequence corresponding to each barplot (or prepare a heat map with the sequence of each codon and the corresponding CSC-value for each condition tested). This would allow readers to clearly see if AU rich or GC rich codons are enriched among positive or negative CSCs. Reviewer #3: Manuscript Number: PONE-D-22-00848 Full Title: Amino acid misincorporation reduces mRNA stability Although I disagree with the author’s interpretation of their data (see major concern 1), this paper is a quality submission by an established RNA researcher and two undergraduate student co-authors. The manuscript is generally well written and provides data useful to the field. In this submission, the authors use different doses of translation inhibitors to interrogate their effect(s) on mRNA stability. The core of their argument is that the use of different doses of G418, which has been shown to increase the misincorporation of amino acids, would offer a window into how cellular RNA surveillance mechanisms would survey and ‘deal with’ RNAs where the ribosome incorporates an incorrect amino acid. The use of in vivo labeling (SLAM-Seq) is appropriate and helps make their case that the effect is at the RNA level. Major Concerns: 1. This reviewer’s dominant concern is related to the mechanism proposed to explain the observations. I wonder why the authors invoke a protein-folding mechanism via Ubr1-CCR4/NOT complex as the method for RNA turnover. They could have a stronger case for this logic if they had data or cited papers that demonstrate that their G418 conditions yielded consistent and common misincorporation of incorrect amino acids (therefore suggesting a misfolded protein-driven mechanism). Further, in this reviewer’s opinion, the link between codon optimality and protein misfolding is tenuous and they offer no direct data or references to strengthen it. Frankly, I think that the authors’ protein folding-targeted explanation in the discussion is not supported. In the eyes of this reviewer, the authors are wrong to neglect mentioning ribosome collisions (see many papers by the Green, Hegde, Zaher and several other labs) as the likeliest mechanism for the observed RNA instability. To this reviewer, their RNA-based codon optimality data perfectly support such a mechanism without the need to include protein folding. Further, these data fit well with previously published ribosome collision literature which show that slowing the rate of ribosome elongation (say by A-site competition or by multiple imperfect wobble pairing codons in a row) cause ribosome collisions and RNA degradation. Therefore, it could offer an important insight into another mechanism by which ribosome collisions can be studied. I urge the authors to read papers from this sub-field of RNA biology, then reconsider their data from this viewpoint, and adjust the introduction and discussion to reflect that they have considered this possibility. As an alternate (or complimentary) course, I would also welcome a robust defense of the proposed protein folding mechanism as the cause of RNA instability. 2. In the eyes of this reviewer, the data are sound. My only question is why is some of it being held back? For example, the authors do SLAM-seq, but they only report a small scrap of the data (limited to Fig 2b) even though half-lives were determined for over 10000 mRNAs. Why not report these data either whole or in part (limit it to mRNAs enriched in under- or over-represented codons?) as supplementary tables in this manuscript? Such data could be very useful to the broader community. At least a rationale for this omission should be offered. 3. The text, legend, and figure pertaining to figure 3 were confusing to this reviewer. It appears as if the color coding was incorrect or the descriptions are mis-assigned. Lines 490-91 state that U wobble codons are overrepresented, but the color codes show them as underrepresented. Since getting that correct is critical for interpreting the data, this needs to be corrected and the text must be adjusted to account for the changes. 4. The organization of the supplementary tables needs to be greatly improved. First, add an extra sheet as the first sheet which functions essentially as both a table of contents and as a brief summary of the worksheets in the table (since it has two sheets). Second, the tabs for each worksheet in the xls table should be titled the table. Third, the worksheets need column headings Minor points: 1- Several citations (for lines 78,79 is just one example) are missing. Please add them as needed. 2- please break up the results section by using section headings to help organize the results by the key findings. 3- Changing figure 2C by including the actual codon identities in their codon optimality map would be VERY helpful. Currently, it’s impossible to determine which of the 61 codons is best/worst or anything in between. 4- Description of the western blot are missing in the methods. Please add 5- How was the loading of the western blots normalized? Please describe in methods and or legend. 6- The number of replicates is not listed for all experiments. Please correct. 7- For better readability, the total protein description of method (AHA/click seq) should be presented separately from the 4-thiouracil method. 8- How do we know is the number of cells remains the same and the effect is not the cells being dead or a variability of cell number. 9- For tAI experiment, please explain why the comparison was performed between puro and G418 and not with the control experiment? 10- Violin plots would be much more informative for the data presented in figures 2B, D and E. 11- Fig 2B: How many time points were used for SLAM-Seq experiments? How many replicates were performed? Although the P-value showed significant difference between Control, G418, and puromycin-treated samples, the standard deviation values were quite high. 12- Fig 1B: The authors should indicate where the primers located, are they at 3’, 5’ or CDS? (since the qPCR results may be affected by the positions of primers.) 13- Fig 1C: The authors should indicate if they used different amounts of rabbit reticulocyte lysate or antibiotics. In case different amounts of G418 were used, the authors did not explain why the firefly protein increased while the mRNA got destabilized after 30 mins reaction. 14- The authors should also provide something akin to a future direction in the discussion. For example, Selected reporter genes (ID’d by the SLAM-seq data) containing overrepresented and underrepresented codons found in fig 3 should be assayed using Northern Blotting and polysome gradient followed by Western Blotting in the condition with and without G418 to validate the conclusion that G418 acts preferentially on codons with G or C in the wobble position. a. Please note that I’m NOT suggesting that the authors must do this for publication. Such experiments would be a great set of follow-up experiments, but in my opinion would be beyond the scope of this focused manuscript. 15- Adding 3 Vertical lines to separate the groups in Figure 3A would be very helpful (A 1,2,3 /line/ C 1,2,3 /line/ G 1,2,3 /line/ U 1,2,3). (This is best shown by C3 and G1 which look like they belong together.) 16- Bold your figure legend titles for each figure. 