Literature DB >> 35723663

NAD kinase promotes Staphylococcus aureus pathogenesis by supporting production of virulence factors and protective enzymes.

Clarisse Leseigneur1, Laurent Boucontet2, Magalie Duchateau3, Javier Pizarro-Cerda1, Mariette Matondo3, Emma Colucci-Guyon2, Olivier Dussurget1.   

Abstract

Nicotinamide adenine dinucleotide phosphate (NADPH) is the primary electron donor for reductive reactions that are essential for the biosynthesis of major cell components in all organisms. Nicotinamide adenine dinucleotide kinase (NADK) is the only enzyme that catalyzes the synthesis of NADP(H) from NAD(H). While the enzymatic properties and physiological functions of NADK have been thoroughly studied, the role of NADK in bacterial pathogenesis remains unknown. Here, we used CRISPR interference to knock down NADK gene expression to address the role of this enzyme in Staphylococcus aureus pathogenic potential. We find that NADK inhibition drastically decreases mortality of zebrafish infected with S. aureus. Furthermore, we show that NADK promotes S. aureus survival in infected macrophages by protecting bacteria from antimicrobial defense mechanisms. Proteome-wide data analysis revealed that production of major virulence-associated factors is sustained by NADK. We demonstrate that NADK is required for expression of the quorum-sensing response regulator AgrA, which controls critical S. aureus virulence determinants. These findings support a key role for NADK in bacteria survival within innate immune cells and the host during infection.
© 2022, Leseigneur et al.

Entities:  

Keywords:  AgrA; NADK; infection; infectious disease; macrophage; microbiology; staphylococcus; virulence; zebrafish

Mesh:

Substances:

Year:  2022        PMID: 35723663      PMCID: PMC9208755          DOI: 10.7554/eLife.79941

Source DB:  PubMed          Journal:  Elife        ISSN: 2050-084X            Impact factor:   8.713


Introduction

Nicotinamide adenine dinucleotide (NAD+), its phosphorylated form (NADP+) and their reduced equivalents (NADH and NADPH) are essential cofactors shared by all living organisms, including bacteria. While NAD+ and NADH are important for cellular energy metabolism, inflammation, and senescence (Chini et al., 2021; Covarrubias et al., 2020), NADP+ and NADPH are key cofactors in central metabolism, being involved in tricarboxylic acid (TCA) cycle, pentose phosphate pathway as well as de novo synthesis of fatty acids, cholesterol, amino acids and nucleotides (Chandel, 2021). NADPH also provides the reducing power necessary for the restoration of antioxidative defense systems of the cell (Chandel, 2021). Like NAD(H), growing evidence suggests that NADP(H) has a broader role. In particular, the NADP+ derivative nicotinic acid adenine dinucleotide phosphate (NAADP), which is the major intracellular calcium mobilizing molecule, links NADP(H) metabolism with calcium homeostasis and signaling, development, and differentiation (Galione and Chuang, 2020). Whereas there are two known multi-step pathways for NAD+ biosynthesis, a single enzyme is responsible for the phosphorylation of NAD+/NADH into NADP+/NADPH: the NAD kinase (NADK) (McGuinness and Butler, 1985; Chini et al., 2021). NADK activity was first reported in the late 30’s (Vestin, 1937; Von Euler and Adler, 1938), and the enzyme was purified from yeast by Kornberg, 1950. It is only in 2000 that the genes encoding NADK were identified in Micrococcus flavus and Mycobacterium tuberculosis (Kawai et al., 2000). Since then, NADK genes have been identified in all living organisms, except the intracellular parasitic bacteria, Chlamydia spp. on the basis of genome annotation (Grose et al., 2006; Fisher et al., 2013). Given the vital role of NADPH, notably during oxidative stress, NADK genes have been shown to be essential for growth of several bacteria, such as Mycobacterium tuberculosis (Sassetti et al., 2003), Bacillus subtilis (Kobayashi et al., 2003), Salmonella enterica (Grose et al., 2006), and Staphylococcus aureus (Chaudhuri et al., 2009; Gelin et al., 2020). NADKs essentiality may account for the poor characterization of their role in prokaryotes. In contrast, NADKs have been extensively studied in plants (Li et al., 2018), especially in Arabidopsis thaliana which possesses three NADK encoding genes (Chai et al., 2006; Turner et al., 2004). NADK has a key role in photosynthesis, plant cell metabolism, intracellular redox balance (Li et al., 2018), and response to stresses as shown during exposure to aluminum in wheat (Ślaski, 1995), upon cold shock in green bean leaves (Ruiz et al., 2002), upon treatment with NaCl, ionizing radiations or oxidative stress in Arabidopsis thaliana (Chai et al., 2006; Berrin et al., 2005). In plants, NADKs are regulated by calcium and calmodulin (Tai et al., 2019). In contrast, in prokaryotes allosteric regulation of NADK activity by NADPH or NADH is the main mechanism identified so far (Grose et al., 2006). The importance of microbial metabolic adaptation during infection (Eisenreich et al., 2010; Richardson, 2019; Teoh et al., 2021) and the unknown contribution of NADK to bacterial pathogenesis prompted us to investigate the role of NADK in Staphylococcus aureus pathogeny. While being carried as a commensal by around one-third of the human population, S. aureus is a leading cause of infectious diseases, ranging from mild skin and soft tissue infections to life-threatening endocarditis and bacteremia (Turner et al., 2019). Worryingly, S. aureus can develop resistance to virtually all antibiotic classes available (Vestergaard et al., 2019), limiting dramatically therapeutic options for some patients. Therefore, WHO included S. aureus in the list of high-priority pathogens to promote research and development of new antibiotics and emphasized the need for innovation and diversification in the choice of targets (https://www.who.int/news/item/27-02-2017-who-publishes-list-of-bacteria-for-which-new-antibiotics-are-urgently-needed). In this study, we used a genetic approach to modulate NADK activity and analyze S. aureus behavior in the infected host, in infected cells and in response to stresses mimicking those encountered during infection. We establish the first link between NADK activity and S. aureus pathogenic potential, as NADK inhibition led to an increased survival of the host in a zebrafish infection model. We further demonstrate that inhibition of NADK leads to a dramatic decrease of S. aureus survival in macrophages, highlighting the enzyme importance during interactions with immune cells. We further show that exposures to oxidative and envelope-targeting antimicrobial compounds significantly decrease bacterial survival upon inhibition of NADK activity. Proteomic analysis indicated that the production of protective enzymes, virulence factors and the quorum-sensing response regulator AgrA relies on NADK. Thus, our results reveal a key role for NADK in bacterial pathogenesis.

Results

NADK contributes to S. aureus virulence in zebrafish

As most prokaryotes, S. aureus possesses a single NADK encoded by the highly conserved ppnK gene. To investigate the role of NADK in S. aureus pathogenesis, we followed a genetic approach to modulate the expression of ppnK. We used the S. aureus NADK sgRNA strain (Gelin et al., 2020), in which the levels of ppnK expression were decreased by CRISPR interference based on plasmid pSD1 (Zhao et al., 2017), without affecting the transcript levels of the downstream gene rluA (Figure 1—figure supplement 1). Knockdown of NADK expression in this strain was analyzed by RT-PCR, immunoblotting, and aerobic growth in BHI at 37°C (Figure 1—figure supplement 1). Growth of the S. aureus/sgRNA strain was affected as previously reported (Gelin et al., 2020), attesting the efficiency of the knockdown. We investigated whether NADK inhibition might influence S. aureus pathogenesis in a zebrafish infection model. This model allows short kinetics of infection (Prajsnar et al., 2008) and has been previously used to study S. aureus infection dynamics (Prajsnar et al., 2012). In addition to being optically transparent, zebrafish larvae innate immune system is the only one operating during the first days of development, facilitating the study of interactions between bacteria and neutrophils or macrophages. We first determined the stability of the pSD1 plasmid during infection. Zebrafish larvae were infected at 60 hr post fertilization (hpf) by intravenous injections of either S. aureus containing the empty vector pSD1 or the knockdown NADK sgRNA strain. Bacteria recovered from infected larvae were plated onto BHI agar with and without chloramphenicol. There was no significant difference between the number of bacteria growing on BHI alone and BHI supplemented with chloramphenicol up to 48 hr post-infection (hpi), irrespective of the strain (Figure 1—figure supplement 2A). Thus, plasmids were maintained in our experimental infection conditions. We next monitored zebrafish survival upon infection with 104 bacteria. S. aureus/pSD1 infection led to ≈ 75% fish mortality at 24 hpi (Figure 1A). Strikingly, only one larva out of 48 died when bacterial NADK was inhibited (Figure 1A). Decreased fish mortality upon S. aureus/NADK sgRNA infection was also observed 48 and 72 hpi (Figure 1A). These results indicate that NADK inhibition leads to a decreased bacterial virulence. We then determined the bacterial burden of fish larvae 24 and 48 hpi. Interestingly, numbers of S. aureus/pSD1 and S. aureus/NADK sgRNA bacteria at both time points varied depending on the viability of the fish (Figure 1B). As observed previously by Prajsnar et al., 2012, some fishes were able to control the infection with 104 bacteria but a high bacterial burden was associated with larval death in most cases (Figure 1B). Early mortality was observed in zebrafish in which S. aureus/pSD1 developed to high numbers compared to larvae infected with the NADK knockdown strain. Together, these results suggest that NADK contributes to S. aureus pathogenic potential, which depends on both bacterial and host factors. To investigate the impact of NADK inhibition on phagocyte populations, we infected intravenously transgenic zebrafish lines with S. aureus/pSD1 or S. aureus/NADK sgRNA strains, and observed bacteria, macrophages, and neutrophils at time 0, 6, 12, and 24 hpi. S. aureus/pSD1 bacterial burden was higher than that of S. aureus/NADK sgRNA strain in head and caudal regions observed in fish of comparable viability 12 hpi (Figure 1C) and 24 hpi (Figure 1—figure supplement 2B). We also noticed a strong depletion of neutrophils in larvae infected with S. aureus/pSD1, while this neutropenia was more limited upon infection with NADK knockdown bacteria (Figure 1C, D and E). This correlated with virulence differences of the two strains, given the key role of neutrophils in S. aureus infection (Pollitt et al., 2018; Prajsnar et al., 2012). In contrast, the number of macrophages in larvae did not significantly decrease upon infection with either strain (Figure 1—figure supplement 2C). Altogether, our results suggest that NADK is important for S. aureus pathogenesis.
Figure 1—figure supplement 1.

Nicotinamide adenine dinucleotide kinase (NADK) is important for S. aureus growth.

(A) Total RNAs of S. aureus containing the empty vector (pSD1) or the NADK knockdown strain (NADK sgRNA) were analyzed by RT-PCR using oligonucleotides specific to the target gene ppnK or the control gene gyrA. (B) Bacterial protein extracts of S. aureus containing the empty vector (pSD1) or the NADK knockdown strain (NADK sgRNA) were analyzed by immunoblotting using antibodies against the target protein NADK or against the control protein EF-Tu. (C) Bacterial growth of S. aureus containing the empty vector (pSD1) or the NADK knockdown strain (NADK sgRNA) monitored for 6 hr at OD600nm in BHI broth at 37°C upon ATc induction. Data shown are representative of three independent experiments. The bar indicates the standard error of the means of biological replicates. Comparison of data was performed using a t-test (*p<0.05). (D) S. aureus ppnK gene is part of the relQ operon. Genomic region surrounding the ppnK gene of S. aureus Xen36 between nucleotides 947,626 and 955,045. Bars and numbers represent the regions amplified by RT-PCR shown in B. (E) Ethidium bromide staining of DNA in an agarose gel following RT-PCR amplification using total RNA from S. aureus Xen36 and primers located in regions indicated in D. (F) Ethidium bromide staining of DNA in an agarose gel following RT-PCR amplification using total RNA from S. aureus Xen36/pSD1 or Xen36/NADK sgRNA strains and oligonucleotides specific to the gene rluA or the control gene gyrA, respectively.

Figure 1—figure supplement 2.

Nicotinamide adenine dinucleotide kinase (NADK) contributes to S. aureus virulence in zebrafish.

(A) The number of pSD1 (gray) or NADK sgRNA (blue) S. aureus was monitored in zebrafish larvae after intravenous injection with 5.103 bacteria. For each strain, CFU was determined 0, 6, 24, and 48 hpi by plating fish lysates on BHI agar (open circles) and BHI agar supplemented with chloramphenicol (triangles). (B) Representative fluorescence confocal images of transgenic mpx:GFP zebrafish larvae fixed and labeled with specific antibodies to detect GFP or S. aureus, uninfected (CTRL), or intravenously injected with 104 S. aureus containing the empty vector (pSD1) or the NADK knockdown strain (NADK sgRNA) at 0 or 24 hpi. Maximum intensity Z-projection images (2 μm serial optical sections) of bacteria (red) and neutrophils (green) in the caudal and head regions. Scale bars, 25 μm. (C) Representative fluorescence confocal images of transgenic mfap4::mCherryF zebrafish larvae fixed and labeled with specific antibodies to detect mCherry or S. aureus, uninfected (CTRL), or intravenously injected with 104 S. aureus containing the empty vector (pSD1) or the NADK knockdown strain (NADK sgRNA) at 24 hpi, showing macrophages (red). White arrows indicate the injection site. Scale bars, 500 μm.

Figure 1.

Nicotinamide adenine dinucleotide kinase (NADK) promotes S. aureus virulence in zebrafish.

(A) Survival of zebrafish larvae uninfected (CTRL) or intravenously injected at 60 hpf with 104 S. aureus containing the empty vector (pSD1) or the NADK knockdown strain (NADK sgRNA) between 0 and 72 hpi (n=48). (B) Bacterial burden in zebrafish larvae upon intravenous injection with 104 S. aureus containing the empty vector (pSD1) or the NADK knockdown strain (NADK sgRNA). For each strain, CFU was determined in living larvae (open circles) or dead larvae (filled circles) 0, 24, and 48 hpi. (C) Representative fluorescence confocal images of transgenic mpx:GFP zebrafish larvae uninfected (CTRL), or intravenously injected with 104 S. aureus containing the empty vector (pSD1) or the NADK knockdown strain (NADK sgRNA) at 12 hpi. Maximum intensity Z-projection images (2 μm serial optical sections) of bacteria (red) and neutrophils (green). Scale bars, 25 μm. Insets are shown at higher magnification on the right panels for head and caudal regions. Scale bars, 10 μm. Neutrophils containing NADK knockdown bacteria can be seen in the caudal inset. (D) Representative fluorescence confocal images of transgenic mpx:GFP zebrafish larvae uninfected (CTRL), or intravenously injected with 104 S. aureus containing the empty vector (pSD1) or the NADK knockdown strain (NADK sgRNA) at 24 hpi, showing neutrophils (green). White arrows indicate the injection site. Scale bars, 500 μm (E) Number of neutrophils in uninfected zebrafish larvae (CTRL) or in zebrafish larvae intravenously injected with 104 S. aureus containing the empty vector (pSD1) or the NADK knockdown strain (NADK sgRNA) at 24 hpi. Comparison of data was performed using one-way analysis of variance (***p<0.001, ****p<0.0001).

(A) Total RNAs of S. aureus containing the empty vector (pSD1) or the NADK knockdown strain (NADK sgRNA) were analyzed by RT-PCR using oligonucleotides specific to the target gene ppnK or the control gene gyrA. (B) Bacterial protein extracts of S. aureus containing the empty vector (pSD1) or the NADK knockdown strain (NADK sgRNA) were analyzed by immunoblotting using antibodies against the target protein NADK or against the control protein EF-Tu. (C) Bacterial growth of S. aureus containing the empty vector (pSD1) or the NADK knockdown strain (NADK sgRNA) monitored for 6 hr at OD600nm in BHI broth at 37°C upon ATc induction. Data shown are representative of three independent experiments. The bar indicates the standard error of the means of biological replicates. Comparison of data was performed using a t-test (*p<0.05). (D) S. aureus ppnK gene is part of the relQ operon. Genomic region surrounding the ppnK gene of S. aureus Xen36 between nucleotides 947,626 and 955,045. Bars and numbers represent the regions amplified by RT-PCR shown in B. (E) Ethidium bromide staining of DNA in an agarose gel following RT-PCR amplification using total RNA from S. aureus Xen36 and primers located in regions indicated in D. (F) Ethidium bromide staining of DNA in an agarose gel following RT-PCR amplification using total RNA from S. aureus Xen36/pSD1 or Xen36/NADK sgRNA strains and oligonucleotides specific to the gene rluA or the control gene gyrA, respectively.

(A) The number of pSD1 (gray) or NADK sgRNA (blue) S. aureus was monitored in zebrafish larvae after intravenous injection with 5.103 bacteria. For each strain, CFU was determined 0, 6, 24, and 48 hpi by plating fish lysates on BHI agar (open circles) and BHI agar supplemented with chloramphenicol (triangles). (B) Representative fluorescence confocal images of transgenic mpx:GFP zebrafish larvae fixed and labeled with specific antibodies to detect GFP or S. aureus, uninfected (CTRL), or intravenously injected with 104 S. aureus containing the empty vector (pSD1) or the NADK knockdown strain (NADK sgRNA) at 0 or 24 hpi. Maximum intensity Z-projection images (2 μm serial optical sections) of bacteria (red) and neutrophils (green) in the caudal and head regions. Scale bars, 25 μm. (C) Representative fluorescence confocal images of transgenic mfap4::mCherryF zebrafish larvae fixed and labeled with specific antibodies to detect mCherry or S. aureus, uninfected (CTRL), or intravenously injected with 104 S. aureus containing the empty vector (pSD1) or the NADK knockdown strain (NADK sgRNA) at 24 hpi, showing macrophages (red). White arrows indicate the injection site. Scale bars, 500 μm.

Nicotinamide adenine dinucleotide kinase (NADK) promotes S. aureus virulence in zebrafish.

(A) Survival of zebrafish larvae uninfected (CTRL) or intravenously injected at 60 hpf with 104 S. aureus containing the empty vector (pSD1) or the NADK knockdown strain (NADK sgRNA) between 0 and 72 hpi (n=48). (B) Bacterial burden in zebrafish larvae upon intravenous injection with 104 S. aureus containing the empty vector (pSD1) or the NADK knockdown strain (NADK sgRNA). For each strain, CFU was determined in living larvae (open circles) or dead larvae (filled circles) 0, 24, and 48 hpi. (C) Representative fluorescence confocal images of transgenic mpx:GFP zebrafish larvae uninfected (CTRL), or intravenously injected with 104 S. aureus containing the empty vector (pSD1) or the NADK knockdown strain (NADK sgRNA) at 12 hpi. Maximum intensity Z-projection images (2 μm serial optical sections) of bacteria (red) and neutrophils (green). Scale bars, 25 μm. Insets are shown at higher magnification on the right panels for head and caudal regions. Scale bars, 10 μm. Neutrophils containing NADK knockdown bacteria can be seen in the caudal inset. (D) Representative fluorescence confocal images of transgenic mpx:GFP zebrafish larvae uninfected (CTRL), or intravenously injected with 104 S. aureus containing the empty vector (pSD1) or the NADK knockdown strain (NADK sgRNA) at 24 hpi, showing neutrophils (green). White arrows indicate the injection site. Scale bars, 500 μm (E) Number of neutrophils in uninfected zebrafish larvae (CTRL) or in zebrafish larvae intravenously injected with 104 S. aureus containing the empty vector (pSD1) or the NADK knockdown strain (NADK sgRNA) at 24 hpi. Comparison of data was performed using one-way analysis of variance (***p<0.001, ****p<0.0001).

Nicotinamide adenine dinucleotide kinase (NADK) is important for S. aureus growth.

(A) Total RNAs of S. aureus containing the empty vector (pSD1) or the NADK knockdown strain (NADK sgRNA) were analyzed by RT-PCR using oligonucleotides specific to the target gene ppnK or the control gene gyrA. (B) Bacterial protein extracts of S. aureus containing the empty vector (pSD1) or the NADK knockdown strain (NADK sgRNA) were analyzed by immunoblotting using antibodies against the target protein NADK or against the control protein EF-Tu. (C) Bacterial growth of S. aureus containing the empty vector (pSD1) or the NADK knockdown strain (NADK sgRNA) monitored for 6 hr at OD600nm in BHI broth at 37°C upon ATc induction. Data shown are representative of three independent experiments. The bar indicates the standard error of the means of biological replicates. Comparison of data was performed using a t-test (*p<0.05). (D) S. aureus ppnK gene is part of the relQ operon. Genomic region surrounding the ppnK gene of S. aureus Xen36 between nucleotides 947,626 and 955,045. Bars and numbers represent the regions amplified by RT-PCR shown in B. (E) Ethidium bromide staining of DNA in an agarose gel following RT-PCR amplification using total RNA from S. aureus Xen36 and primers located in regions indicated in D. (F) Ethidium bromide staining of DNA in an agarose gel following RT-PCR amplification using total RNA from S. aureus Xen36/pSD1 or Xen36/NADK sgRNA strains and oligonucleotides specific to the gene rluA or the control gene gyrA, respectively.

Nicotinamide adenine dinucleotide kinase (NADK) contributes to S. aureus virulence in zebrafish.

(A) The number of pSD1 (gray) or NADK sgRNA (blue) S. aureus was monitored in zebrafish larvae after intravenous injection with 5.103 bacteria. For each strain, CFU was determined 0, 6, 24, and 48 hpi by plating fish lysates on BHI agar (open circles) and BHI agar supplemented with chloramphenicol (triangles). (B) Representative fluorescence confocal images of transgenic mpx:GFP zebrafish larvae fixed and labeled with specific antibodies to detect GFP or S. aureus, uninfected (CTRL), or intravenously injected with 104 S. aureus containing the empty vector (pSD1) or the NADK knockdown strain (NADK sgRNA) at 0 or 24 hpi. Maximum intensity Z-projection images (2 μm serial optical sections) of bacteria (red) and neutrophils (green) in the caudal and head regions. Scale bars, 25 μm. (C) Representative fluorescence confocal images of transgenic mfap4::mCherryF zebrafish larvae fixed and labeled with specific antibodies to detect mCherry or S. aureus, uninfected (CTRL), or intravenously injected with 104 S. aureus containing the empty vector (pSD1) or the NADK knockdown strain (NADK sgRNA) at 24 hpi, showing macrophages (red). White arrows indicate the injection site. Scale bars, 500 μm.

NADK promotes S. aureus survival in macrophages

Since both neutrophils and macrophages are key immune cells specialized in the destruction of microorganisms, we next investigated if, in addition to triggering neutrophil killing, NADK might support S. aureus survival during macrophages infection. Murine RAW264.7 macrophages were infected with S. aureus/pSD1 or S. aureus/NADK sgRNA strains. Bacterial enumerations were performed at time zero and at 1, 2, 4, and 6 hpi. No significant difference in initial phagocytosis of the two strains could be observed, nor at early time of infection (Figure 2A). In contrast, after 2 hr of infection the percentage of intracellular bacteria was significantly reduced upon ppnK knockdown, and the survival defect increased over time (Figure 2A), indicating that bacteria were not able to survive inside macrophages without proper NADK activity. As oxidative burst is a major antimicrobial mechanism of phagocytes (Fang, 2004), we next investigated the role of ROS produced by macrophages in the control of the S. aureus/NADK sgRNA strain using the antioxidant agent N-acetyl cysteine (NAC). NAC partially restored bacterial survival (Figure 2A), indicating that the bacterial growth defect of the ppnK knockdown strain was due to its inability to cope with oxidative stress to some extent. Using confocal fluorescence microscopy, we then investigated bacterial intracellular localization in macrophages 6hpi. Few S. aureus/NADK sgRNA bacteria were detected compared to S. aureus/pSD1 (Figure 2B), and NAC treatment led to an increased number of bacteria (Figure 2C), confirming bacterial enumeration results. Interestingly, while all knockdown bacteria colocalized with lysosomal associated membrane protein 1 (LAMP1), many S. aureus/pSD1 did not upon NAC treatment, suggesting that NADK activity might be required for phagolysosome escape and bacterial survival in macrophages. Since S. aureus has been shown to be cytotoxic to macrophages, we next wondered if the bacterial growth defect of the NADK knockdown strain was correlated with reduced lysis of infected cells. We measured the levels of cell death in macrophages that were uninfected, uninfected, and treated with Triton X-100 or infected with S. aureus/pSD1 or S. aureus/NADK sgRNA strains (Figure 2D). Detergent treatment expectedly led to massive cell lysis. Infections produced significant macrophage death compared to uninfected cells, although to much lower levels than that triggered by Triton X-100. Infection with the ppnK knockdown strain was significantly less cytotoxic than infection with the S. aureus/pSD1 strain. Altogether, these results suggest that NADK promotes survival and possibly virulence of S. aureus in macrophages.
Figure 2.

Nicotinamide adenine dinucleotide kinase (NADK) promotes S. aureus survival and cytotoxicity in macrophages.

(A) Percentage of growth of the S. aureus strains containing the empty vector (pSD1) or the ppnK knockdown strain (NADK sgRNA) at time 0, and 1, 2, 4, and 6 hpi of RAW264.7 macrophages left untreated or treated with N-acetylcysteine (NAC). Bars indicate standard errors of the means of biological replicates (n=4). Comparison of data was performed using two-ways analysis of variance (*p<0.05, **p<0.01, ****p<0.0001). (B–C) Representative images of RAW264.7 macrophages infected with S. aureus/pSD1 or S. aureus/NADK sgRNA strains and analyzed 6 hpi by confocal fluorescence microscopy using antibodies to label S. aureus (Cy5, red) and LAMP-1 (FITC, green). Nuclei were labeled with DAPI (blue). (B) shows untreated macrophages. (C) shows macrophages treated with NAC. Insets are shown at higher magnification. Images are representative of three independent experiments. (D) Cell death of RAW264.7 macrophages uninfected (NI), uninfected and treated with Triton X-100 (lysis control), or 6 hpi with S. aureus strains containing the empty vector (pSD1) or the ppnK knockdown strain (NADK sgRNA). Bars indicate standard errors of the means of biological replicates. Comparison of data was performed using two-ways analysis of variance (*p<0.05, **p<0.01, ****p<0.0001). Data are representative of at least three independent experiments.

Nicotinamide adenine dinucleotide kinase (NADK) promotes S. aureus survival and cytotoxicity in macrophages.

(A) Percentage of growth of the S. aureus strains containing the empty vector (pSD1) or the ppnK knockdown strain (NADK sgRNA) at time 0, and 1, 2, 4, and 6 hpi of RAW264.7 macrophages left untreated or treated with N-acetylcysteine (NAC). Bars indicate standard errors of the means of biological replicates (n=4). Comparison of data was performed using two-ways analysis of variance (*p<0.05, **p<0.01, ****p<0.0001). (B–C) Representative images of RAW264.7 macrophages infected with S. aureus/pSD1 or S. aureus/NADK sgRNA strains and analyzed 6 hpi by confocal fluorescence microscopy using antibodies to label S. aureus (Cy5, red) and LAMP-1 (FITC, green). Nuclei were labeled with DAPI (blue). (B) shows untreated macrophages. (C) shows macrophages treated with NAC. Insets are shown at higher magnification. Images are representative of three independent experiments. (D) Cell death of RAW264.7 macrophages uninfected (NI), uninfected and treated with Triton X-100 (lysis control), or 6 hpi with S. aureus strains containing the empty vector (pSD1) or the ppnK knockdown strain (NADK sgRNA). Bars indicate standard errors of the means of biological replicates. Comparison of data was performed using two-ways analysis of variance (*p<0.05, **p<0.01, ****p<0.0001). Data are representative of at least three independent experiments.

NADK protects S. aureus from antimicrobial defense compounds

Hydrogen peroxide is one of the reactive oxygen species generated upon activation of macrophages (Fang, 2004). We, therefore, compared growth of the S. aureus strain containing the empty vector to that of the NADK knockdown strain, upon exposure to increasing concentrations of hydrogen peroxide (H2O2). While the S. aureus/pSD1 strain resisted to high doses of H2O2, the S. aureus/NADK sgRNA strain showed increasing growth deficiency when exposed to H2O2 concentrations ranging from 50 to 500 μM H2O2 (Figure 3A). Expectedly, treatment of the S. aureus/pSD1 strain with catalase alone or catalase and H2O2 did not affect growth (Figure 3B). In contrast, addition of catalase, which catalyzes hydrogen peroxide dismutation into water and oxygen, rescued the growth defect of the S. aureus/NADK sgRNA strain upon H2O2 treatment (Figure 3B). Taken together, our results show that NADK protects S. aureus from toxic effects of a reactive oxygen species involved in host defense. Within phagocytes, bacteria have to cope with other mechanisms of antimicrobial defenses such as production of lysozyme (Callewaert and Michiels, 2010; Avican et al., 2021; Fang et al., 2016). We thus investigated the effects of NADK knockdown on S. aureus sensitivity to lysozyme. Since S. aureus is highly resistant to lysozyme, we treated bacteria with lysozyme and the bacteriocin lysostaphin, a combination that potentiates their antibacterial activity against S. aureus (Cisani et al., 1982). At subinhibitory concentrations for the S. aureus/pSD1 strain, the S. aureus/NADK sgRNA strain showed decreased viability when exposed to lysozyme and lysostaphin (Figure 3C). Thus, NADK protects S. aureus from toxic effects of cell envelope-targeting compounds.
Figure 3.

Nicotinamide adenine dinucleotide kinase (NADK) protects S. aureus from antimicrobial defense compounds.

Bacterial growth was monitored at OD600nm in BHI broth at 37°C. (A) Percentage of growth of the S. aureus strain containing the empty vector (pSD1) and the ppnK knockdown strain (NADK sgRNA) exposed for 6 hr to increasing concentrations of H2O2 relative to the untreated condition. (B) Percentage of growth of the S. aureus strain containing the empty vector (pSD1) and the ppnK knockdown strain (NADK sgRNA) exposed for 6 hr to H2O2 and catalase alone or in combination, relative to the untreated condition. Data shown are representative of three independent experiments. Bars indicate the standard error of the means of biological replicates. Comparison of data was performed using one-way analysis of variance (ns: nonsignificant, *p<0.05, ***p<0.001, ****p<0.0001). (C) Bacterial cell death of the S. aureus strain containing the empty vector (pSD1) and the ppnK knockdown strain (NADK sgRNA) untreated or exposed for 30 min to 0.05 mg/mL lysostaphin and 5 mg/mL lysozyme. Bacterial permeability was assessed using the CellTox Green cytotoxicity assay. Bars indicate standard errors of the means of biological replicates. Comparison of data was performed using two-ways analysis of variance (*p<0.05, **p<0.01, ***p<0.001, ****p<0.0001). Data are representative of at least three independent experiments.

Nicotinamide adenine dinucleotide kinase (NADK) protects S. aureus from antimicrobial defense compounds.

Bacterial growth was monitored at OD600nm in BHI broth at 37°C. (A) Percentage of growth of the S. aureus strain containing the empty vector (pSD1) and the ppnK knockdown strain (NADK sgRNA) exposed for 6 hr to increasing concentrations of H2O2 relative to the untreated condition. (B) Percentage of growth of the S. aureus strain containing the empty vector (pSD1) and the ppnK knockdown strain (NADK sgRNA) exposed for 6 hr to H2O2 and catalase alone or in combination, relative to the untreated condition. Data shown are representative of three independent experiments. Bars indicate the standard error of the means of biological replicates. Comparison of data was performed using one-way analysis of variance (ns: nonsignificant, *p<0.05, ***p<0.001, ****p<0.0001). (C) Bacterial cell death of the S. aureus strain containing the empty vector (pSD1) and the ppnK knockdown strain (NADK sgRNA) untreated or exposed for 30 min to 0.05 mg/mL lysostaphin and 5 mg/mL lysozyme. Bacterial permeability was assessed using the CellTox Green cytotoxicity assay. Bars indicate standard errors of the means of biological replicates. Comparison of data was performed using two-ways analysis of variance (*p<0.05, **p<0.01, ***p<0.001, ****p<0.0001). Data are representative of at least three independent experiments.

NADK supports S. aureus protective enzymes

To elucidate mechanisms of action of NADK, unbiased mass spectrometry-based proteomics was used to identify proteins differentially expressed upon NADK knockdown. Relative protein abundance was compared in the S. aureus strain containing the empty vector and the NADK knockdown strain grown in BHI. Interestingly, lower levels of major antioxidant enzymes were detected in the NADK sgRNA strain (Table 1 and Supplementary file 1). NADK deficiency was linked to decreased relative abundance of superoxide dismutase SodM, catalase KatA, thioredoxin Trx2 and methionine sulfoxide reductase MsrA2. Additionally, the NADK sgRNA strain had lower levels of the peptidoglycan O-acetyltransferase OatA and the glycopeptide resistance-associated two-component system GraRS, major determinants for S. aureus resistance to lysozyme and cationic antimicrobial peptides (CAMP), respectively (Bera et al., 2005; Herbert et al., 2007). We then compared the proteomes of the S. aureus strain containing the empty vector and the NADK knockdown strain upon hydrogen peroxide treatment. OatA, SodM, Trx2, MrsA2, KatA, and other antioxidant enzymes were more abundant in the S. aureus/pSD1 strain than in the NADK deficient strain (Supplementary files 2 and 3), as it had been observed when strains were grown in BHI. To determine the effect of NADK knockdown on S. aureus proteome in vivo, relative protein abundance was analyzed in zebrafish infected with the S. aureus strain containing the empty vector or the NADK knockdown strain. The D-alanyl carrier protein DltC, which mediates CAMP resistance, and antioxidant enzymes, such as SodA, KatA, thiol peroxidase Tpx, and alkyl hydroperoxide reductase subunit AhpF, were detected in zebrafish infected with S. aureus/pSD1 (Supplementary files 4 and 5). In contrast, these proteins were undetectable in S. aureus/NADK sgRNA-infected zebrafish. Thus, our approach identified a role for NADK in supporting S. aureus protective proteins in vitro and in vivo.
Table 1.

Relative abundance of a subset of protective proteins differentially expressed by S. aureus pSD1 and NADK sgRNA strains.

UniprotProteinDescriptionLog2R*P
Q2FV54Q2G000Q2G261Q2FZZ3Q2G0D9Q2G280P0A086Q2FVL7Q2G0E0Q2FYU7OatATrx2SodM-GraS-MsrA2-GraRKatAO-acetyl transferaseThioredoxin 2Superoxide dismutase [Mn/Fe]Thioredoxin domain-containing proteinSensor histidine kinasePeroxiredoxinMethionine sulfoxide reductaseThioredoxin domain-containing proteinResponse regulator proteinCatalase3.071.791.681.591.311.261.101.021.000.591.78E-052.75E-052.11E-067.22E-044.00E-046.69E-072.25E-051.94E-032.23E-031.00E-05

Log2R=Log2[pSD1]/[NADK sgRNA].

Adjusted p-value.

Log2R=Log2[pSD1]/[NADK sgRNA]. Adjusted p-value.

NADK promotes virulence factor expression by S. aureus

To investigate additional mechanisms of action of NADK, our quantitative proteomic data were analyzed further using proteomaps (Liebermeister et al., 2014). S. aureus proteins were classified into functional groups based on KEGG annotation. Expression profiles of strains grown in BHI were visualized by Voronoi tree maps, clustering proteins in three hierarchical categories. Top-level functional categories relying on NADK activity included biosynthesis, central carbon metabolism, other enzymes, folding, sorting and degradation, translation, transcription, and DNA maintenance (Figure 4A). Remarkably, infectious diseases, signaling molecules and interaction, and signal transduction identified at the highest level (Figure 4A), and S. aureus infection, bacterial toxins, and two-component system identified at the second level (Figure 4B), encompassed multiple major virulence factors such as alpha-hemolysin, gamma-hemolysin, Map, IsdA, and virulence regulators AgrA and SaeS (Figure 4C). NADK deficiency was also linked to decreased relative abundance of other virulence-related proteins, for example, phenol-soluble modulin (PSM) alpha PsmA, the lipase Lip1, leukocidin-like proteins 1 and 2, and staphopain A (Table 2). Of note, similar proteomic profiles were obtained when strains were exposed to hydrogen peroxide, confirming the importance of NADK for proper expression of virulence proteins in conditions mimicking host defenses (Figure 4—figure supplement 1, Supplementary file 6). Furthermore, comparative analysis of whole protein extracts from bacterial pellets and culture supernatants by immunoblotting showed a massive decrease in the levels of alpha-hemolysin secretion by the NADK deficient strain (Figure 4D and E). To determine if the differential protein abundance of toxins was translated into different levels of enzymatic activity, a Christie-Atkins-Munch-Peterson test was performed using S. aureus RN4220, S. aureus/pSD1, and S. aureus/NADK sgRNA strains (Adhikari et al., 2007). Strikingly, NADK deficiency led to a lack of hemolysis (Figure 4F). In contrast S. aureus/pSD1 produced a synergistic hemolysis in presence of the RN4220 strain, indicating secretion of hemolysins and phenol soluble modulins. Taken together, these data suggest that NADK is required for expression of S. aureus virulence determinants.
Figure 4.

Nicotinamide adenine dinucleotide kinase (NADK) promotes expression of S. aureus virulence determinants.

The S. aureus strain containing the empty vector (pSD1) and the ppnK knockdown strain (NADK sgRNA) were grown in BHI broth at 37°C. (A–C) Whole bacterial cell lysates were analyzed by LC-MS/MS. