Literature DB >> 35834570

Enrichment of circulating trophoblasts from maternal blood using filtration-based Metacell® technology.

Jana Weymaere1, Ann-Sophie Vander Plaetsen1, Yasmine Van Den Branden2, Eliska Pospisilova3, Olivier Tytgat1, Dieter Deforce1, Filip Van Nieuwerburgh1.   

Abstract

In a cell-based non-invasive prenatal test (cbNIPT), intact circulating trophoblasts (CTs) are isolated from maternal blood for subsequent genetic analysis. Enrichment of these CTs from maternal blood is the most challenging step in the cbNIPT workflow. This study aims to assess the suitability of the filtration-based Metacell® technology to enrich CTs from maternal blood at week 10 to 13 of gestation. The Metacell® technology is a novel size-based enrichment technology that combines blood filtration through 8 μm pores with an in vitro culture method. Three protocols were evaluated. First, 8 mL or 16 mL of maternal blood was filtered and subsequently cultured in vitro on the separation membrane for 3 days in RPMI 1640. In addition, 16 mL of maternal blood was filtered, and immediately processed without further culturing. Y-chromosome-specific qPCR or STR analysis was performed to evaluate the enrichment of CTs. A total of 44 samples from pregnant women, out of which 26 were carrying a male fetus, were processed. Although five enriched male fetus samples show detectable male DNA quantities, it cannot be excluded that the obtained positive signal is caused by cell-free fetal DNA sticking to the Metacell® separation membrane. In conclusion, the Metacell® technology, tested as described, is not suitable for consistent enrichment of CTs.

Entities:  

Mesh:

Substances:

Year:  2022        PMID: 35834570      PMCID: PMC9282611          DOI: 10.1371/journal.pone.0271226

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.752


Introduction

The field of non-invasive prenatal screening has evolved tremendously in the past few years. The implementation of cell-free non-invasive prenatal testing (cfNIPT) in clinical practice resulted in a significant reduction of invasive prenatal testing [1]. cfNIPT is based on massively parallel sequencing of cell-free DNA (cfDNA) in maternal plasma, which is a mixture of maternal and fetal cfDNA (cffDNA) [2-5]. In addition to the detection of large copy number variants and chromosomal aneuploidies, which has been widely adopted in the clinic, some monogenic diseases can be detected using a targeted sequencing approach [4-6]. However, a number of relevant genetic disorders caused by small genetic aberrations are often missed [7-9]. An alternative approach is a cell-based NIPT (cbNIPT) in which intact circulating fetal cells are isolated from maternal blood and subsequently analyzed. A sensitive and accurate cbNIPT would allow the detection of smaller genetic aberrations than cfNIPT, as the isolated fetal cells provide a pure source of fetal genomic DNA without a disturbing background of maternal DNA [10]. Circulating trophoblasts (CTs) and nucleated red blood cells are frequently targeted fetal cells in cbNIPT research [11]. Trophoblasts are cells of the placenta. The terms ‘fetal DNA’ and ‘fetal cells’ used throughout this paper refer to these trophoblasts, and it should be considered that the genomic make-up of this ‘fetal DNA’ can differ from that of the fetus due to the possible presence of confined placental mosaicism. Because of to the larger cell size of CTs [12] compared to other blood cells and the availability of relatively specific cell markers [13,14], most cbNIPT research nowadays focuses on CTs. In a general beginning-to-end workflow for cbNIPT, maternal blood is collected at week 10 to 13 of gestation. CTs present in maternal blood are then enriched, stained, and imaged. Next, CTs are selected based on staining and/or morphology and subsequently isolated using a single cell isolation technique. Eventually, after whole genome amplification, prenatal testing is performed by analyzing fetal DNA. Although this workflow for cbNIPT is technically challenging due to the rarity and fragility of CTs in the maternal peripheral bloodstream [15], some research groups have already made significant progress in the quest for a cbNIPT. The Danish research group ARCEDI Biotech (Vejle, Denmark) succeeded in enriching CTs using magnetic-activated cell sorting [16-18]. Likewise, other research groups published evidence for the feasibility of a cbNIPT using a marker-based enrichment strategy [19-21]. Although the results are promising, the major drawbacks of these marker-based strategies are the required volume of maternal blood, the need for pre-enrichment steps such as red blood cell lysis and cell fixation, and their complex and time-consuming procedures. Instead of marker-based CT enrichment, size-based enrichment could be a valuable alternative in a cbNIPT workflow. Due to the similar physical characteristics of CTs and circulating tumor cells (CTCs) [12], size-based enrichment technologies that have been optimized for the enrichment of CTCs in cancer liquid biopsy, such as Screencell [22], Parsortix [23], and Isolation-by-Size of Epithelial Tumor cells (ISET) [12], could potentially be applied for CT enrichment. The research group of Paterlini-Bréchot reported the successful enrichment and isolation of one to two CTs per mL, starting from 10 mL of maternal blood [24], using the ISET technology. In this technology, blood is first diluted with a proprietary buffer that lyses erythrocytes and fixes nucleated cells. The diluted blood is then filtered under negative pressure through a filter containing pores of 8 μm. As a result, larger cells in the blood, such as CTCs and CTs, are enriched on the filter. Cells with a size of 15 μm or larger are then selected and isolated using laser capture microdissection [24]. Although the publication of Mouawia et al. [24] in 2012 seemed very promising, no additional papers using ISET for CT enrichment have been published since then. In addition to this size-based filtration enrichment, successful size-based microfluidic enrichment of CTs is also reported in the literature [25,26]. However, these published technologies still need to be further developed before they can be implemented in a cbNIPT workflow. The present study investigates the Metacell® technology (Metacell® s.r.o., Ostrava, Czech Republic), a novel size-based enrichment technology combined with an in vitro culture method, originally developed for the enrichment and culture of viable CTCs. In this Metacell® technology, fresh blood is filtered through a polycarbonate membrane with pores of 8 μm in less than 10 min. The filtration flow is driven by capillary forces induced by an absorbent touching the separation membrane [27], as visualized in Fig 1A. Due to the gentle flow in this separation process and the absence of pre-enrichment steps, enriched cells remain viable and intact. Therefore, cells on the separation membrane are suitable for culturing, characterization, and cytomorphological evaluation [27]. Fig 1B represents the Metacell® procedure.
Fig 1

Overview of the Metacell® technology.

A) Metacell® device in detail. B) Metacell® procedure. Blood is collected in the filtration tube with separation membrane. To start the filtration, the filtration tube is pushed down to make contact with the absorbent underneath. After filtration, the plastic ring with the separation membrane is unscrewed from the filtration unit. The separation membrane is then detached and used for characterization (a), cytomorphological evaluation (b), or culturing (c) followed by characterization or cytomorphological evaluation.

Overview of the Metacell® technology.

A) Metacell® device in detail. B) Metacell® procedure. Blood is collected in the filtration tube with separation membrane. To start the filtration, the filtration tube is pushed down to make contact with the absorbent underneath. After filtration, the plastic ring with the separation membrane is unscrewed from the filtration unit. The separation membrane is then detached and used for characterization (a), cytomorphological evaluation (b), or culturing (c) followed by characterization or cytomorphological evaluation. Besides successful CTC enrichment [27-29], the Metacell® technology has already proven to be effective for the enrichment of rare circulating endometrium cells (CECs) [30-32]. In this study, the suitability of the Metacell® technology for the enrichment of large fetal cells from maternal blood at week 10 to 13 of gestation is assessed. As trophoblasts are the largest and most abundant type of circulating fetal cells [11], it is most likely that these are enriched from maternal blood using size-based methods. If effective, the Metacell® technology could easily be implemented in a cbNIPT workflow, as visualized in Fig 2.
Fig 2

Metacell® CT enrichment and related procedures implemented in a cbNIPT workflow.

(1) Maternal blood containing a low fraction of CTs, is collected at week 10 to 13 of gestation. (2) CTs are enriched using the size-based Metacell® technology. Larger cells, such as CTs, remain on the separation membrane. Optionally, the membrane with cells is further cultured to deplete more unwanted cells. (3) A fluorescent dye is added to the culture medium. Cells on the membrane are then visualized with an LCM fluorescence microscope. (4) Based on cytomorphology, cytochemical staining, or immunostaining, a single CT is selected and isolated with UV-LCM. (5) The genome of the single cell is then amplified. (6) Eventually, DNA analysis is performed.

Metacell® CT enrichment and related procedures implemented in a cbNIPT workflow.

(1) Maternal blood containing a low fraction of CTs, is collected at week 10 to 13 of gestation. (2) CTs are enriched using the size-based Metacell® technology. Larger cells, such as CTs, remain on the separation membrane. Optionally, the membrane with cells is further cultured to deplete more unwanted cells. (3) A fluorescent dye is added to the culture medium. Cells on the membrane are then visualized with an LCM fluorescence microscope. (4) Based on cytomorphology, cytochemical staining, or immunostaining, a single CT is selected and isolated with UV-LCM. (5) The genome of the single cell is then amplified. (6) Eventually, DNA analysis is performed.

Materials and methods

Experimental design

The suitability of the Metacell® technology was assessed for the enrichment of CTs from maternal blood at 10 to 13 weeks of gestation. To facilitate this assessment, mainly blood samples from women carrying a male fetus were processed, followed by Y-chromosome-specific detection. Processing maternal blood from women carrying a female fetus requires autosomal STR-analysis. However, the interpretation of the result would be much more challenging, as at least 50% of the autosomal STRs overlap between mother and fetus. Moreover, the limited fraction of fetal cells in the presence of maternal cells results in a huge allelic imbalance which hampers efficient amplification and detection of the minor allele fraction. In order to avoid these challenges, mainly blood samples from women carrying a male fetus were processed in this proof-of-concept study. As visualized in Fig 3, three protocols that vary in maternal blood volume and Metacell® procedure, were evaluated. In the first protocol, which has already proven to be successful for the enrichment of CTCs and CECs [27-32], 8 mL of maternal blood was filtered through a Metacell® separation membrane. Assuming that culturing will result in an additional enrichment, the separation membrane was subsequently cultured in Rosewell Park Memorial Institute 1640 medium (RPMI) supplemented with L-glutamine, FBS, and a mix of penicillin and streptomycin for 3 days. In the second protocol, 16 mL of maternal blood was filtered, followed by culturing for 3 days. To assess the effect of culturing, in the third protocol, 16 mL of maternal blood was filtered through a Metacell® membrane, and the DNA was extracted without a culturing step.
Fig 3

Experimental design.

Three protocols with varying maternal blood volumes and Metacell® filtration procedures were evaluated in thisCle proof-of-concept study. Each protocol comprises sample collection, Metacell® procedure, DNA extraction, and Y-chromosome-specific detection.

Experimental design.

Three protocols with varying maternal blood volumes and Metacell® filtration procedures were evaluated in thisCle proof-of-concept study. Each protocol comprises sample collection, Metacell® procedure, DNA extraction, and Y-chromosome-specific detection. Following the Metacell® procedure, the presence of male cells on the separation membrane was assessed by Y-chromosome-specific detection. As only small amounts of male cells are expected on the Metacell® membrane, Y-chromosome short tandem repeat (Y-STR) analysis was chosen for detection because it has a high sensitivity. However, using Y-STR analysis, the obtained signal cannot be quantified. Therefore, in a minority of samples, Y-chromosome quantitative PCR (Y-qPCR) analysis was used in this proof-of-concept study, as Y-qPCR allows quantification. In each assay, a few maternal blood samples from women carrying a female fetus were processed in parallel to serve as a biological negative control. cffDNA present in the sample may possibly stick to the separation membrane during filtration, causing a Y-qPCR or Y-STR signal that is not caused by male fetal cells being retained on the membrane. To assess this assumption, plasma samples from pregnant women, which contain by definition cffDNA without fetal cells, were processed according to protocol 3. Plasma from four male fetus blood samples and three female fetus blood samples was filtered. In addition, to include the possible influence of blood components on the membrane, two samples containing male cffDNA in a blood matrix without male fetal cells were prepared by replacing the plasma from a female fetus blood sample by plasma from a male fetus blood sample. The latter samples are further referred to as ‘mixed samples’.

Sample collection

A total of 55 maternal blood samples were collected from women who attend their gynecologist at Ghent University Hospital for a cfNIPT at 10 to 13 weeks of gestation. All women were adult, healthy, and have signed an informed consent. The study was approved by the ethical review board of Ghent University Hospital (B670201524235), and performed in accordance with the Declaration of Helsinki. Each maternal blood sample contained 18 mL of peripheral blood, collected in K3EDTA blood collection tubes (ThermoFisher Scientific, Waltham, USA). As the sex of the fetus was not known at the time of collection, a Y-chromosome-specific qPCR was performed on an aliquot of the samples as follows: within 2 hours after collection, 2 mL of blood was centrifuged at 1,200 x g for 12 min. After centrifugation, 400 μL plasma was collected, and cell-free DNA was extracted in 100 μL nuclease-free water using the QIAamp DNA Blood Mini Kit (Qiagen, Hilden, Germany). Next, a qPCR was performed to detect the Y-chromosome-specific multicopy DYS14 sequence located within the TSPY gene, as proposed by Picchiassi et al. [33]. Amplification occurs in a total volume of 50 μL, containing 30 μL extracted DNA, 0.9 μM of both forward (5’ GGGCCAATGTTGTATCCTTCTC) and reverse (5’ GCCCATCGGTCACTTACACTTC) primer (Integrated DNA Technologies, Leuven, Belgium), 2.5 U HotStarTaq DNA Polymerase (Qiagen, Hilden, Germany), 1.25 μM EvaGreen dye in aqueous solution (VWR, Radnor, USA), 1 X PCR buffer (Qiagen, Hilden, Germany), and 200 μM of each dNTP (ThermoFisher Scientific, Waltham, USA). The qPCR was performed in triplicate using a LightCycler 480 (Roche, Basel, Switzerland) with cycling conditions of 15 min at 95°C, followed by 50 cycles of 95°C for 30 s, 57°C for 45 s, and 72°C for 1 min. Each run included two negative controls, consisting of 30 μL sterile nuclease-free water and 30 μL purified plasma from women carrying a female fetus, and a positive control, consisting of 1 ng 2800M male Control DNA (Promega, Madison, USA). Quantification cycle (Cq) values were determined with LinRegPCR version 2020.0 [34]. If plasma Cq values were below 35 (S1 Table), the pregnant woman was considered to carry a male fetus. The fetal sex was later confirmed by the Ghent University Hospital, based on cfNIPT results. All women had singleton pregnancies, except for one woman who was expecting a twin (sample 18).

Metacell® procedure

Maternal blood was transferred to the Metacell® filtration tube. Next, to start the filtration process, the filtration tube was pushed down to make contact with the absorbent underneath. After blood filtration, the filter was washed twice with 5 mL Rosewell Park Memorial Institute 1640 medium (RPMI). The plastic ring with separation membrane was then cultured for 3 days in a humidified atmosphere containing 5% CO2 at 37°C in 4 mL RPMI medium supplemented with 2 mM L-glutamine, 15% FBS, and a mix of penicillin and streptomycin at a final concentration of 100 units/mL and 100 μg/mL, respectively (all from Gibco, ThermoFisher Scientific, Waltham, USA). Next, the separation membrane was removed from the plastic ring and collected in 400 μL lysis buffer (Qiagen, Hilden, Germany). In protocol 3, the separation membrane was immediately collected in lysis buffer, without culturing the enriched cells.

DNA extraction and quantification

The Metacell® procedure was followed by DNA extraction of the enriched cells using the QIAamp DNA Blood Mini kit. First, cells on the separation membrane were lysed by incubating the membrane in 400 μL lysis buffer and 40 μL proteinase K at 56°C for 10 min. Next, 400 μL EtOH 100% was added. After mixing, the supernatant was purified according to manufacturer’s recommendations. DNA was eventually eluted in 35 μL or 40 μL sterile nuclease-free water, for samples analyzed with Y-qPCR or Y-STR, respectively. For each protocol, at least three random samples were quantified with a Qubit dsDNA High Sensitivity Assay Kit (Life Technologies, Carlsbad, USA) to evaluate the cell depletion performance. The approximate number of cells remaining after filtration, was calculated by dividing this DNA quantity by 6 pg per human diploid cell. The average fold depletion is then calculated by dividing the average range of white blood cells in 1 mL blood, which is 4.5–11 x 106 as reported by Dean [35], by the number of remaining cells.

Y-chromosome-specific detection

After DNA extraction of the enriched cells, the presence of male DNA was assessed with Y-chromosome-specific detection, either using Y-qPCR or Y-STR analysis. Fig 3 shows the exact number of samples assessed with each technology, categorized by protocol and fetal sex.

Y-chromosome quantitative PCR analysis

Y-qPCR analysis was performed on the extracted DNA to detect the Y-chromosome-specific multicopy DYS14 sequence within the TSPY gene, as previously described in section 3.2 ‘Sample collection’. Two positive controls containing 1 ng and 10 pg male 2800M Control DNA, and a no template control (NTC), consisting of 30 μL sterile nuclease-free water, were included in each run. To validate the Y-qPCR assay, a dilution series of male DNA was analyzed, containing an absolute quantity of 1,000 pg, 100 pg, 50 pg, 20 pg, 10 pg, 5 pg, and 2.5 pg male 2800M Control DNA. To mimic the maternal DNA background present in the enriched Metacell® samples, 70 ng female DNA was added to each calibrator sample. This female DNA was obtained from a blood sample of a woman carrying a female fetus, extracted with the QIAamp DNA Blood Mini kit. An NTC consisting of sterile nuclease-free water, and a negative control containing 70 ng female DNA, were included in each run. The Cq values of all calibrator samples, the negative controls, and the NTC samples are shown in S2 Table. The standard curve with R2 and equation is shown in S1 Fig. The calibrator samples were used to determine the limit of detection (LOD) and limit of quantification (LOQ) of the assay. The LOD was defined as the lowest DNA quantity in the calibrator samples for which the Cq value of all replicates falls outside the Cq range of the negative controls containing 70 ng female DNA. The LOD in this assay was 10 pg male DNA. This LOD corresponds to a Cq of 35.2, which is the geometric mean of the Cq values of the 10 pg male DNA calibrator samples. The LOQ, defined as the lowest DNA quantity in the calibrator samples for which the replicates show a coefficient of variation (CV) ≤ 35% [36], was 50 pg male DNA, corresponding with a Cq of 32.2. Assuming that each human diploid cell contains 6 pg of DNA, the LOQ corresponds with approximately 8 male cells.

Y-chromosome STR analysis

Y-chromosome STRs were amplified with the Investigator Argus Y-12 QS Kit (Qiagen, Hilden, Germany), which is a multiplex PCR kit that targets 11 Y-chromosome STR loci. Each reaction contained 33.8 μL purified DNA, 10 μL Reaction Mix A, 5 μL Primer Mix, and 1.2 μL Multi Taq2 DNA polymerase. Amplification was initiated with a denaturation step at 94°C for 4 min, followed by 5 cycles of 94°C for 30 s, 63°C for 120 s, and 72°C for 75 s and 28 cycles of 94°C for 30 s, 61°C for 120 s, and 72°C for 75 s. A final elongation step at 68°C for 60 min was performed. A positive control consisting of 0.5 ng male 9948 Control DNA (Qiagen, Hilden, Germany), and an NTC consisting of 33.8 μL sterile nuclease-free water, were included for quality control. After capillary electrophoresis of the STR amplicons with the ABI3130xl Genetic Analyzer (ThermoFisher Scientific, Waltham, USA), STR profiles were acquired and analyzed with the GeneMapper ID-x 1.2 software (ThermoFisher Scientific, Waltham, USA). Male DNA was detected if at least one allele in the Y-STR profile had a relative fluorescence unit (RFU) higher than the detection limit of 50 RFU. Analogous to Y-qPCR, the Y-STR assay was validated using a dilution series of male DNA, containing an absolute quantity of 1,000 pg, 500 pg, 100 pg, 50 pg, 20 pg, and 10 pg male DNA in a background of 70 ng female DNA. An NTC consisting of sterile nuclease-free water, and a negative control, containing 70 ng female DNA, were included in each run. The Investigator Argus Y-12 QS Y-STR assay kit was developed to detect male DNA in a mixture of male and female DNA up to a ratio of 1:4,000. According to the protocol recommendations, the optimal input DNA quantity under standard conditions is 0.2–0.5 ng, although reliable results can be obtained with less than 0.1 ng input DNA. As the lowest calibrator sample contains 10 pg male DNA in a background of 70 ng female DNA, an incomplete Y-STR profile is expected. Nevertheless, all calibrator samples show at least 9 of the 11 alleles. The STR profile of a calibrator sample containing 10 pg male DNA in a background of 70 ng female DNA is shown in S2 Fig. No male DNA was detected in the negative control and the NTC sample.

Results and discussion

Cell depletion performance of the Metacell® technology

The Metacell® procedure vastly reduces the number of remaining maternal cells. While other successful CT enrichment technologies result in a 100 to 1,000-fold depletion of white blood cells [18,37,38], the Metacell® technology shows a 10,000 fold depletion. Moreover, culturing introduces an additional depletion, reflected in the average fold depletions for protocols 1,2, and 3 shown in Table 1. During culturing, white blood cells may detach from the filter and are washed away, or they may not survive three days culturing. Nevertheless, this excellent depletion performance is no indicator for the success of CT enrichment, which is discussed in the next section.
Table 1

Overview of the Metacell® performance.

For each protocol, the average DNA quantity after enrichment, the corresponding number of remaining cells, and the average fold depletion is calculated.

ProtocolProcessed blood volumeAverage DNA quantity (ng) after enrichment (SD)Corresponding number of remaining cells (SD)Average fold depletion
18 mL7.38 (6.66)(n = 9)1230 (1109)2.9–7.1 x 104
216 mL28.64 (12.79)(n = 3)4773 (2131)1.5–3.7 x 104
316 mL42.16 (16.52)(n = 6)7026 (2757)1.0–2.5 x 104

SD: standard deviation.

Overview of the Metacell® performance.

For each protocol, the average DNA quantity after enrichment, the corresponding number of remaining cells, and the average fold depletion is calculated. SD: standard deviation.

Fetal cell enrichment and detection

A total of 44 blood samples from pregnant women were processed with the Metacell® technology. Of these samples, 26 women were carrying a male fetus, and 18 women were carrying a female fetus. In addition, plasma of seven blood samples was processed and four blood samples were used to create two mixed samples (Section 3.1 ‘Experimental design’). A total of 27 samples, including 9 male fetus samples, 9 female fetus samples, 4 male plasma samples, 3 female plasma samples, and 2 mixed samples, were assessed using Y-qPCR analysis. In Fig 4, the baseline corrected fluorescent signal of all fetus samples is plotted against the cycle number.
Fig 4

Baseline corrected fluorescent signal plotted against the cycle number.

Male fetus samples are plotted in blue, while female fetus samples are marked in pink.

Baseline corrected fluorescent signal plotted against the cycle number.

Male fetus samples are plotted in blue, while female fetus samples are marked in pink. Individual Cq values for all male fetus samples, male plasma samples, and mixed samples, categorized per protocol, are listed in Table 2. Cq values for all female fetus samples and female plasma samples are listed in S3 Table. All samples with a Cq value below the predefined LOD of 10 pg, corresponding to a Cq value of 35.2, are considered positive for male DNA. As a result, all female fetus samples and female plasma samples are negative for male DNA. Male DNA can be detected with Y-qPCR analysis in 1 out of 3 male fetus samples processed according to protocol 3 (sample 18). All male fetus samples processed according to protocol 1 or 2 have Cq values above the LOD. However, although the mixed samples have Cq values above the LOD, 2 out of 4 male plasma samples show detectable amounts of male DNA. This finding reduces the evidential value of the positive signal in male fetus samples as originating from intact fetal cells retained on the membrane. The positive signal may not only be caused by the actual presence of male CTs, but also by male cffDNA.
Table 2

Overview of the Y-qPCR and Y-STR results for male fetus samples, male plasma samples, and mixed samples, categorized by protocol and analysis method.

PROTOCOL 1
AnalysisSampleResultFetal DNA detectable?
Y-qPCR1Cq > 40No
2Cq > 40No
3Cq = 36.87No
Y-STR4EmptyNo
5EmptyNo
61 alleleYes
7EmptyNo
PROTOCOL 2
Analysis Sample Result Fetal DNA detectable?
Y-qPCR8Cq = 37.05No
9Cq = 37.98No
10Cq = 37.09No
Y-STR11EmptyNo
122 allelesYes
13EmptyNo
14EmptyNo
15EmptyNo
PROTOCOL 3
Analysis Sample Result Fetal DNA detectable?
Y-qPCR16Cq = 35.54No
17Cq > 40No
18Cq = 33.99Yes
Plasma 1Cq = 36.54No
Plasma 2Cq = 34.86Yes
Plasma 3Cq = 36.26No
Plasma 4Cq = 31.19Yes
Mixed 136.23No
Mixed 237.92No
Y-STR191 alleleYes
20EmptyNo
21EmptyNo
222 allelesYes
23EmptyNo
24EmptyNo
25EmptyNo
26EmptyNo

Cq: quantification cycle, Y-qPCR: Y-chromosome-specific quantitative PCR, Y-STR: Y-chromosome-specific short tandem repeat.

Cq: quantification cycle, Y-qPCR: Y-chromosome-specific quantitative PCR, Y-STR: Y-chromosome-specific short tandem repeat. Remarkably, positive sample 18 originates from a twin pregnancy (boy and girl). Although the Cq of this sample is above the Cq corresponding to the LOQ, the male DNA quantity in sample 18 is estimated as 19.69 pg, which corresponds to approximately 3 male cells. This finding can be a coincidence due to random biological variation in the number of CTs or cffDNA levels, or due to physiological differences between singleton and twin pregnancies at gestational week 10 to 13. However, Ravn et al. [15], and Van de Looij et al. [39] did not observe any apparent changes in CT numbers in twin pregnancies compared to singleton pregnancies, based on a few cases. Besides, there is no clarifying literature available on the cffDNA fraction in twin pregnancies in gestational week 10 to 13. Y-STR analysis was performed on a total of 26 samples, including 17 male fetus samples and 9 female fetus samples. All female fetus samples were negative for male DNA. As presented in Table 2, male DNA could only be detected in 1 out of 4 male fetus samples processed according to protocol 1 (sample 6), 1 out of 5 male fetus samples processed according to protocol 2 (sample 12), and 2 out of 8 male fetus samples processed according to protocol 3 (samples 19 and 22). Their STR profiles are shown in S3 Fig. However, similar to Y-qPCR, the obtained signal is too low to exclude cffDNA detection. Regardless of the detection method used, samples processed according to protocol 3 have the highest success rate (3 out of 11 samples, 27%). The culturing step included in protocol 1 and 2 does not only result in depletion of unwanted cells, but may also have a negative influence on target cell recovery. Overall, our results reveal that the main concern of the tested set-ups, is the lack of enriched fetal cells, and not the number of contaminating maternal cells. An unfeasible large blood volume should be processed to robustly get the required number of fetal cells for cbNIPT using the protocols as tested here. Several other set-ups could have been tested. For example, we’ve also processed some maternal samples that were fixed prior to filtration. This was unsuccessful, as the filter was immediately clogged. The results obtained after Metacell® enrichment are in contrast to the reported results obtained with the similar, but successful ISET technology [24], which mainly differs from Metacell® in terms of pre-enrichment and method of filtration flow generation. In ISET, cells are fixed/lysed prior to filtration under negative pressure, while Metacell® has the advantage of filtering whole blood driven by capillary forces. However, unfixed CTs may be deformable, whereby they are filtered through the 8 μm pores, even if they are larger than 8 μm. This might explain why the Metacell® technology is not suitable for implementation in a cbNIPT workflow.

Conclusion

The Metacell® technology, already proven to be successful for the enrichment of CTCs and CECs, is not suitable for consistent enrichment of CTs using the protocols as tested here. Although five male fetus samples show low, but detectable male DNA quantities, it cannot be excluded that the obtained signal is caused by cffDNA sticking to the separation membrane.

Standard curve, R2, and equation for Y-qPCR analysis.

All calibrator samples consist of male DNA in a background of 70 ng female DNA. (DOCX) Click here for additional data file.

Y-STR profile of a calibrator sample containing 10 pg male DNA in a background of 70 ng female DNA.

(DOCX) Click here for additional data file.

Y-STR profile of sample 6, 12, 19, and 22.

An allele is called if the fluorescent signal is higher than 50 RFU. Called alleles are marked with a blue arrow. (DOCX) Click here for additional data file.

Plasma Cq values with corresponding male DNA concentration, and fetal sex confirmation by Ghent University Hospital.

(DOCX) Click here for additional data file.

Individual Cq values of the calibrator samples used for Y-qPCR validation, with coefficient of variation.

(DOCX) Click here for additional data file.

Individual Cq values of the female fetus samples and female plasma samples, categorized per protocol.

(DOCX) Click here for additional data file. 8 Mar 2022
PONE-D-21-37386
Enrichment of circulating trophoblasts from maternal blood using filtration-based Metacell® technology.
PLOS ONE Dear Dr. Van Nieuwerburgh, Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process. Please submit your revised manuscript by Apr 22 2022 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. Please include the following items when submitting your revised manuscript:
A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'. If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter. If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols. We look forward to receiving your revised manuscript. Kind regards, Kelvin Yuen-Kwong CHAN, Ph.D. Academic Editor PLOS ONE Journal Requirements: When submitting your revision, we need you to address these additional requirements. 1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf 2. Thank you for stating the following in your Competing Interests section: "No" Please complete your Competing Interests on the online submission form to state any Competing Interests. If you have no competing interests, please state "The authors have declared that no competing interests exist.", as detailed online in our guide for authors at http://journals.plos.org/plosone/s/submit-now This information should be included in your cover letter; we will change the online submission form on your behalf. 3. In your Data Availability statement, you have not specified where the minimal data set underlying the results described in your manuscript can be found. PLOS defines a study's minimal data set as the underlying data used to reach the conclusions drawn in the manuscript and any additional data required to replicate the reported study findings in their entirety. All PLOS journals require that the minimal data set be made fully available. For more information about our data policy, please see http://journals.plos.org/plosone/s/data-availability. "Upon re-submitting your revised manuscript, please upload your study’s minimal underlying data set as either Supporting Information files or to a stable, public repository and include the relevant URLs, DOIs, or accession numbers within your revised cover letter. For a list of acceptable repositories, please see http://journals.plos.org/plosone/s/data-availability#loc-recommended-repositories. Any potentially identifying patient information must be fully anonymized. Important: If there are ethical or legal restrictions to sharing your data publicly, please explain these restrictions in detail. Please see our guidelines for more information on what we consider unacceptable restrictions to publicly sharing data: http://journals.plos.org/plosone/s/data-availability#loc-unacceptable-data-access-restrictions. Note that it is not acceptable for the authors to be the sole named individuals responsible for ensuring data access. We will update your Data Availability statement to reflect the information you provide in your cover letter [Note: HTML markup is below. Please do not edit.] Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Partly Reviewer #2: Partly ********** 2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: No Reviewer #2: N/A ********** 3. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes Reviewer #2: Yes ********** 4. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes Reviewer #2: Yes ********** 5. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: Summary of the study: In search for a biomarker-free workflow for the enrichment of circulating fetal trophoblasts (CT) from maternal blood, the authors present results from a study where they use a filtration-based technology called MetaCell to isolate fetal cells from maternal blood cells. In the study they use different amounts of blood collected from pregnant women carrying male fetuses, run the sample through the device, and confirm their presence of CTs fetal using either Y specific qPCR, or Y-STR analysis. In few cases they show the presence of male Y-chromosome. However, they don’t rule out that the presence of Y-chromosome could be due to the presence of cell-free-fetal DNA, and not necessarily CTs. The Authors conclude that MetaCell technology is not apt for isolating CTs. General Comments: Technologies isolating fetal cells from maternal blood and using them for prenatal diagnosis are attractive with a huge potential to be disruptive. A lot of research is being done not only to find new fetal cell markers, but also to exploit their different size and morphology to isolate them from maternal blood. Though the current study presents a negative result, there are some major questions and concerns that this study either misses or avoids addressing. Here are some concerns: 1. Even though the study claims that the presence of Y specific qPCR is evidence of the presence of circulating fetal trophoblasts, no direct evidence is provided to show that the technology isolates fetal trophoblasts, and not any other fetal cell type. 2. The final technology workflow for using fetal cells for prenatal diagnosis is not clear. Even if the presence of fetal cells is confirmed by qPCR, what is the roadmap for isolating individual fetal cells and using them for genetic analyses? 3. Similarly, if not for Y specific qPCR, or STR for male pregnancies, how would the fetal cells originating from female pregnancies be confirmed? Reviewer #2: The authors have tested the Metacell technology to enrich cells (trophopblasts) from the conceptus, circulating in maternal blood. I 3 different set-ups, the yield was none or poor. Testing this system is relevant, and the observations are as such relevant to others working in this field. However, the discussion should include considerations on whether the test set-up has tested the system sufficiently. I.e. could larger volumes of blood have been used, could the procedure show efficient if the blood was drawn at a later time. Could the filtering be followed by another procedure to further minimize contamination by maternal cells? Perhaps the authors could think of other possibilities Minor issues: Line 34. I recognize that the term “fetal DNA” is frequently used for the DNA originating in the conceptus, identified in the maternal blood. However, please consider using another term, as likely most of this DNA does not originate in the fetus – or at least please comment on this. Similarly, the expression cffDNA is misleading Line 43. Similarly to the comment to line 34, it would be nice avoid calling trophoblasts “fetal cells” (or at least it would be nice to read a comment on the fact that the circulating cells identified as trophoblasts, more likely originate in the placenta than the fetus). Line 49: Same comment on “fetal DNA”. Line 67: “blood cells” should be replaced by a term that indicates that (some of) these cells are not normally present in the blood, e.g. “cells in the blood” Lines 169 and 170: Some words are missing, likely ”the cells” Line 176: “supernatans” likely is misspelled The figures and tables are fuzzy ********** 6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #2: Yes: Lone Sunde [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step. 11 Apr 2022 Dear reviewers, Thank you very much for revising our paper. We appreciate your comments and have considered them for improving our manuscript and resubmitting the paper. All your comments are addressed in a point-by-point response which you can find in the file “Response to reviewers.docx,” which we uploaded together with our revised manuscript. In addition, for your convenience, a “Revised manuscript with Track Changes.docx” has been uploaded alongside a clean version of the revised manuscript. Kind regards, Filip Van Nieuwerburgh Submitted filename: Response to reviewers.docx Click here for additional data file. 27 Jun 2022 Enrichment of circulating trophoblasts from maternal blood using filtration-based Metacell® technology. PONE-D-21-37386R1 Dear Dr. Van Nieuwerburgh, We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements. Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication. An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org. If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org. Kind regards, Kelvin Yuen-Kwong CHAN, Ph.D. Academic Editor PLOS ONE Additional Editor Comments (optional): Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation. Reviewer #1: All comments have been addressed ********** 2. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Partly ********** 3. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: (No Response) ********** 4. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes ********** 5. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes ********** 6. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: (No Response) ********** 7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No ********** 7 Jul 2022 PONE-D-21-37386R1 Enrichment of circulating trophoblasts from maternal blood using filtration-based Metacell® technology. Dear Dr. Van Nieuwerburgh: I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org. If we can help with anything else, please email us at plosone@plos.org. Thank you for submitting your work to PLOS ONE and supporting open access. Kind regards, PLOS ONE Editorial Office Staff on behalf of Dr. Kelvin Yuen-Kwong CHAN Academic Editor PLOS ONE
  36 in total

1.  The best approach for early prediction of fetal gender by using free fetal DNA from maternal plasma.

Authors:  Elena Picchiassi; Giuliana Coata; Alessia Fanetti; Michela Centra; Luana Pennacchi; Gian Carlo Di Renzo
Journal:  Prenat Diagn       Date:  2008-06       Impact factor: 3.050

2.  A new device for rapid isolation by size and characterization of rare circulating tumor cells.

Authors:  Isabelle Desitter; Bella S Guerrouahen; Naoual Benali-Furet; Janine Wechsler; Pasi A Jänne; Yanan Kuang; Masahiko Yanagita; Lilin Wang; Jillian A Berkowitz; Robert J Distel; Yvon E Cayre
Journal:  Anticancer Res       Date:  2011-02       Impact factor: 2.480

Review 3.  Overview of the impact of noninvasive prenatal testing on diagnostic procedures.

Authors:  Steven L Warsof; Sebastian Larion; Alfred Z Abuhamad
Journal:  Prenat Diagn       Date:  2015-05-21       Impact factor: 3.050

Review 4.  Discordant non-invasive prenatal testing (NIPT) - a systematic review.

Authors:  Tanja Schlaikjaer Hartwig; Louise Ambye; Steen Sørensen; Finn Stener Jørgensen
Journal:  Prenat Diagn       Date:  2017-06-01       Impact factor: 3.050

5.  Genome-wide copy number analysis on DNA from fetal cells isolated from the blood of pregnant women.

Authors:  Steen Kølvraa; Ripudaman Singh; Elizabeth A Normand; Sadeem Qdaisat; Ignatia B van den Veyver; Laird Jackson; Lotte Hatt; Palle Schelde; Niels Uldbjerg; Else Marie Vestergaard; Li Zhao; Rui Chen; Chad A Shaw; Amy M Breman; Arthur L Beaudet
Journal:  Prenat Diagn       Date:  2016-11-18       Impact factor: 3.050

Review 6.  Frequency of submicroscopic chromosomal aberrations in pregnancies without increased risk for structural chromosomal aberrations: systematic review and meta-analysis.

Authors:  M I Srebniak; M Joosten; M F C M Knapen; L R Arends; M Polak; S van Veen; A T J I Go; D Van Opstal
Journal:  Ultrasound Obstet Gynecol       Date:  2018-04       Impact factor: 7.299

7.  Circulating Endometrial Cells in Women With Spontaneous Pneumothorax.

Authors:  Imrich Kiss; Eliska Pospisilova; Katarina Kolostova; Vilem Maly; Ivan Stanek; Robert Lischke; Jan Schutzner; Ireneusz Pawlak; Vladimir Bobek
Journal:  Chest       Date:  2019-09-19       Impact factor: 9.410

8.  Lower detectability of non-invasive prenatal testing compared to prenatal diagnosis in high-risk pregnant women.

Authors:  Jing Wang; Zhi-Wei Wang; Qin Zhou; Bin Zhang; Ting Yin; Bin Yu; Lei-Lei Wang
Journal:  Ann Transl Med       Date:  2019-07

9.  A novel method for noninvasive diagnosis of monogenic diseases from circulating fetal cells.

Authors:  Liang Chang; Xiaohui Zhu; Rong Li; Han Wu; Weijian Chen; Jiucheng Chen; Hu Liu; Shunjie Li; Ping Liu
Journal:  Prenat Diagn       Date:  2020-11-04       Impact factor: 3.050

10.  The term basal plate of the human placenta as a source of functional extravillous trophoblast cells.

Authors:  Alexandre U Borbely; Silvana Sandri; Isabella R Fernandes; Karen M Prado; Elaine C Cardoso; Simone Correa-Silva; Renata Albuquerque; Martin Knöfler; Patricia Beltrão-Braga; Ana Campa; Estela Bevilacqua
Journal:  Reprod Biol Endocrinol       Date:  2014-01-28       Impact factor: 5.211

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.