Literature DB >> 35900969

Zoledronic acid generates a spatiotemporal effect to attenuate osteoarthritis by inhibiting potential Wnt5a-associated abnormal subchondral bone resorption.

Dong Ding1,2, Limei Wang3, Jiangbo Yan1, Yong Zhou1, Gangning Feng1, Long Ma4, Yong Yang1, Xiuying Pei1, Qunhua Jin4.   

Abstract

This study aimed to determine the effects of zoledronic acid (ZOL) on OA in rats and explored the molecular mechanism of osteoclast activation in early OA. A knee OA rat model was designed by surgically destabilizing the medial meniscus (DMM). Seventy-two male rats were randomly assigned to Sham+phosphate-buffered saline (PBS), DMM+PBS, and DMM+ZOL groups; rats were administered with 100 μg/Kg ZOL or PBS, twice weekly for 4 weeks. After 2, 4, 8, and 12 weeks of OA induction, the thickness of the hyaline and calcified cartilage layers was calculated using hematoxylin and eosin staining, degenerated cartilage stained with Safranin O-fast green staining was evaluated and scored, tartrate-resistant acid phosphatase (TRAP)-stained osteoclasts were counted, changes in subchondral bone using micro-computed tomography were analyzed, and PINP and CTX-I levels were detected using enzyme-linked immunosorbent assay. Using these results, 18 male rats were randomly assigned to three groups. Four weeks after surgery, Wnt5a, RANKL, CXCL12, and NFATc1 protein levels were measured in subchondral bone using western blotting, and mRNA levels of genes related to osteoclastogenesis in subchondral bone were measured using quantitative polymerase chain reaction. Bone marrow-derived macrophages were isolated as osteoclast precursors, and cell differentiation, migration, and adhesion were assessed by TRAP staining and Transwell assays, revealing that DMM induced knee OA in rats. Progressive cartilage loss was observed 12 weeks after OA induction. Subchondral bone remodeling was dominated by bone resorption during early OA (within 4 weeks), whereas bone formation was increased 8 weeks later. ZOL suppressed bone resorption by inhibiting Wnt5a signaling in early OA, improved the imbalance of subchondral bone remodeling, reduced cartilage degeneration, and delayed OA progression. Additionally, ZOL delayed OA progression and reduced cartilage degeneration via a spatiotemporal effect in DMM-induced OA. Osteoclast activity in early OA might be associated with Wnt5a signaling, indicating a possible novel strategy for OA treatment.

Entities:  

Mesh:

Substances:

Year:  2022        PMID: 35900969      PMCID: PMC9333271          DOI: 10.1371/journal.pone.0271485

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.752


Introduction

Osteoarthritis (OA) is a chronic, progressive, and degenerative inflammatory disease that seriously affects the quality of life and increases the incidences of cardiovascular events and all-cause mortality [1]. OA incidence is increasing as the global population ages. Due to the complexity of OA etiology and pathogenesis, effective treatment has not yet been established. The present principle of gradual and individualized OA therapy is based on the patient’s age, sex, weight, risk factors, location, and the extent of lesions [2]. However, surgery is ultimately unavoidable for patients with end-stage OA; this results in various degrees of physical and psychological pain and increases economic burdens on individuals and society [3]. Therefore, OA etiology and pathogenesis need to be understood in more detail, and effective therapeutic targets to cure or delay OA are urgently needed. The role of subchondral bone in OA pathogenesis has recently attracted attention; subchondral bone remodeling is a dynamic equilibrium process that is maintained by osteoclast- and osteoblast-mediated bone resorption and formation, respectively [4]. During the early stages of OA, osteoclast-mediated bone resorption may be enhanced and trabecular bone within subchondral bone is lost [5]. These morphological and structural changes lead to changes in the biomechanical functions of articular cartilage in response to load, resulting in cartilage degeneration [6]. Another speculation is that cartilage degeneration causes abnormal subchondral bone remodeling [7]. Whether abnormal subchondral bone remodeling is a cause or an effect of cartilage degeneration in OA has importance in understanding OA pathogenesis and realizing early precision treatment. The Wnt secreted glycoprotein has important roles in regulating cell proliferation, differentiation, migration, polarity, and inflammation. Wnt is classified into classical or non-classical signaling pathways depending on whether β-catenin is dependent on co-receptor formation [8]. The Wnt/β-catenin signaling pathway accelerates articular cartilage degeneration in OA and promotes the osteogenic differentiation of bone marrow mesenchymal stem cells in subchondral bone, which results in late osteosclerosis [9]. The Wnt/β-catenin signaling pathway also induces osteoblasts to secrete osteoprotegerin (OPG), reduces the ratio of receptor activator of nuclear factor κB ligand (RANKL)/OPG, and indirectly inhibits osteoclast-mediated bone resorption [10]. The regulation of Wnt5a is bidirectional in some diseases; for example, Wnt5a expression correlates negatively with the occurrence of thyroid and colorectal cancers, and positively with that of melanoma and gastric cancer [11], and promotes and inhibits Wnt3a [12, 13]. Therefore, the complex functions of Wnt5a signaling are associated with various receptors bound to different microenvironments and different biological effects [14]. Osteoclast biological behavior is influenced by various cytokines in the microenvironment; for example, the RANKL/RANK/OPG axis regulates the formation of osteoclasts [15], and the C-X-C motif chemokine 12 (CXCL12)/CXCR4 axis plays important roles in cell chemotaxis and migration [16]. However, whether these mechanisms are associated with Wnt5a in early OA remains unclear, so further research is needed to gain a better understanding about the pathogenesis of early OA.

Materials and methods

Animals and ethics statement

Nighty 8-week-old (adult) male Sprague Dawley rats (Laboratory Animal Center of Ning Xia Medical University, Yinchuan, IACUC-NYLAC-2020-51) weighing 287 ± 12 g were group-housed on a 12 h light/dark cycle with food and water ad libitum. The Animal Care and Experiment Committee of Ning Xia Medical University approved all experimental procedures associated with this study (protocol no. 2020–0001), which proceeded according to the principles and guidelines of the National Institutes of Health Guide for the Care and Use of Laboratory Animals. All surgery was performed under sodium pentobarbital anesthesia, all rats were euthanized via an overdose of intraperitoneal sodium pentobarbital, and every effort was made to minimize the number and suffering of rats included in this study.

Experimental design

A total of 72 of 90 rats were randomly divided into sham+PBS, destabilizing the medial meniscus (DMM)+PBS, and DMM+ZOL groups. The rats were sacrificed at 2, 4, 8, and 12 weeks after OA induction (n = 6 per time point), and the effects of Zoledronic acid (ZOL) on cartilage and subchondral bone during progressed OA were assessed, the OA bone resorption stage was identified according to the results of Osteoarthritis Research Society International (OARSI) scores, cartilage morphology, osteoclast number in subchondral bone. Based on these results, another 18 rats were randomly divided into three groups (n = 6 per group) to assess osteoclast formation, migration and adhesion of bone marrow-derived macrophages (BMMs), expression of Wnt5a, RANKL, CXCL12, nuclear factor of activated T-cells (NFATc1), tartrate-resistant acid phosphatase (TRAP), cathepsin K (Ctsk) and to explore the relative molecular mechanism during early OA. Fig 1 shows the experimental design.
Fig 1

Schematic of the experimental design.

(A) A total of 72 rats were randomly divided into sham+PBS, DMM+PBS, and DMM+ZOL groups at 2, 4, 8, and 12 weeks after OA induction (n = 6 per time point). The bone resorption stage of OA was identified, and effects of ZOL on cartilage and subchondral bone were assessed. (B) Another 18 rats were randomly divided into three groups at 4 weeks after OA induction (n = 6 per group) to explore possible molecular mechanism of osteoclast activation in early OA.

Schematic of the experimental design.

(A) A total of 72 rats were randomly divided into sham+PBS, DMM+PBS, and DMM+ZOL groups at 2, 4, 8, and 12 weeks after OA induction (n = 6 per time point). The bone resorption stage of OA was identified, and effects of ZOL on cartilage and subchondral bone were assessed. (B) Another 18 rats were randomly divided into three groups at 4 weeks after OA induction (n = 6 per group) to explore possible molecular mechanism of osteoclast activation in early OA.

OA induction

Rats were acclimated for 1 week and anesthetized with 1% pentobarbital sodium in phosphate-buffered saline (PBS, 60 mg/Kg). DMM rat models were created as described [17]. Briefly, the right knee joint capsule of each rat in DMM group was exposed according to a medial parapatellar approach; subsequently, the medial meniscotibial ligament was transected with micro-scissors to destabilize the medial meniscus, and the medial meniscus was reflected proximally toward the femur. Finally, the capsule and skin were sutured using 5–0 synthetic absorbable suture. By contrast, each rat in the sham+PBS group underwent to the same procedure without transections of medial meniscotibial ligament and destabilization of medial meniscus. All rats were resuscitated after surgical anesthesia by placing them on electric blankets.

ZOL subcutaneous administration

Changes of osteoclast activity during OA progression in each group were analyzed. Rats in the DMM+ZOL group were subcutaneously injected with ZOL (100 μg/Kg, Aclasta®, Novartis Pharma Stein AG, Switzerland) in PBS twice weekly for 4 weeks after surgery. The same volume of PBS was administered to the sham+PBS and DMM+PBS groups.

Micro-computer tomography (CT) analysis

Knee joints of six rats in each group were fixed in 4% paraformaldehyde (PFA) for 48 h. Three-dimensional (3D) μCT images were acquired using a SKYSCAN1076 (Bruker, Billerica, MA, USA) with an isotropic voxel resolution of 10 μm under the following parameters: pixel size, 10 μm; tube potential (peak), 40 kVp; tube current, 250 μA with 0.6° rotations. A portion (0.5 mm below the growth plate and 1 mm in height, 3.5 mm ventrodorsal length) of the load-bearing region at the medial tibial plateau was identified as a region of interest (ROI). The trabecular bone morphometry includes bone volume fraction (BV/TV), trabecular thickness (Tb.Th), trabecular separation (Tb.Sp), trabecular number (Tb.N), and connectivity density (Conn.D) were calculated.

Measurement of serum biomarkers of bone turnover

Six rats from each group were fasted but had free access to water for at least 6 h before collecting blood. Blood collected from tail vein at each time point was clotted at 20°C for 30 min, and then centrifuged at 4,000 × g for 20 min. Serum was then aliquoted and stored at -80°C. Concentrations of N-terminal propeptide of type I procollagen (PINP) and carboxy-terminal telopeptide of type I collagen (CTX-I) were assayed using enzyme-linked immunosorbent assay (ELISA) kits (Lianshuo Biological Technology Co., Ltd., Shanghai, China), as described by the manufacturer.

Histology

After acquiring μCT images, knee samples of six rats in each group were decalcified in 10% disodium ethylenediaminetetraacetate dihydrate (E8030; Solarbio Co., Ltd., Beijing, China) for 4 weeks, embedded in paraffin, sectioned at 5 μm thickness along the coronal plane and stained with hematoxylin and eosin (HE) using a kit (G1005; Servicebio, Wuhan, China) at 25°C. The sections were placed in xylene twice for 20 min, anhydrous ethanol twice for 5 min each, and then 75% alcohol for 5 min. The sections were stained with hematoxylin for 3 min, rinsed in running water for 10 min, dehydrated in 85% and 95% alcohol for 5 min each, and then stained with eosin for 5 min. The thickness of the hyaline (HC) and calcified (CC) cartilage layers, and total articular cartilage (TAC) were calculated as described [18]. Before staining with Safranin O-fast green and TRAP (G1053 and G1050, respectively; Servicebio), slides were deparaffinized as described above, and then stained with Fast Green for 5 min, washed, dehydrated, and stained with Safranin O for 2 min. Histopathologically stained cartilage were graded using OARSI scores, as described [19]. Sections were incubated in working fluid from TRAP staining kit for 2 h, washed thrice with distilled water, then TRAP-stained slides were stained with hematoxylin for 3 min. Mature osteoclasts were counted, and ratios of Oc.S/BS that represented bone resorption activity in subchondral bone were calculated. Regions from three sections per rat were visualized using a DP71 microscope with DP controller software (Olympus Optical Co. Ltd., Tokyo, Japan).

Immunohistochemistry

Coronal sections of three rats in each group were incubated overnight at 4°C with primary antibodies (all diluted 1:100) against Wnt5a (55184-1-AP), CXCL12 (17402-1-AP; both from Proteintech Group Inc., Rosemont, IL, USA), and NFATc1 (ab264530; Abcam, Cambridge, UK). Sections were washed thrice for 5 min, incubated with goat anti-rabbit immunoglobulin G (IgG) polymer-conjugated horseradish peroxidase (HRP) for 1 h at 37°C, and then color was developed by adding 3,3-diaminobenzidine (DAB) (ZLI-9018; Beijing Zhongshan Jinqiao Biotechnology Co., Beijing, China) and counterstained with hematoxylin. Positively stained cells were counted in whole areas of tibial subchondral bone per specimen, and five sequential specimens per rat in each group were assessed. All measurements proceeded in a blinded fashion.

Western blot analysis

Four weeks after surgery, three rats from each group were sacrificed, and subchondral bone was analyzed by western blotting. Articular cartilage was removed and subchondral bone from the proximal tibia was preserved. The tissues were lysed using a buffer containing protease inhibitors and phosphatase inhibitors and pulverized in an automated frozen sample grinder (Jingxin Industrial Development Co., Ltd; Shanghai, China). Protein concentrations were measured using a kit (KGP250; Keygen Biotech Co., Ltd., Nanjing, China), proteins were resolved using 8% or 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and then electroblotted onto polyvinylidene difluoride membranes (Millipore, Darmstadt, Germany). Non-specific protein binding was blocked using skim milk (Fujifilm, Tokyo, Japan) for 2 h, and then the membranes were incubated overnight with primary antibodies against Wnt5a (1:1000, 55184-1-AP), RANKL (1:1000, 23408-1-AP; both from Proteintech), CXCL12 (1:1000, AF5166; Affinity Biosciences, Cincinnati, OH, USA), NFATc1 (1:5000, ab264530; Abcam), and β-actin (1:5000, 20536-1-AP; Proteintech), followed by goat anti-rabbit Ig–G conjugated HRP (1:10000, SA00001-2; Proteintech). Signals were detected using enhanced chemiluminescence. Data are shown relative to the intensity of the β-actin control.

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

Samples of three rats from each group were processed as described above for western blotting. Total RNA was extracted from proximal tibias without articular cartilage using Multisource Total RNA Prep Kits (AP-MN-MS-RNA-250, Axygen Inc., Union City, CA, USA). First-strand cDNA was synthesized using TransScript® All-in-One First-Strand cDNA Synthesis Kit (AT341-01; TransGen Biotech, Beijing, China) and an S1000 Thermal Cycler (Bio-Rad Laboratories Inc., Hercules, CA, USA). Target genes were amplified by RT-qPCR using Perfect Start™ Green qPCR SuperMix (Cat No. AQ602-21; TransGen Biotech, Beijing, China) and an Applied Biosystems7500 Fast Real-Time PCR System (Thermo Fisher Inc., Waltham, MA, USA) under the following conditions: 45 cycles of 94°C for 30 sec, 54°C for 30 sec, and 72°C for 34 sec. Table 1 lists the primer sequences. Relative mRNA expression levels were quantified using the 2-ΔΔCq method. The loading control was β-actin.
Table 1

Primer sequences for reverse transcription-quantitative polymerase chain reaction.

GenesSequence (5’-3’)
Wnt5a F: GCCAACTGGCGGGACTTTCT
R: CGCGTACGTGAAGGCTGTCT
RANKL F: ACAAGCCTTTCAAGGGGCCG
R: GGTGAGGTGAGCAAACGGCT
CXCL12 F: ATGTCGCCAGAGCCAACGTC
R: TGCGCCCCTTGTTTAAGGCT
OPG F: CACCCTGTGCGAAGAGGCAT
R: AGGTTCGCGTGGCCGATATG
TRAP F: GGTCACCGCCTACCTGTGTG
R: CCTTTCGTTGATGCCGCACG
Ctsk F: CGGGTAGGACCCGTCTCTGT
R: ACCACCAACACGGCATGGTT
NFATc1 F: GAAGACCTGGGCACCACACC
R: GATACGAGGCCTGTGGCACC
β-actin F: TGATGGACTCCGGAGACGGG
R: CTGTAGCCACGCTCGGTCAG

RANKL, receptor activator of nuclear factor κB ligand; OPG, osteoprotegerin; TRAP, tartrate resistant acid phosphatase; Ctsk, cathepsin k; NFATc1, nuclear factor of activated T-cells cytoplasmic 1

RANKL, receptor activator of nuclear factor κB ligand; OPG, osteoprotegerin; TRAP, tartrate resistant acid phosphatase; Ctsk, cathepsin k; NFATc1, nuclear factor of activated T-cells cytoplasmic 1

Isolation of bone marrow derived-macrophages (BMMs) and osteoclast formation

Four weeks after surgery, bone marrow was collected from six euthanized rats in each group to isolate BMMs and determine osteoclast formation, as described [20]. Briefly, bone marrow cells were flushed from rat tibias using α-minimum essential media (MEM, 01-042-1ACS; BioInd, Shanghai, China) containing 2% fetal bovine serum (FBS, 10099141; Thermo Fisher Inc.), erythrocytes were removed with lysis buffer (R1010; Solarbio Co Ltd.), and the remaining cells were resuspended in α-MEM containing 10% FBS. After an overnight incubation, unattached cells (osteoclast precursors) were incubated in α-MEM containing 10% FBS, 30 ng/mL of macrophage-colony stimulating factor (M-CSF, 216-MC-025; R&D Systems, Minneapolis, MN, USA), and 20 ng/mL RANKL (390-TN-010; R&D Systems) for 3 days, followed by α-MEM containing 10% FBS, 30 ng/mL of M-CSF, and 100 ng/mL of RANKL for 3 days. The cells were fixed, and then stained for TRAP using kits (PMC-AK04F-COS; Cosmo Bio Co., Ltd., Tokyo, Japan), as described by the manufacturer. Multinucleated cells (> 3 nuclei) that were TRAP positive were identified as mature osteoclasts and counted using the DP71 light microscope.

Assays of migration and adhesion of osteoclast precursors

Osteoclast migration was evaluated using Transwell assay kits (3422; Corning Inc., Corning, NY, USA), as described [21]. Osteoclast precursors (200 μl containing 1 × 106 cells/mL) were loaded into the upper chamber of 24-well Transwells and left for 6 h to migrate through 8 μm polycarbonate filters to the bottom chambers containing 600 μl α-MEM containing 10% FBS and 30 ng/mL M-CSF. Osteoclast precursors in the lower chamber were stained with crystal violet for 10 min and then counted using a Zeiss light microscope (Axio Observer 7; Carl Zeiss AG., Oberkochen, Germany). Osteoclast precursors (1 × 105 cells/well) were seeded into 96-well plates and incubated for 30 min in α-MEM containing 10% FBS and 30 ng/mL M-CSF [22]. Cells were washed thrice with PBS, fixed with 4% PFA at 20°C for 15 min, and stained with crystal violet for 10 min. Cells that adhered to the bottom of the plates were counted using a Zeiss light microscope.

Statistical analysis

Data were analyzed using one-way and two-way factorial design analysis of the variations followed by Student-Newman-Keuls and Bonferroni post hoc tests. Quantitative data are expressed as the means ± standard deviation (SD). For OARSI scores, data were analyzed using Kruskal-Wallis test followed by Dunn’s test. GraphPad Prism 7.0 (GraphPad Software Inc., San Diego, CA, USA) and Stata/MP 15.0 (College Station, Texas 77845 USA) were used for statistical analysis, and values P < 0.05 were significantly different.

Results

DMM-induced abnormal subchondral bone remodeling is inhibited by ZOL

Representative μCT images of knee joints demonstrated that DMM resulted in increased bone resorption from 2–4 weeks and increased bone formation from 8–12 weeks after surgery, indicating abnormal remodeling in subchondral bone. In contrast, ZOL attenuated bone resorption at an early stage (within 4 weeks postoperatively) and delayed bone formation at the advanced stage (8 weeks postoperatively). Osteosclerosis occurred at the tibial metaphysis, possibly due to osteoclast inhibition by ZOL in active growth plates (Fig 2A). Based on trabecular bone morphometric parameters, subchondral bone was significantly altered in the DMM+PBS group compared that in the sham+PBS group in terms of decreased BV/TV (Fig 2B), Tb.N (Fig 2E) and Conn.D (Fig 2F), reduced Tb.Th (Fig 2C), and increased Tb.Sp (Fig 2D) at an early stage, and increased BV/TV, thickened Tb.Th, narrowed Tb.Sp, and decreased Tb.N and Conn.D at advanced stages. However, these changes were preserved by ZOL, especially during early OA. PINP and CTX-I levels consistently and time-dependently increased in the DMM+PBS group compared with those in the sham+PBS group; ZOL also decreased CTX-I levels in early OA (Fig 2G and 2H).
Fig 2

DMM-induced abnormal subchondral bone remodeling is inhibited by ZOL.

(A) Reconstructed coronal μCT images of tibial subchondral bone at various time-points after OA induction. Scale bar, 2,000 μm. (B, C, D, E, and F) Quantitative μCT analyses of microarchitecture in tibial subchondral bone: (B) BV/TV (%), (C) Tb.Th, (D) Tb.Sp, (E) Tb.N and (F) Conn.D (n = 6 per group/time point). Quantitative analysis of (G) PINP and (H) CTX-I at various time-points (n = 6 per group/time point). *P < 0.05, **P < 0.01, and ***P < 0.001, compared with sham+PBS group; #P < 0.05, ##P < 0.01, and ###P < 0.001, compared with DMM+PBS group.

DMM-induced abnormal subchondral bone remodeling is inhibited by ZOL.

(A) Reconstructed coronal μCT images of tibial subchondral bone at various time-points after OA induction. Scale bar, 2,000 μm. (B, C, D, E, and F) Quantitative μCT analyses of microarchitecture in tibial subchondral bone: (B) BV/TV (%), (C) Tb.Th, (D) Tb.Sp, (E) Tb.N and (F) Conn.D (n = 6 per group/time point). Quantitative analysis of (G) PINP and (H) CTX-I at various time-points (n = 6 per group/time point). *P < 0.05, **P < 0.01, and ***P < 0.001, compared with sham+PBS group; #P < 0.05, ##P < 0.01, and ###P < 0.001, compared with DMM+PBS group.

ZOL inhibits articular cartilage degeneration in DMM-induced OA rats

Sections stained with HE and Safranin O-fast green to assess histomorphological changes in cartilage during OA progression. Cartilage degeneration generally occurred and time-dependently worsened from 2–12 weeks after surgery. HE staining showed decreased thickness of the HC, whereas the CC increased with tidemark duplication and moved closer to the articular surface in the DMM+PBS group compared with that in the sham+PBS group (Fig 3A and 3B). The thickness of the CC was attenuated by ZOL at 2 and 4 weeks after surgery (Fig 3C). The CC/TAC ratio was higher in the DMM+PBS group than those in sham+PBS and DMM+ZOL groups 4 weeks postoperatively; the sham+PBS group and DMM+ZOL groups did not significantly differ at 2 and 4 weeks after surgery (Fig 3D).
Fig 3

ZOL inhibits the increase of calcified cartilage in DMM-induced OA rats.

Histological analysis of articular cartilage stained with (A, B and C) HE, in coronal sections of tibia at various time-points. Scale bar, 100 μm. Quantitative analysis of (D) CC/TAC at various time-points (n = 6 per group/time point). **P < 0.01 and ***P < 0.001, compared with sham+PBS group; ##P < 0.01 and ###P < 0.001, compared with DMM+PBS group.

ZOL inhibits the increase of calcified cartilage in DMM-induced OA rats.

Histological analysis of articular cartilage stained with (A, B and C) HE, in coronal sections of tibia at various time-points. Scale bar, 100 μm. Quantitative analysis of (D) CC/TAC at various time-points (n = 6 per group/time point). **P < 0.01 and ***P < 0.001, compared with sham+PBS group; ##P < 0.01 and ###P < 0.001, compared with DMM+PBS group. Safranin O-fast green staining indicated that compared with those in the sham+PBS group at 2 weeks following surgery, matrix and chondrocytes in the DMM+PBS group were lost mainly in the superficial cartilage layer. This extended into the deep zone and generated irregular cracks at 4 weeks. Full-thickness degeneration and tidemark replication that occurred at 8 weeks, became more widespread by 12 weeks (Fig 4B). The cartilage degeneration grade was mild, and the process was slow in the DMM+ZOL group (Fig 4C). The OARSI score showed significantly increased cartilage degeneration in the DMM+PBS group, compared with that in the sham+PBS group, while degeneration was attenuated in the DMM+ZOL group after OA induction (Fig 4D).
Fig 4

ZOL attenuates articular cartilage degeneration in DMM-induced OA rats.

Histological analysis of articular cartilage stained with (A, B and C) Safranin O-fast green in coronal sections of tibia at various time-points. Scale bar, 100 μm. Quantitative analysis of (D) OARSI scores at various time-points (n = 6 per group/time point). *P < 0.05, **P < 0.01, and ***P < 0.001, compared with sham+PBS group; #P < 0.05, compared with DMM+PBS group.

ZOL attenuates articular cartilage degeneration in DMM-induced OA rats.

Histological analysis of articular cartilage stained with (A, B and C) Safranin O-fast green in coronal sections of tibia at various time-points. Scale bar, 100 μm. Quantitative analysis of (D) OARSI scores at various time-points (n = 6 per group/time point). *P < 0.05, **P < 0.01, and ***P < 0.001, compared with sham+PBS group; #P < 0.05, compared with DMM+PBS group.

ZOL attenuates osteoclast activity in early OA in vitro and in vivo

The number of TRAP-positive osteoclasts was higher in the DMM+PBS group than the sham+PBS group 4 weeks after OA induction (Fig 5A and 5B), whereas ZOL significantly inhibited osteoclast formation (Fig 5C and 5D). These findings supported the hypothesis that DMM caused subchondral bone loss by enhancing bone resorption mediated by increasing osteoclasts during early OA.
Fig 5

ZOL inhibits osteoclast formation in DMM-induced OA rats.

Analysis of osteoclast formation in subchondral bone stained with (A, B and C) TRAP in coronal sections of tibia at various time-points. Scale bar, 100 μm. Quantitative analysis of (D) Oc.S/BS at various time-points (n = 6 per group/time point). **P < 0.01 and ***P < 0.001, compared with sham+PBS group; ##P < 0.01 and ###P < 0.001, compared with DMM+PBS group.

ZOL inhibits osteoclast formation in DMM-induced OA rats.

Analysis of osteoclast formation in subchondral bone stained with (A, B and C) TRAP in coronal sections of tibia at various time-points. Scale bar, 100 μm. Quantitative analysis of (D) Oc.S/BS at various time-points (n = 6 per group/time point). **P < 0.01 and ***P < 0.001, compared with sham+PBS group; ##P < 0.01 and ###P < 0.001, compared with DMM+PBS group. The histomorphological and μCT findings demonstrated accelerated bone turnover at the early stage of DMM-induced OA in rats, indicating that bone resorption mediated by osteoclasts increased. To confirm this, BMMs were isolated from tibial bone marrow 4 weeks after OA induction and osteoclast formation, migration, and adhesion were examined. The results of TRAP and crystal violet staining showed that DMM significantly enhanced, whereas ZOL inhibited osteoclast formation (Fig 6A and 6D), BMM migration (Fig 6B and 6E) and adhesion (Fig 6C and 6F).
Fig 6

ZOL attenuates BMM activity in vitro 4 weeks after DMM-induced OA.