17- the scale on figure 3A would benefit by the inclusion of more 'ticks' and/or color-coding to show where the values are. Vocabulary & grammar (there are several others not listed here) - Line 62: “selected” instead of “select” - Line 77: “A sites” instead of “A, sites” - Line 80: not sure what binding the authors mentioned. - Line 277: Is it ESGRO-2i medium? - In line 463 use OR (not and) since you don't do the double inhibitor As a final aside, this reviewer has evaluated R15 grants as a study section member. If the PI is considering applying for such a grant mechanism, then including language similar to the below in the acknowledgements section of this and every published paper from their lab would aid their application by establishing their undergraduate-focused ‘training bona fides’ for the review process. “YTD and AS are undergraduate student trainees majoring in _____ at Washington and Lee University and were mentored by KF during this project.” ********** 6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #2: No Reviewer #3: No [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step. 8 Apr 2022 Editorial Comments: As reviewers also emphasize, there is no direct evidence provided in the manuscript for link between amino acid misincorporation and mRNA stability. The observations described can be explained via alternative models. Thus, the current title and undue focus on this one mechanism is unwarranted. Either more direct evidence will be needed to support the current model, or the title and text should be extensively revised to present a more balanced interpretation of data reported in the manuscript. In any scenario, various possible modes by which translation can impact mRNA stability should be discussed. Reviewer 3 make a key point about ribosomal collisions as another potential mechanism, and we now discuss that possibility in the revised text. We have also performed in vitro experiments to show that most luciferase mRNA in reticulocytes is bound to monoribosomes and that G418 can delay translation elongation rates (although at higher concentrations than those used to decrease mRNA stability). These data are more consistent with a model involving amino acid misincorporation, although we cannot completely rule out ribosomal collisions. We make those conclusions in the revised text and discuss both possibilities in the Discussion. Here, we do not point to specific lines of text since these changes are made throughout the manuscript. New experiments have been suggested to obtain data for more direct support of the conclusions regarding G418 effects on mRNA stability in a codon dependent manner (reviewer 1, comments 2 and 3; reviewer 2, major comment 2). One possible way to address this could be to perform new experiments focused on select G418 sensitive and insensitive RNAs. Another possibility is to acknowledge the lack of direct evidence for such a mechanism and extensively revise the conclusions while clearly stating limitations of the data and possible alternate explanations for the observations. Unfortunately, we are unable to perform the suggested experiments in this short time frame. As suggested above, we have both acknowledged the lack of direct evidence here. Amended text can be found in lines 256-258. Both reviewer 1 and 2 point out the need to address the discrepancy between small effect on luciferase activity but significant impact on reporter RNA stability by intermediate levels of G418. Reviewer 2 suggests a possible source of this discrepancy that can be experimentally tested. Another way to address this issue could be to note this discrepancy with a discussion of possible caveats and limitations of the experimental approach. Reviewer 2 suggested performing a time-course analysis for G418, which we now include in our revised manuscript. As suggested, firefly luciferase accumulates in a large burst toward the end of our time course. These data are presented in figure 1C, and we have included our interpretation of these results in lines 130-136. Both reviewers 2 and 3 express concerns about data analysis and data presentation. All comments concerning these issues should be addressed with more thorough analysis of the available data and its appropriate presentation so that data on which conclusions are based is readily accessible to readers. These revisions were extensive, and we respond to each comment below. In summary, we have attempted to more thoroughly analyze the data and alter its presentation (where suggested) to make it more accessible. Reviewer #1: The article titled “Amino acid misincorporation reduces mRNA stability” by Durmaz et al., addresses an important aspect of RNA Biology. Earlier reports suggest the role of codon optimality and codon sequences in determining mRNA stability. Here the authors tried to suggest a hypothesis where the mRNA stability is affected by misincorporation of amino acid during the process of translation. In this article the authors mimicked the process of amino acid misincorporation using G418 (Geneticin). They further hypothesize that misincorporation of amino acid by ribosome leads to misfolded protein response resulting in protein degradation, where authors wanted to connect this process with mRNA stability. The article addresses an interesting question and can be considered for publication. However the following issues need to be addressed. Major comments: 1. G418 treatment reduced the stability of firefly luciferase mRNA in vitro (Figure 1 B). But it did not affect the protein level of firefly luciferase in Figure 1C. It is unclear why this would be the case and authors did not comment about the same. Based on its probable mechanism, we expect G418 to have a more pronounced effect on enzyme activity than protein levels since it promotes amino acid misincorporation. Therefore, it could be the case that the modest defect in luciferase activity is not fully born out at the protein level. We have included this language in the figure legend for Fig. 1F (originally Fig. 1C) and in lines 166-169. 2. To strengthen the hypothesis proposed by author connecting G418 treatment and mRNA stability, it would be important to test and validate the stability of couple of G418 sensitive mRNA targets with specific codon features. It is possible to perform these experiments with engineered reporter mRNAs whose transcription can be downregulated, but we are unable to do such experiments rapidly. As suggested by the editor, we have amended the text to discuss the limitations of the SLAM-Seq experiment in lines 256 – 258. 3. To confirm that amino acid mis-incorporation leads to ribosome slow-down and affect mRNA stability. An important experiment could be to express firefly luciferase mRNA containing optimal codons and non-optimal codons in vivo, check for its translation and stability. This is an excellent experiment, although extremely challenging. We do show in our revised manuscript that G418 can delay translation elongation rates, consistent with the effect of cycloheximide. A more formal proof that codon biases lead to defects in elongation rates requires engineering new luciferase constructs to test this hypothesis. Due to time constraints, we are unable to do these additional analyses. As discussed in our response to the editor, we now more formally outline the limitations of our assays and provide these explanations as alternate interpretations of our results. The relevant lines of text are 128 – 145. Reviewer #2: In this manuscript, Durmaz YT, Shatadal A and Friend K, studied the impact of different translation inhibitors on modulating mRNA stability in vitro and in mouse embryonic stem cells. Using an in vitro translation system programmed with a luciferase reporter mRNA in the presence of G418 (an aminoglycoside that alters translation elongation and termination), cycloheximide (which interferes with the translocation step and blocks elongating ribosomes on the mRNA) or puromycin (an aminonucleoside that induces premature chain termination, releasing elongating ribosomes from the mRNA), the authors measured transcript stability in a 30 minutes time course. Their results indicate a significant stabilization of the reporter mRNA in the presence of cycloheximide and puromycin (compared to the untreated control), while G418 leads to accelerated mRNA degradation (compared to the untreated control). Slam-seq experiments performed in mouse embryonic stem cells validate their in vitro results, showing a global stabilization of cellular transcripts when cells are incubated in puromycin, while incubation with G418 is associated with transcript destabilization. Calculation of codon stabilization coefficients (CSCs) using the Slam-seq datasets from control cells also recapitulates previous findings obtained in other cell-types and in particular the observed GC content bias for stabilizing and destabilizing codons described in Hia et al 2019. Interestingly, addition of puromycin or G418, although having an impact on global mRNA stability, does not appear to significantly affect the CSCs values, even though a small effect is apparent on most codons. Finally, analysis of codon usage on G418-sensitive mRNAs revealed an enrichment of codons with G or C in the wobble position, which are typically stabilizing codons. Furthermore, codons under-represented in the G418-sensitive mRNAs correspond to hydrophobic amino-acids. Based on their results and in ribosome crystal structures obtained in the presence of G418, the authors conclude that G418 could preferentially affect near-cognate tRNA usage in GC rich codons leading to increase amino-acid mis-incorporation and inducing mRNA degradation. Overall, the manuscript is very well written. The introduction is well documented and relevant to the study as it allows readers to place the study in the current context of the field while highlighting open questions that have not been addressed yet. The authors have generate an interesting dataset using the state-of-the-art Slam-seq protocol. However, the analyses performed on this dataset are sometimes cryptic and superficial and could be largely improved. Moreover, there is room for improving the overall clarity of the figures to facilitate the interpretation of the results by readers. Below you will find some major and minor points that, in my opinion, should be addressed by the authors. Major points: - I am surprised that the low concentrations of translation inhibitors used in the in vitro time course (Figure 1B), have such a profound impact on the reporter mRNA stability while leading to a decrease of less than 10% of the luciferase activity at 30 minutes as shown in Figure 1A. This could be due to the accumulation of most of the luciferase protein during the first minutes of the translation reaction followed by a plateau in its abundance at later points. It would therefore be important for the authors to include a new time-course figure where firefly luciferase is measured for each sample at each time-point so readers can compare the dynamics of mRNA levels and protein accumulation. As discussed in response to Reviewer 3, we have now included the suggested time course. - Authors decided to perform the Slam-seq protocol in the presence of small amounts of G418 or Puromycin which have modest effects on total translation rates (20% inhibition based on the results presented in Figure 2A). It is therefore not surprising that the effects obtained are very mild. Although translation is an important determinant of mRNA stability, it is probable that only a small fraction of all translating ribosomes are involved in inducing mRNA degradation. It would be interesting to include an additional experiment using a higher concentration of G418 in the analysis to obtain a clearer and robust picture of the impact of G418 on codon-dependent mRNA stability. I also think it would be important to perform a sucrose gradient experiment at the different doses of translation inhibitors to look at their effect on the polysome profile. In any case, contrary to what it is stated in the results section, I do not think (at least for puromycin) that the effect of the translational inhibitors on modulating mRNA stability are independent from codon optimality. There is robust evidence from the work of Olivia Rissland and Ariel Bazzini laboratories showing that translation inhibition leads to a loss of the effect of codon-optimality on mRNA stability. This is a great point, and you are right that we used lower translation inhibitor concentrations in our study. Our goal was to inhibit translation, but not to such a degree that cells would senesce over the course of the experiment. Reanalyzing the data with higher concentrations of inhibitors would likely lead to off-target and nonspecific effects. To better understand ribosome dynamics in the presence of the inhibitors, we have performed polysome analysis, but using our in vitro system. We have also further characterized that system where it is possible to add a variety of translation inhibitor concentrations with less concern about off-target effects. Those results are reported in Figs. 1C – E and S1. The relevant figures are discussed in lines 128-160. - Figure 2B: Instead of displaying a bar plot with the half-lives of cellular transcripts, it would be preferable to use a density plot so readers can have a clearer view of the distribution of half-lives in each condition. Reviewer #3 suggested violin plots, so we have altered Figure 2, panels B, D, and E appropriately. - G418-sensitive transcripts were obtained by calculating the ratio of mRNA half-lives in the G418 treated samples against Puromycin-treated samples (as described in the Material and Methods section). I supposed this was done to maximize the difference in half-lives since the effect of each drug are mild compared to the control condition. However, this strategy might introduce a bias as puromycin also has a small effect on CSC values which are different from that of G418. In my opinion it would be preferable to use the control condition to identify G418-sensitive transcripts. I also think that authors should show a plot with the distribution of the obtained ratios and the two-fold cutoff chosen to define G418-sensitive transcripts. Our goal with using the puromycin treatment was to look at a condition where translation inhibition was stabilizing, rather than destabilizing. Many factors regulate mRNA stability, so with this comparison, we desired to focus on translation itself. That being said, the point is well-taken. We have revised the criteria defining G418-sensitive mRNAs to now include control reactions. In summary, we defined G418-sensitive mRNAs as those whose mRNA stabilities are highest in puromycin-treated cells, intermediate in control cells and lower in G418-treated cells. We still use the two-fold difference in mRNA half-lives between puromycin-treated and G418-treated cells as a final cutoff. By increasing the stringency of our cutoffs, we reduced the overall number of G418-sensitive mRNAs, but did observe trends in codon bias (see Fig. 3B) consistent with our earlier results. Our new criteria are discussed in lines 217 – 220 and 419 – 21. - Are G418-sensitive transcripts enriched in a specific functional category? Are transcripts with the longer open reading frames more sensitive to G418 since they will potentially accumulate more mis-incorporated amino-acids in their nascent chains? Is the Ribosome-associated quality control machinery recruited to polysomes upon G418 incubation? These are excellent questions. No, G418-sensitive transcripts are not enriched for certain biological processes or categories. They also do not contain longer or shorter ORFs on average. Those data are presented in lines 229 - 232. Examining the ribosome-associated quality control machinery would require extensive additional experiments. In consideration of the comments by reviewer #3, we present a more detailed discussion about this possibility. - Figure 3B is an important figure supporting one of the main biological findings of the manuscript. However, it lacks any quantitative aspect of the degree of codon enrichment and depletion among G418-sensitive transcripts. Table1, which should contain the supporting raw information for the figure lacks a header to describe what each column corresponds to. The authors should include the name of each column in the supplementary table and show a plot displaying the extent of codon enrichment and depletion among G418-sensitive transcripts compared to the mean values of codon frequency obtained from a set (of similar number) of randomly chosen transcripts among the G418-insensitive transcripts (random sampling with replacement). Authors should also indicate in the figure which codons correspond to hydrophobic amino-acids. We have included these analyses as supplemental table 3, providing the averaged values for each codon and the corresponding statistics comparing G418-sensitive versus insensitive mRNAs, and we have revised tables to contain headings as suggested. As suggested, Fig. 3B has also been revised. Minor comments: - Authors mention in the introduction that the more prevalent codons are typically decoded by the more abundant tRNAs. Although this is the case in some bacteria species as well as in yeast and some metazoans such as C.elegans, it is not the case in mammals (this reference is a good evidence for the lack of translational selection in organisms with large genomes and a small set of tRNA coding genes https://academic.oup.com/nar/article/32/17/5036/1333956). The sentence should therefore be corrected to indicate that in some organisms, but not all, there is a correlation between codon occurrence in the transcriptome and tRNA abundance. We have made this correction, including the indicated refernce. See line 74. - The concentrations of each translation inhibitor tested in Figure 1A and Figure 1B should be mentioned in the legend or directly in the plot and not only in the Material & Methods section. The authors should also clearly confirm that the lowest translation inhibitor concentrations described in figure 1A (5ng/µl of Puromycin, 2.5ng/µl of cycloheximide and 5ng/µl of G418) are the ones used in Figure 1B. We have amended the figure legend to explicitly include this information. - Figure 2B. The choice of symbols to display the p-values corresponding to the comparison of the mRNA half-lives between the different conditions tested is misleading because the number of stars is usually correlated to the p-value (p-value *>**>***). The authors should change their nomenclature and either choose a different color for each comparison made or directly display the associated p-value in the chart. We have made this change as well. - Figure 2C. Authors should display the codon sequence corresponding to each barplot (or prepare a heat map with the sequence of each codon and the corresponding CSC-value for each condition tested). This would allow readers to clearly see if AU rich or GC rich codons are enriched among positive or negative CSCs. We have included this information in Figure 2C and provide color coding for wobble positions to aid the reader. Reviewer #3: Manuscript Number: PONE-D-22-00848 Full Title: Amino acid misincorporation reduces mRNA stability Although I disagree with the author’s interpretation of their data (see major concern 1), this paper is a quality submission by an established RNA researcher and two undergraduate student co-authors. The manuscript is generally well written and provides data useful to the field. In this submission, the authors use different doses of translation inhibitors to interrogate their effect(s) on mRNA stability. The core of their argument is that the use of different doses of G418, which has been shown to increase the misincorporation of amino acids, would offer a window into how cellular RNA surveillance mechanisms would survey and ‘deal with’ RNAs where the ribosome incorporates an incorrect amino acid. The use of in vivo labeling (SLAM-Seq) is appropriate and helps make their case that the effect is at the RNA level. Major Concerns: 1. This reviewer’s dominant concern is related to the mechanism proposed to explain the observations. I wonder why the authors invoke a protein-folding mechanism via Ubr1-CCR4/NOT complex as the method for RNA turnover. They could have a stronger case for this logic if they had data or cited papers that demonstrate that their G418 conditions yielded consistent and common misincorporation of incorrect amino acids (therefore suggesting a misfolded protein-driven mechanism). Further, in this reviewer’s opinion, the link between codon optimality and protein misfolding is tenuous and they offer no direct data or references to strengthen it. Frankly, I think that the authors’ protein folding-targeted explanation in the discussion is not supported. In the eyes of this reviewer, the authors are wrong to neglect mentioning ribosome collisions (see many papers by the Green, Hegde, Zaher and several other labs) as the likeliest mechanism for the observed RNA instability. To this reviewer, their RNA-based codon optimality data perfectly support such a mechanism without the need to include protein folding. Further, these data fit well with previously published ribosome collision literature which show that slowing the rate of ribosome elongation (say by A-site competition or by multiple imperfect wobble pairing codons in a row) cause ribosome collisions and RNA degradation. Therefore, it could offer an important insight into another mechanism by which ribosome collisions can be studied. I urge the authors to read papers from this sub-field of RNA biology, then reconsider their data from this viewpoint, and adjust the introduction and discussion to reflect that they have considered this possibility. As an alternate (or complimentary) course, I would also welcome a robust defense of the proposed protein folding mechanism as the cause of RNA instability. This was an incredibly valuable observation and prompted us to ask some key questions using our in vitro translation system. While imperfect, most translation seems to occur in reticulocyte lysate on mRNA bound to monoribosomes (Figs. 1D and E). Interestingly, G418 can delay translation elongation rates at higher concentrations (Fig. S1), but does not push luciferase mRNA into heavier complexes with additional ribosomes. Furthermore, minimal luciferase mRNA can be found in denser fractions from a polyribosome sedimentation assay. These data are largely inconsistent with a ribosome collision model, but we cannot rule that possibility out. In our revised manuscript, we cannot and do not insist on amino acid misincorporation as the sole mechanism by which G418 can act. We include the references on ribosome collisions and attempt to take a more nuanced view. These edits required extensive changes to the text and additional figures, but the key changes can be found in lines 146 – 160 and 310 – 315. 2. In the eyes of this reviewer, the data are sound. My only question is why is some of it being held back? For example, the authors do SLAM-seq, but they only report a small scrap of the data (limited to Fig 2b) even though half-lives were determined for over 10000 mRNAs. Why not report these data either whole or in part (limit it to mRNAs enriched in under- or over-represented codons?) as supplementary tables in this manuscript? Such data could be very useful to the broader community. At least a rationale for this omission should be offered. These data were included in our original GEO submission and can be found in that repository, but for ease-of-access, we have also included calculated mRNA half-lives as an additional supplemental table here. 3. The text, legend, and figure pertaining to figure 3 were confusing to this reviewer. It appears as if the color coding was incorrect or the descriptions are mis-assigned. Lines 490-91 state that U wobble codons are overrepresented, but the color codes show them as underrepresented. Since getting that correct is critical for interpreting the data, this needs to be corrected and the text must be adjusted to account for the changes. We have attempted to modify this figure in response to both this comment and comments from Reviewer #2. There was some discrepancy between the text and figure. 4. The organization of the supplementary tables needs to be greatly improved. First, add an extra sheet as the first sheet which functions essentially as both a table of contents and as a brief summary of the worksheets in the table (since it has two sheets). Second, the tabs for each worksheet in the xls table should be titled the table. Third, the worksheets need column headings We have made these changes in the supplemental tables and apologize for their original lack of clarity. Minor points: In the interests of brevity, we point to individual figures or lines of text where the suggested corrections are made, but we have attempted to address each point raised below. 1- Several citations (for lines 78,79 is just one example) are missing. Please add them as needed. 2- please break up the results section by using section headings to help organize the results by the key findings. The Results have been divided as suggested. 3- Changing figure 2C by including the actual codon identities in their codon optimality map would be VERY helpful. Currently, it’s impossible to determine which of the 61 codons is best/worst or anything in between. Codon sequences are included and color-coded to aid the reader. 4- Description of the western blot are missing in the methods. Please add. See lines 371 - 375. 5- How was the loading of the western blots normalized? Please describe in methods and or legend. 6- The number of replicates is not listed for all experiments. Please correct. 7- For better readability, the total protein description of method (AHA/click seq) should be presented separately from the 4-thiouracil method. This paragraph has been given its own heading. 8- How do we know is the number of cells remains the same and the effect is not the cells being dead or a variability of cell number. 9- For tAI experiment, please explain why the comparison was performed between puro and G418 and not with the control experiment? This point was raised by reviewer 2 and is addressed above. 10- Violin plots would be much more informative for the data presented in figures 2B, D and E. These are now included. 11- Fig 2B: How many time points were used for SLAM-Seq experiments? How many replicates were performed? Although the P-value showed significant difference between Control, G418, and puromycin-treated samples, the standard deviation values were quite high. These additional pieces of information are now included in the Methods. See line 397. 12- Fig 1B: The authors should indicate where the primers located, are they at 3’, 5’ or CDS? (since the qPCR results may be affected by the positions of primers.) They are located in the CDS in the case of luciferase, CFP (new to this revision) and toward the 3’end of the 18S rRNA (see lines 364 – 367). 13- Fig 1C: The authors should indicate if they used different amounts of rabbit reticulocyte lysate or antibiotics. In case different amounts of G418 were used, the authors did not explain why the firefly protein increased while the mRNA got destabilized after 30 mins reaction. This point was raised by reviewer #1, and we address it above. 14- The authors should also provide something akin to a future direction in the discussion. For example, Selected reporter genes (ID’d by the SLAM-seq data) containing overrepresented and underrepresented codons found in fig 3 should be assayed using Northern Blotting and polysome gradient followed by Western Blotting in the condition with and without G418 to validate the conclusion that G418 acts preferentially on codons with G or C in the wobble position. a. Please note that I’m NOT suggesting that the authors must do this for publication. Such experiments would be a great set of follow-up experiments, but in my opinion would be beyond the scope of this focused manuscript. We now include a more detailed future directions section within the Discussion in lines 310 - 316. 15- Adding 3 Vertical lines to separate the groups in Figure 3A would be very helpful (A 1,2,3 /line/ C 1,2,3 /line/ G 1,2,3 /line/ U 1,2,3). (This is best shown by C3 and G1 which look like they belong together.) We have amended the figure as suggested. 16- Bold your figure legend titles for each figure. This edit has been made. 17- the scale on figure 3A would benefit by the inclusion of more 'ticks' and/or color-coding to show where the values are. We have amended the figure as suggested. Vocabulary & grammar (there are several others not listed here) - Line 62: “selected” instead of “select” - Line 77: “A sites” instead of “A, sites” - Line 80: not sure what binding the authors mentioned. - Line 277: Is it ESGRO-2i medium? - In line 463 use OR (not and) since you don't do the double inhibitor We have amended these lines for clarity. As a final aside, this reviewer has evaluated R15 grants as a study section member. If the PI is considering applying for such a grant mechanism, then including language similar to the below in the acknowledgements section of this and every published paper from their lab would aid their application by establishing their undergraduate-focused ‘training bona fides’ for the review process. “YTD and AS are undergraduate student trainees majoring in _____ at Washington and Lee University and were mentored by KF during this project.” We have included such language in the Acknowledgements, and we thank the reviewer for this suggestion. Submitted filename: ResponseToReviewers.docx Click here for additional data file. 23 Jun 2022
PONE-D-22-00848R1
Geneticin reduces mRNA stability
PLOS ONE Dear Dr. Friend, Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it needs few minor changes before it can fully meet PLOS ONE’s publication criteria. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process. All changes requested by reviewers 1 and 2 can be made by changing the text to acknowledge caveats or add explanations as suggested. No new experiments will be necessary. Once the revised manuscript is submitted,  an additional round of peer review may not be needed and the decision can be made at the editorial level. Please submit your revised manuscript by Aug 07 2022 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. Please include the following items when submitting your revised manuscript:
If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter. A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'. If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols. We look forward to receiving your revised manuscript. Kind regards, Guramrit Singh Academic Editor PLOS ONE Journal Requirements: Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice. [Note: HTML markup is below. Please do not edit.] Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation. Reviewer #1: All comments have been addressed Reviewer #2: All comments have been addressed Reviewer #3: All comments have been addressed ********** 2. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Yes Reviewer #2: Partly Reviewer #3: Yes ********** 3. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: Yes Reviewer #2: Yes Reviewer #3: Yes ********** 4. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes Reviewer #2: Yes Reviewer #3: Yes ********** 5. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes Reviewer #2: Yes Reviewer #3: Yes ********** 6. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: Reviewer #1: Durmaz et al has satisfactorily address all the queries raised by this reviewer either by providing the justification to our comments or by mentioning the caveats and limitations of the experimental approach within the text. Therefore, considering the scope of the focused manuscript this reviewer recommends publication in the journal. However, this reviewer has some further questions that requires justifications. Major comments: 1. Line 158, figure number 1C-D, the polyribosome sedimentation was carried out after inhibiting the translation reaction at 15 minutes to trap the mRNAs in the initial phase of firefly luciferase production. This reviewer has no objection about the time points taken. Reviewer is just curious that the difference of mRNA degradation in G418 vs untreated (Figure 1B) is very prominent at t=20 and 30, then why the authors decided to go with 15 minutes of translation reaction followed by polyribosome sedimentation. The authors mention in the line 108-110, that “in vitro, we observe that G418 likely acts independently of ribosome collisions.” What if the timepoints of t=20 or 30 minutes could have roughly provided us the connection between G418 and ribosome collision. Without which the above statement remains void and should be re-written. 2. The sedimentation assay (Figure 1D and 1E) was carried out to check the relative abundance of luciferase mRNA throughout the polysome fraction. From the result it was evident that the mRNA is present mostly in the monoribosomal fraction. But the authors did not mention the proper method to quantify the mRNAs. Did the author took ribosomal rRNA to measure relative abundance of luciferase mRNA? Or is it relative to each fraction of the polysome profile? It would be very informative if authors can describe this information in the method section. Minor comments: 1. Incorporate the G418 (Geneticin) in the introduction as the title suggest and it would be informative to a novice reader. 2. Line 233-234: repetitive statement. 3. Interspersed grammatical errors. A thorough reading of the manuscript should take care of it. Reviewer #2: Dear authors, Thank you for having addressed most of my comments. I only have two final comments that I think should be addressed: - Introduction: It is important to clearly state in which organism the findings described in the introduction were obtained as there can be mechanistic differences between yeast, insects and mammals. As an example, the work describing the role of the Ccr4-Not complex at ribosomes with unoccupied A sites was performed in yeast. - Line 149-153 (Figure S1) : The authors tested whether G418 could delay elongation in RRL by monitoring luciferase expression levels (upon adding high concentrations of G418 and other translation inhibitors) using western-blotting. However, G418 induces amino-acid misincorporation and thus (at high concentrations), could possibly change the epitope recognized by the luciferase antibody. A better proxy to monitor this would be to perform in vitro translation experiments in the presence of S35-Methionine in order to quantify luciferase expression more accurately. Reviewer #3: I commend the authors for submitting a greatly improved manuscript. They have de-emphasized and/or removed the unsupported text and have satisfactorily addressed this reviewer's core concerns. While the authors have not definitively identified the mechanism by which G418 reduces the stability of the reporter RNAs (which is beyond the scope of this manuscript -as far as this reviewer is concerned-) they have effectively ruled out certain possible mechanisms. On that note, I commend the authors for their use of polysome gradients to address my suggestion of ribosome collisions as the likely mechanism. Their data show nearly a complete absence of polysomes and a strong monosome peak. Simply, ribosomes can't collide when each mRNA is only translated by a single ribosome. It's a clever way to test my suggestion. As they show their polysome data do capture the regions of the gradient that span from 40S peak through part of the polysome region are convincing enough for this reviewer, they aren't perfect. (see below) My lab regularly runs polysome gradients (using the same sucrose concentrations, and rotor) as part of our work. Simply, by this reviewer's experience their centrifugation conditions (10-50% gradients, centrifuged @ 39,000 RPM for 3 hours in an SW-41 rotor) likely resulted in the heaviest ribosomes pelleting. My lab uses very similar conditions, but we only spin samples for 2 hours (not 3). Granted, my lab's polysome results are all based on cell lysates as opposed to an in vitro translation system & there are differences between systems, but I'm fairly certain that the author's data only includes the polysome region corresponding to the position where polysomes corresponding to maybe the 5 or 6 ribosomes would be. The very long distance between the RNP peak at the start of the gradient and the monosome peak speaks to this as well. Despite this concern, as I said above, I find these data (especially the absence of any di-ribosome peak -which, had it been there, would have been captured in their experiment) convincing enough to support publication of this manuscript. On a final note, I also encourage the authors to submit higher quality figures for publication. They are quite pixellated on my display and when I printed them out on hardcopy. ********** 7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #2: No Reviewer #3: No ********** [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.
30 Jun 2022 We greatly appreciate the feedback from Reviewers 1-3 on this second consideration of our manuscript. We have attempted to address each reviewer’s comments in the indicated sections of our manuscript (see below, italicized). Our manuscript has been greatly improved by your careful reading and critical feedback. We greatly appreciate the thoughtfulness of your comments. From the Editor: All changes requested by reviewers 1 and 2 can be made by changing the text to acknowledge caveats or add explanations as suggested. No new experiments will be necessary. Once the revised manuscript is submitted, an additional round of peer review may not be needed and the decision can be made at the editorial level. As indicated above, we have modified the manuscript in an attempt to address the remaining concerns of each reviewer. We have indicated the changes made below. From Reviewer 1: Durmaz et al has satisfactorily address all the queries raised by this reviewer either by providing the justification to our comments or by mentioning the caveats and limitations of the experimental approach within the text. Therefore, considering the scope of the focused manuscript this reviewer recommends publication in the journal. However, this reviewer has some further questions that requires justifications. Major comments: 1. Line 158, figure number 1C-D, the polyribosome sedimentation was carried out after inhibiting the translation reaction at 15 minutes to trap the mRNAs in the initial phase of firefly luciferase production. This reviewer has no objection about the time points taken. Reviewer is just curious that the difference of mRNA degradation in G418 vs untreated (Figure 1B) is very prominent at t=20 and 30, then why the authors decided to go with 15 minutes of translation reaction followed by polyribosome sedimentation. The authors mention in the line 108-110, that “in vitro, we observe that G418 likely acts independently of ribosome collisions.” What if the timepoints of t=20 or 30 minutes could have roughly provided us the connection between G418 and ribosome collision. Without which the above statement remains void and should be re-written. In performing the experiment this way, our chief objective was to interrogate ribosome-bound mRNAs prior to significant differences in mRNA levels. We selected the 15 min time-point since that time allowed ribosome loading onto mRNAs, but was likely concurrent with their initial decay. As the reviewer notes, between 10 and 20 min (and before to some degree), we observe reduction in mRNA levels implying that mRNAs are decaying within that time window. We have updated the text to make this point more explicitly (see lines 158 - 59). 2. The sedimentation assay (Figure 1D and 1E) was carried out to check the relative abundance of luciferase mRNA throughout the polysome fraction. From the result it was evident that the mRNA is present mostly in the monoribosomal fraction. But the authors did not mention the proper method to quantify the mRNAs. Did the author took ribosomal rRNA to measure relative abundance of luciferase mRNA? Or is it relative to each fraction of the polysome profile? It would be very informative if authors can describe this information in the method section. As indicated in the revised Methods, normalization was accomplished using a spike-in mRNA since various polysome fractions have different levels of rRNA. The Methods are changed in line 363 to indicate this point. Minor comments: We have made the changes in the text where indicated below. 1. Incorporate the G418 (Geneticin) in the introduction as the title suggest and it would be informative to a novice reader. (lines 103 - 107) 2. Line 233-234: repetitive statement. Removed. 3. Interspersed grammatical errors. A thorough reading of the manuscript should take care of it. Edited throughout. From Reviewer 2: - Introduction: It is important to clearly state in which organism the findings described in the introduction were obtained as there can be mechanistic differences between yeast, insects and mammals. As an example, the work describing the role of the Ccr4-Not complex at ribosomes with unoccupied A sites was performed in yeast. This is an excellent point. We have attempted to specify which systems were used to make the observations in the Introduction. Changes are indicated throughout using track changes. - Line 149-153 (Figure S1) : The authors tested whether G418 could delay elongation in RRL by monitoring luciferase expression levels (upon adding high concentrations of G418 and other translation inhibitors) using western-blotting. However, G418 induces amino-acid misincorporation and thus (at high concentrations), could possibly change the epitope recognized by the luciferase antibody. A better proxy to monitor this would be to perform in vitro translation experiments in the presence of S35-Methionine in order to quantify luciferase expression more accurately. Absolutely, labeling with 35S-Met would be ideal. However, we do not currently have a phosphorimager or access to a dark room for X-ray film development. That necessitates the use of antibodies or firefly luciferase activity measurements (which were used and are now indicated the in Fig. S1 legend). That being said, the activity that we do observe obeys delayed kinetics. The point is certainly valid, however, so we have modified the text in lines 149 - 51 to discuss this caveat and to be more explicit about how firefly luciferase protein levels were monitored. From Reviewer 3: I commend the authors for submitting a greatly improved manuscript. They have de-emphasized and/or removed the unsupported text and have satisfactorily addressed this reviewer's core concerns. While the authors have not definitively identified the mechanism by which G418 reduces the stability of the reporter RNAs (which is beyond the scope of this manuscript -as far as this reviewer is concerned-) they have effectively ruled out certain possible mechanisms. On that note, I commend the authors for their use of polysome gradients to address my suggestion of ribosome collisions as the likely mechanism. Their data show nearly a complete absence of polysomes and a strong monosome peak. Simply, ribosomes can't collide when each mRNA is only translated by a single ribosome. It's a clever way to test my suggestion. As they show their polysome data do capture the regions of the gradient that span from 40S peak through part of the polysome region are convincing enough for this reviewer, they aren't perfect. (see below) My lab regularly runs polysome gradients (using the same sucrose concentrations, and rotor) as part of our work. Simply, by this reviewer's experience their centrifugation conditions (10-50% gradients, centrifuged @ 39,000 RPM for 3 hours in an SW-41 rotor) likely resulted in the heaviest ribosomes pelleting. My lab uses very similar conditions, but we only spin samples for 2 hours (not 3). Granted, my lab's polysome results are all based on cell lysates as opposed to an in vitro translation system & there are differences between systems, but I'm fairly certain that the author's data only includes the polysome region corresponding to the position where polysomes corresponding to maybe the 5 or 6 ribosomes would be. The very long distance between the RNP peak at the start of the gradient and the monosome peak speaks to this as well. Despite this concern, as I said above, I find these data (especially the absence of any di-ribosome peak -which, had it been there, would have been captured in their experiment) convincing enough to support publication of this manuscript. Although not specifically requested, we do now point out that our polysome profiles may exclude very large complexes of ribosomes and mRNA given how we prepared the samples. Those changes are made in lines 164 - 6. On a final note, I also encourage the authors to submit higher quality figures for publication. They are quite pixellated on my display and when I printed them out on hardcopy. We have attempted to upload higher resolution images. Submitted filename: ResponseToReviewers_June.docx Click here for additional data file. 13 Jul 2022 Geneticin reduces mRNA stability PONE-D-22-00848R2 Dear Dr. Friend, We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements. Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication. An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org. If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org. Kind regards, Guramrit Singh Academic Editor PLOS ONE Additional Editor Comments (optional): All remaining reviewer concerns are now adequately addressed and manuscript is now acceptable for publication. Reviewers' comments: 18 Jul 2022 PONE-D-22-00848R2 Geneticin reduces mRNA stability Dear Dr. Friend: I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org. If we can help with anything else, please email us at plosone@plos.org. Thank you for submitting your work to PLOS ONE and supporting open access. Kind regards, PLOS ONE Editorial Office Staff on behalf of Dr. Guramrit Singh Academic Editor PLOS ONE
  48 in total

1.  Coupling of rates of transcription, translation, and messenger ribonucleic acid degradation in streptomycin-dependent mutants of Escherichia coli.

Authors:  R S Gupta; D Schlessinger
Journal:  J Bacteriol       Date:  1976-01       Impact factor: 3.490

2.  Cytochrome c release and endoplasmic reticulum stress are involved in caspase-dependent apoptosis induced by G418.

Authors:  Q H Jin; B Zhao; X J Zhang
Journal:  Cell Mol Life Sci       Date:  2004-07       Impact factor: 9.261

3.  Systematic Detection of Amino Acid Substitutions in Proteomes Reveals Mechanistic Basis of Ribosome Errors and Selection for Translation Fidelity.

Authors:  Ernest Mordret; Orna Dahan; Omer Asraf; Roni Rak; Avia Yehonadav; Georgina D Barnabas; Jürgen Cox; Tamar Geiger; Ariel B Lindner; Yitzhak Pilpel
Journal:  Mol Cell       Date:  2019-07-25       Impact factor: 17.970

4.  A technique to increase protein yield in a rabbit reticulocyte lysate translation system.

Authors:  Maria Anastasina; Ilya Terenin; Sarah J Butcher; Denis E Kainov
Journal:  Biotechniques       Date:  2014-01       Impact factor: 1.993

5.  Codon bias confers stability to human mRNAs.

Authors:  Fabian Hia; Sheng Fan Yang; Yuichi Shichino; Masanori Yoshinaga; Yasuhiro Murakawa; Alexis Vandenbon; Akira Fukao; Toshinobu Fujiwara; Markus Landthaler; Tohru Natsume; Shungo Adachi; Shintaro Iwasaki; Osamu Takeuchi
Journal:  EMBO Rep       Date:  2019-09-03       Impact factor: 8.807

6.  Molecular mechanism of translational stalling by inhibitory codon combinations and poly(A) tracts.

Authors:  Petr Tesina; Laura N Lessen; Robert Buschauer; Jingdong Cheng; Colin Chih-Chien Wu; Otto Berninghausen; Allen R Buskirk; Thomas Becker; Roland Beckmann; Rachel Green
Journal:  EMBO J       Date:  2019-12-20       Impact factor: 11.598

7.  Ubr1 and Ubr2 function in a quality control pathway for degradation of unfolded cytosolic proteins.

Authors:  Nadinath B Nillegoda; Maria A Theodoraki; Atin K Mandal; Katie J Mayo; Hong Yu Ren; Rasheda Sultana; Kenneth Wu; Jill Johnson; Douglas M Cyr; Avrom J Caplan
Journal:  Mol Biol Cell       Date:  2010-05-12       Impact factor: 4.138

8.  Thiol-linked alkylation of RNA to assess expression dynamics.

Authors:  Veronika A Herzog; Brian Reichholf; Tobias Neumann; Philipp Rescheneder; Pooja Bhat; Thomas R Burkard; Wiebke Wlotzka; Arndt von Haeseler; Johannes Zuber; Stefan L Ameres
Journal:  Nat Methods       Date:  2017-09-25       Impact factor: 28.547

9.  Pathogenic Signal Sequence Mutations in Progranulin Disrupt SRP Interactions Required for mRNA Stability.

Authors:  Emile S Pinarbasi; Andrey L Karamyshev; Elena B Tikhonova; I-Hui Wu; Henry Hudson; Philip J Thomas
Journal:  Cell Rep       Date:  2018-06-05       Impact factor: 9.423

10.  Broad range of missense error frequencies in cellular proteins.

Authors:  Raffaella Garofalo; Ingo Wohlgemuth; Michael Pearson; Christof Lenz; Henning Urlaub; Marina V Rodnina
Journal:  Nucleic Acids Res       Date:  2019-04-08       Impact factor: 16.971

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.