(A) Ability of BMMs to differentiate into multinucleated osteoclasts and (D) quantitative analysis of TRAP staining. Scale bar, 200 μm. (B) Migrated and (C) adherent BMMs stained with crystal violet. Scale bar, 500 μm. Quantitation of BMM (E) migration and (F) adhesion (n = 6 per group). ***P < 0.001, compared with sham+PBS group; ###P < 0.001, compared with DMM+PBS group.

ZOL attenuates BMM activity in vitro 4 weeks after DMM-induced OA.

(A) Ability of BMMs to differentiate into multinucleated osteoclasts and (D) quantitative analysis of TRAP staining. Scale bar, 200 μm. (B) Migrated and (C) adherent BMMs stained with crystal violet. Scale bar, 500 μm. Quantitation of BMM (E) migration and (F) adhesion (n = 6 per group). ***P < 0.001, compared with sham+PBS group; ###P < 0.001, compared with DMM+PBS group.

ZOL attenuates expression of Wnt5a and osteoclastogenesis genes induced by DMM during early OA

To further elucidate the possible mechanism of osteoclastogenesis in early OA at the molecular level, the activities of Wnt5a and CXCL12, together with NFATc1, RANKL, Trap, Opg, and Ctsk in the tibia were examined. Immunohistochemical staining indicated that significantly more cells in the DMM+PBS group were positive for Wnt5a (Fig 7A and 7E), CXCL12 (Fig 7B and 7E), and NFATc1 (Fig 7C and 7E), which play important roles in cell migration and osteoclastogenesis in tibial subchondral bone, than in the sham+PBS group. Western blotting (Fig 7D and 7F) and qPCR (Fig 7G–7I) data of the proximal tibia showed that ZOL suppressed the significantly increased expression of Wnt5a, CXCL12, and osteoclastogenesis genes induced by DMM. These findings further supported the possible effects of Wnt5a on osteoclastogenesis and function.
Fig 7

ZOL attenuates the expression of Wnt5a and osteoclastogenesis genes 4 weeks after DMM-induced OA.

Expression of (A) Wnt5a, (B) CXCL12 and (C) NFATc1 determined by immunohistochemical staining and by (E) quantitative analysis. Scale bar, 200 μm. n = 6 per group. (D) Western blots and (F) quantitation of Wnt5a, RANKL, CXCL12 and NFATc1. Reverse transcription quantitative polymerase chain reaction of (G) Wnt5a, CXCL12, NFATc1, (H) RANKL, OPG, RANKL/OPGand (I) TRAP, Ctsk. n = 3 per group. *P < 0.05, **P < 0.01, and ***P < 0.001, compared with sham+PBS group; #P < 0.05, ##P < 0.01, and ###P < 0.001, compared with DMM+PBS group.

ZOL attenuates the expression of Wnt5a and osteoclastogenesis genes 4 weeks after DMM-induced OA.

Expression of (A) Wnt5a, (B) CXCL12 and (C) NFATc1 determined by immunohistochemical staining and by (E) quantitative analysis. Scale bar, 200 μm. n = 6 per group. (D) Western blots and (F) quantitation of Wnt5a, RANKL, CXCL12 and NFATc1. Reverse transcription quantitative polymerase chain reaction of (G) Wnt5a, CXCL12, NFATc1, (H) RANKL, OPG, RANKL/OPGand (I) TRAP, Ctsk. n = 3 per group. *P < 0.05, **P < 0.01, and ***P < 0.001, compared with sham+PBS group; #P < 0.05, ##P < 0.01, and ###P < 0.001, compared with DMM+PBS group.

Discussion

This study determined the spatiotemporal order of ZOL in OA and the underlying molecular mechanisms. These findings indicated that DMM induced OA with a higher OARSI score and CC/TAC ratio in model rats. Abnormal subchondral bone remodeling was characterized by enhanced bone resorption whereas osteoclast activity was significantly increased in early OA, which was confirmed by the CTX-I and PINP findings. Furthermore, ZOL alleviated bone resorption by inhibiting osteoclast activity, thus delaying OA progression (time) and reducing cartilage degeneration (space), reflecting the spatiotemporal effect of ZOL on OA. Additionally, osteoclast activation might be associated with Wnt5a signaling. OA is a chronic, progressive, and degenerative disease characterized by abnormal subchondral bone remodeling and cartilage degeneration. The stage and severity of OA may be quantified using OARSI scores, which comprise the standard method for OA cartilage histopathology assessment [19]. Compared with other scoring methods, the OARSI score reveals early pathological changes in OA and provides guidance for basic research, as well as OA clinical diagnosis and treatment [23]. Lost trabecular bone and cartilage degeneration may reportedly be determined in animal models using OARSI scores at 1 or 2 weeks after OA induction [24, 25]. The results of the present study contradicted this, as only minor cartilage degeneration was observed 4 weeks after OA induction. This might be partially due to the fact that the OA model in the present study was induced using DMM, which is minimally invasive, and does not generate interference due to trauma, or acute inflammatory or immune responses, and thus, better simulates chronic, progressive, and degenerative OA. Sex and species may also affect OA [26, 27]. The knee OA seems to involve the whole joint [28]. Articular cartilage and subchondral bone form structural and functional units that participate in OA pathology [29]. Traditionally, the subchondral bone plate has been regarded as a barrier to prevent molecular and informational communication between articular cartilage and subchondral bone [30]. However, recent findings have suggested that subchondral bone remodeling influences cartilage degeneration through a crosstalk mechanism in bone-cartilage junctions [31, 32]. Experimental animal and clinical findings have proven that increased numbers of cysts in subchondral bone during early OA is an adaptive change in response to abnormal bone remodeling and is associated with osteoclast activation [33]. Consistent with previous results, more osteoclasts were found in subchondral bone and BMM migration and adhesion increased 4 weeks after DMM-induced OA, which enhanced bone resorption and reduced subchondral bone mass. However, others have focused on intermediate or late OA, and may have missed the crucial early stage in which subchondral bone undergoes rapid resorption, similar to the trigger for OA deterioration. The third-generation, nitrogen-containing, long-acting bisphosphonate, ZOL, significantly increases bone mineral density by suppressing osteoclast activity and it is the standard clinical treatment for osteoporosis [34]. Thus, ZOL was applied to rat models of OA. Early subchondral bone resorption was inhibited, and OARSI scores, as well as the TRAP staining, μCT, and ELISA results confirmed that ZOL improved the abnormal subchondral bone remodeling and then attenuated cartilage degeneration. We believe that this was a causal sequential event, as ZOL delayed OA progression and reduced cartilage degeneration, which was referred to as a spatiotemporal effect of ZOL on OA. These findings indicated that early effective measures to improve bone remodeling might be an OA treatment strategy. The Wnt/β-catenin signaling pathway is involved in bone formation and cartilage degeneration in late OA [8]. It exerts bone remodeling behavior coupled with bone formation, regardless of whether bone resorption is associated with Wnt5a signaling pathways. Maeda et al. have found that mice deficient in Wnt5a have abnormal bone remodeling due to impaired osteoclast formation [12]. In contrast, another study has found that Wnt5a upregulates low-density lipoprotein receptor-related protein 5/6 expression in osteoblast-lineage cells, which promotes osteoblastogenesis and inhibits adipogenesis via Wnt/β-catenin signaling [12]. These previous findings suggest that Wnt5a does not simply inhibit, but rather enhances Wnt/β-catenin signaling; notably, Wnt5a exerts bidirectional regulation in tumors [11]. Therefore, it is inferred that Wnt5a derived from different cells in various microenvironments binds to a diversity of receptors to form different complexes, thus activating corresponding downstream transcription factors and playing a regulatory role. Here, DMM increased Wnt5a expression and upregulated levels of RANKL, CXCL12, NFATc1, and osteoclastogenesis genes, including TRAP and Ctsk, which were significantly attenuated by ZOL. Bone resorption of osteoclasts might have been inhibited by ZOL, which would have changed the acidic environment in subchondral bone and indirectly inhibited the expression of RANKL, CXCL12, and osteoclastogenesis mediated by the Wnt5a signaling pathway. However, this study has several limitations. First, data were collected at four time points to investigate early subchondral bone loss and late-stage OA development. Inevitably, this excluded many time points during which key events related to OA might have occurred. Second, the same model was not tracked and data about technical limitations were not collected, such as generating μCT results from observations in vivo, which could also save experimental animals. Third, referring to previous study [35], we only selected a single dose of ZOL (100 μg/Kg), whereas did not observe the effects of different dose and frequency of administration on OA. Fourth, 8-week-old rats were used for modeling in this study, although the observation lasted for 12 weeks after modeling, it was difficult to completely simulate the changes of OA in human. The primary OA is more likely to occur in the aged than in young people, and it may be that young people have a better capacity to manage joint damage. Moreover, in controlled experiments, the complexities of changing metabolism and skeletal size during growth can obscure how joints respond to damage and therapy. Thus, to obtain the most meaningful insights into human OA, it is essential to use skeletally mature animals whenever possible [36]. In contrast to primary degenerative OA, juvenile idiopathic arthritis (JIA) and rheumatoid arthritis (RA) are present from early childhood, and their pathogenesis may be related to infection, genetics and immunity [37]. Osteochondritis dissecans (OCD) is another adolescent disease characterized by focal, idiopathic changes in the subchondral bone and overlying articular cartilage. Repetitive microtrauma is the most common external mechanism that may lead to this disorder [38]. In addition, we only detected the relationship between Wnt5a and osteoclast differentiation related factors in subchondral bone tissue through animal experiments, and the specific molecular mechanism of their interaction needs to be further explored through cell experiments.

Conclusion

By inhibiting the bone resorption of osteoclasts in early OA, ZOL improves the imbalance of subchondral bone remodeling, thus delaying OA progression and reducing cartilage degeneration. This is regarded as a spatiotemporal effect of ZOL on OA, which may be consider as evidence of crosstalk between articular cartilage and subchondral bone. Osteoclast activity in early OA might be associated with the Wnt5a signaling pathway, which could serve as a strategy for the precise treatment of OA.

Details about some experiments.

(PDF) Click here for additional data file. 11 May 2022
PONE-D-22-08357
Zoledronic acid generates a spatiotemporal effect to attenuate osteoarthritis by inhibiting Wnt5a-mediated abnormal bone resorption in subchondral bone
PLOS ONE Dear Dr. Ding, Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses all the points raised during the review process. In the addition, for the ethics section, please describe the use of adeqate analgesics after the surgery. 
Please submit your revised manuscript by Jun 11 2022 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. Please include the following items when submitting your revised manuscript: A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'. If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter. If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols. We look forward to receiving your revised manuscript. Kind regards, Juha Tuukkanen Academic Editor PLOS ONE Journal Requirements: When submitting your revision, we need you to address these additional requirements. 1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf 2. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels. In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions. [Note: HTML markup is below. Please do not edit.] Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Partly ********** 2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: No ********** 3. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: No ********** 4. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes ********** 5. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: Ding et al show that zoledronic acid can halt OA progression. They further provide interesting data on bone remodelling and especially on osteoclast activity during early OA. This data is very interesting and very important. In addition, authors claim that effects are mediated by inhibiting wnt5a signaling. Associated analyses are performed well but I find it slightly difficult that this is only focused on wnt5a, thus I see that part of the wording should be reconsidered so that made claims are aligned with results. In general, manuscript is well written and the study design is mostly appropriate. There are some major methodological issues that also have to be improved. Major comments: 1. Wnt signaling is very important to bone physiology. Is seems to play role in bone development and mechanosensation. Furthermore, lorecivivint seems to be most potential to be accepted as first disease modifying osteoarthris drug. Lorecivivint also targets wnt signaling by inhibiting DYRK1A and CLK2. So how can you be sure that the halting effect for OA progression is mediated trough wnt5a signaling? Furthermore, I think last graph makes little sense. Thus, I would propose to make wnt5a as potential mechanism. For example, conclusion is ok but title indicates that it is wnt5a only. Furthermore, please see Wang, L., Fang, D., Xu, J. et al. Various pathways of zoledronic acid against osteoclasts and bone cancer metastasis: a brief review. BMC Cancer 20, 1059 (2020). https://doi.org/10.1186/s12885-020-07568-9 2. One big limitation of the current study is the young age of animals (juvenile OA) and this should be added in discussion. 3. Reference 19 cannot be correct. That is the editorial for the issue that introduced the grading system for human cartilage. Rats have specific grading system introduced few years later. Please correct. Gerwin N, Bendele AM, Glasson S, Carlson CS. The OARSI histopathology initiative - recommendations for histological assessments of osteoarthritis in the rat. Osteoarthritis Cartilage. 2010 Oct;18 Suppl 3:S24-34. doi: 10.1016/j.joca.2010.05.030. PMID: 20864021. 4. It is challenging to understand where bone morphometric analysis (microCT) has been conducted and it would be good to add explanatory visualization. 5. This data is important for the as typically OA animal models show bone loss and you have bone sclerosis at 12 weeks. However, it seems that the there is significant bone destruction in DMM group at 12 weeks and thus the BV/TV value alone is misleading. Please provide some cross-anatomy evaluation in addition to morphometric parameters. 6. In general N=3 is not sufficient for any statistical evaluation. Thus, the molecular biology part is also statistically weak. How come there is no deviation in controls in fig 6 F-I? 7. Please provide better quality (4 of the current ones are now yellow) and more (larger area) representative histological images in Fig 4 A. 8. Figure 8 aims to summarize the study but I find it weird. Please remove. Minor: 9. Alltough manuscript is mainly well written there are some poorly written parts like OA induction and should be rewritten with appropriate English. 10. Please do not call bone morphometric parameters indexes and give the full name for all acronyms (CD – connective density?). 11. 250 µA is not intensity but tube current (10W). Please follow “Bouxsein, M.L., Boyd, S.K., Christiansen, B.A., Guldberg, R.E., Jepsen, K.J. and Müller, R. (2010), Guidelines for assessment of bone microstructure in rodents using micro–computed tomography. J Bone Miner Res, 25: 1468-1486. https://doi.org/10.1002/jbmr.141” when reporting microCT methods and results. ********** 6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step. 18 May 2022 Dear editor, Thanks for the comments from you and peer reviewers about the manuscript (PONE-D-22-08357). I have consulted a large number of materials according to the references you provided, and carefully studied and analyzed your review comments. I think these comments are of great help to modify and improve the quality of my article. I have revised the manuscript according to these valuable opinions, and the following is my reply to the revised opinions. I ensure that my manuscript meets PLOS ONE's style requirements, including those for file naming. I provided the original uncropped and unadjusted images underlying all blot or gel results reported both in a submission’s figures and Supporting Information file described as “Details about some experiments”. I re-analyzed the data of qPCR and WB, and uploaded the updated data. All the original data can be queried in the following public database: https://doi.org/10.7910/DVN/ECQM07, Harvard Dataverse, V2. I used the PACE before submitting to check my figures and convert to the accepted formats. 1. “In the addition, for the ethics section, please describe the use of adequate analgesics after the surgery.” Answer: Thanks for your opinion, I described the pain management of experimental animals as required in the ethics and OA induction sections. Major comments: 1. “So how can you be sure that the halting effect for OA progression is mediated trough wnt5a signaling? Furthermore, I think last graph makes little sense. Thus, I would propose to make wnt5a as potential mechanism. For example, conclusion is ok but title indicates that it is wnt5a only. Furthermore, please see Wang, L., Fang, D., Xu, J. et al. a brief review. BMC Cancer 20, 1059 (2020). https://doi.org/10.1186/s12885-020-07568-9.” Answer: Thanks for reviewer’s comments, which are consistent with my initial idea. I gained a great deal of useful information from the review provided by the reviewer. In the present study, a possible correlation between abnormal subchondral bone resorption and Wnt5a was found in the early stage of OA in rats, and this possible relationship was preliminarily proved by the in vitro experiment of the primary BMMs. Therefore, I agree with the reviewer that the results of this study can only preliminarily show that Wnt5a is a possible mechanism related to early abnormal subchondral bone absorption of OA, but cannot completely clarify the specific mechanism related to Wnt5a. According to the suggestions of reviewers, I seriously reconsidered and modified some words in the title, results and conclusion so that made claims are aligned with results. In fact, another study we conduct is in progress, which is about the possible mechanism of Wnt5a mediating intercellular crosstalk and regulating bone remodeling in the subchondral bone microenvironment at the early stage of OA, and I hope it can be accepted by the journal in the later submission. 2. “One big limitation of the current study is the young age of animals (juvenile OA) and this should be added in discussion.” Answer: Thanks for reviewer’s comments. I agree with the reviewer's comments and add the discussion about this part in the manuscript. OA is a disease of adults, and growing animals, like children, seem to have a better capacity at managing joint damage. Moreover, in controlled experiments, the complexities of changing skeletal size and metabolism during growth can obscure how joints respond to injury and therapy. Thus, to obtain the most meaningful insights into human OA, it is essential to use skeletally mature animals whenever possible. There are many animal models that reproduce key aspects of human OA in terms of natural history, mechanisms, signs and symptoms. Yet, as not one animal model completely reproduces the signs and symptoms of human OA, we must remain mindful to use the most appropriate model to answer our scientific questions. As for the age of the OA model, I referred to and agreed with the literature recommended by reviewer, suggesting that rats older than 12 weeks should be used to establish OA model to simulate the development of human OA as much as possible. The 8-week-old male rats were uniformly used in this study. Although the study period was 12 weeks after modeling, the 20-week-old rats also had the longest possible course of OA. The weight of the 8-20-week-old rats was relatively stable, consistent with the statistical significance of normal distribution, and the hormone and metabolism levels were stable. In this way, the influence of stress, hormone, metabolism and other factors on the results was avoided. Rats in this age range may have a more reasonable metabolism of positive control drugs (ZOL). As the age of old SD rats increases, the incidence of cartilage spontaneous cysts increases, which is not conducive to the study of OA. Young rats can shorten the decalcification time, but too young age may be a deficiency of this study, and the possible influence of age factor and rat tissue maturity on the results is not fully considered. We will improve this in the later study. Thanks to reviewers for their important suggestions and opinions. 3. “Reference 19 cannot be correct.” Answer: Thanks for the reviewer's reminding, I corrected this mistake and modified the experimental method accordingly. 4. “It is challenging to understand where bone morphometric analysis (microCT) has been conducted and it would be good to add explanatory visualization.” Answer: Thank you for your advice. As requested, I added and improved the explanatory visualization in the method about “Micro-computer tomography (CT) analysis” as following: A portion (0.5 mm below the growth plate and 1 mm in Height, 3.5 mm ventrodorsal length) of the load-bearing region at the medial tibial plateau was identified as the region of interest (ROI). 5. “However, it seems that the there is significant bone destruction in DMM group at 12 weeks and thus the BV/TV value alone is misleading. Please provide some cross-anatomy evaluation in addition to morphometric parameters.” Answer: Thank you for your advice. In the revised manuscript, I provided the figures of Saffron O-fast green staining as required, which may be used as cross-anatomy evaluation. In addition, in our unpublished articles, general observation figures (SF.1) of rats’ knee joints at 4 and 8 weeks postoperative can be used as supporting documents as evidence of cross-anatomy evaluation. Supplement figure 1. General observation of rats’ knee joints at 4 and 8 weeks postoperative. Ideally, it will be possible to consider MRI and micro-CT as less invasive technologies for the gold standard of macroscopic and microscopic evaluation. However, due to limited conditions, our laboratory did not have micro-CT, and due to the impact of COVID-19, we could not transport live experimental animals to the laboratory in Shanghai for dynamic observation with micro-CT. Therefore, we had to take samples and fix the knee joints of rats at various time points. It is then sent to a micro-CT lab in Shanghai for testing. I described this in the discussion as one of the limitations of this study, and we will try our best to overcome this in the later study by using micro-CT to achieve non-invasive dynamic observation of the course of OA in rats. Thank you for your advice and understanding. 6.“In general N=3 is not sufficient for any statistical evaluation. Thus, the molecular biology part is also statistically weak. How come there is no deviation in controls in fig 7 F-I?” Answer: Thank you for your advice and reminder. In fact, 18 male rats were randomly divided into 3 groups, and 3 of the 6 rats in each group were randomly selected for morphological and molecular biological detection respectively. It may be that we wrongly believed that 3 rats randomly selected from each group could represent the situation of each group, which also met the principle of "Reduction" in animal experiments and reduced the sample size of animal experiments to the minimum. This may not completely meet the statistical requirements, I will pay attention to and improve this point in the future, thank you for reminding. No deviation in Figure 7 may be related to my mishandling of the data. I aimed to compare the difference between the DMM group and the ZOL group by the “fold of increase” in protein and mRNA compared with the sham group, and I wrongly quantified the level of the sham group as “1” in the three repeated experiments. I realized this error and represented the level of sham group in the three repeated experiments as the means ± standard deviation. 7. Please provide better quality (4 of the current ones are now yellow) and more (larger area) representative histological images in Fig 4 A. Answer: Thank you for your advice and reminder. According to the requirements of reviewer, I improved and replaced all the figures by the “PACE”. 8. Figure 8 aims to summarize the study but I find it weird. Please remove. Answer: Thank you for your advice and reminder. According to the requirements of reviewers, I removed the figure 8. 9. Although manuscript is mainly well written there are some poorly written parts like OA induction and should be rewritten with appropriate English. Answer: Thank you for your advice and reminder. According to the requirements of reviewers, I rewritten and improved the “OA induction” with appropriate English according to the steps shown in the following Supplement figure 2. Supplement figure 2: DMM induced OA in rats. 10. Please do not call bone morphometric parameters indexes and give the full name for all acronyms (CD – connective density?). Answer: Thank you for your advice and reminder. I have referred to the literature you provided and modified the description of trabecular bone morphometry according to the guidelines involved in the literature (The following table 2). 11. “250 µA is not intensity but tube current (10W). Please follow” Answer: Thank you for your advice and reminder. I have referred to the literature you provided and modified the description of key parameters for μCT scan acquisition following the guidelines involved in the literature (The following table 1). Thanks again to the editors and reviewers for their comments, which are of great help to modify and improve the quality of my article. Yours sincerely, Corresponding author: Dong Ding Submitted filename: Response to Reviewers.docx Click here for additional data file. 5 Jul 2022 Zoledronic acid generates a spatiotemporal effect to attenuate osteoarthritis by inhibiting potential Wnt5a-associated abnormal subchondral bone resorption PONE-D-22-08357R1 Dear Dr. Ding, We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements. Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication. An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org. If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org. Kind regards, Juha Tuukkanen Academic Editor PLOS ONE Additional Editor Comments (optional): Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation. Reviewer #1: All comments have been addressed ********** 2. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Partly ********** 3. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: Yes ********** 4. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: No ********** 5. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes ********** 6. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: The authors have revised the submitted manuscript. It seems that they have made the necessary changes. In general, I hope that you provide author reply and author action with all of your future revisions. There is an author reply in this revision but the reviewer must search for possible changes in the manuscript. This is highly time-consuming and frustrating. ********** 7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No ********** 19 Jul 2022 PONE-D-22-08357R1 Zoledronic acid generates a spatiotemporal effect to attenuate osteoarthritis by inhibiting potential Wnt5a-associated abnormal subchondral bone resorption Dear Dr. Ding: I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org. If we can help with anything else, please email us at plosone@plos.org. Thank you for submitting your work to PLOS ONE and supporting open access. Kind regards, PLOS ONE Editorial Office Staff on behalf of Dr. Juha Tuukkanen Academic Editor PLOS ONE
  38 in total

1.  Subchondral bone osteoclasts induce sensory innervation and osteoarthritis pain.

Authors:  Shouan Zhu; Jianxi Zhu; Gehua Zhen; Yihe Hu; Senbo An; Yusheng Li; Qin Zheng; Zhiyong Chen; Ya Yang; Mei Wan; Richard Leroy Skolasky; Yong Cao; Tianding Wu; Bo Gao; Mi Yang; Manman Gao; Julia Kuliwaba; Shuangfei Ni; Lei Wang; Chuanlong Wu; David Findlay; Holger K Eltzschig; Hong Wei Ouyang; Janet Crane; Feng-Quan Zhou; Yun Guan; Xinzhong Dong; Xu Cao
Journal:  J Clin Invest       Date:  2019-02-04       Impact factor: 14.808

2.  Osteochondritis dissecans: editorial comment.

Authors:  Eric W Edmonds; Kevin G Shea
Journal:  Clin Orthop Relat Res       Date:  2013-04       Impact factor: 4.176

3.  Arthritis and dentistry.

Authors:  Rozana Valiji Bharmal; Matthew Chia
Journal:  Prim Dent J       Date:  2022-03

4.  Wnt5a can both activate and repress Wnt/β-catenin signaling during mouse embryonic development.

Authors:  Renée van Amerongen; Christophe Fuerer; Makiko Mizutani; Roel Nusse
Journal:  Dev Biol       Date:  2012-07-04       Impact factor: 3.582

5.  Protective effect of zoledronic acid on articular cartilage and subchondral bone of rabbits with experimental knee osteoarthritis.

Authors:  Guorong She; Ziqi Zhou; Zhengang Zha; Fei Wang; Xiaoting Pan
Journal:  Exp Ther Med       Date:  2017-09-19       Impact factor: 2.447

6.  Inhibition of TGF-β signaling in mesenchymal stem cells of subchondral bone attenuates osteoarthritis.

Authors:  Gehua Zhen; Chunyi Wen; Xiaofeng Jia; Yu Li; Janet L Crane; Simon C Mears; Frederic B Askin; Frank J Frassica; Weizhong Chang; Jie Yao; John A Carrino; Andrew Cosgarea; Dmitri Artemov; Qianming Chen; Zhihe Zhao; Xuedong Zhou; Lee Riley; Paul Sponseller; Mei Wan; William Weijia Lu; Xu Cao
Journal:  Nat Med       Date:  2013-05-19       Impact factor: 53.440

Review 7.  Interplay between cartilage and subchondral bone contributing to pathogenesis of osteoarthritis.

Authors:  Ashish R Sharma; Supriya Jagga; Sang-Soo Lee; Ju-Suk Nam
Journal:  Int J Mol Sci       Date:  2013-09-30       Impact factor: 5.923

8.  WNT5A encodes two isoforms with distinct functions in cancers.

Authors:  Matthieu Bauer; Jean Bénard; Terry Gaasterland; Karl Willert; David Cappellen
Journal:  PLoS One       Date:  2013-11-18       Impact factor: 3.240

9.  Association between subchondral bone structure and osteoarthritis histopathological grade.

Authors:  Mikko A J Finnilä; Jérôme Thevenot; Olli-Matti Aho; Virpi Tiitu; Jari Rautiainen; Sami Kauppinen; Miika T Nieminen; Kenneth Pritzker; Maarit Valkealahti; Petri Lehenkari; Simo Saarakkala
Journal:  J Orthop Res       Date:  2016-06-22       Impact factor: 3.494

Review 10.  Nanotechnological Strategies for Osteoarthritis Diagnosis, Monitoring, Clinical Management, and Regenerative Medicine: Recent Advances and Future Opportunities.

Authors:  Reza Mohammadinejad; Milad Ashrafizadeh; Abbas Pardakhty; Ilona Uzieliene; Jaroslav Denkovskij; Eiva Bernotiene; Lauriane Janssen; Gabriela S Lorite; Simo Saarakkala; Ali Mobasheri
Journal:  Curr Rheumatol Rep       Date:  2020-04-04       Impact factor: 4.592

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.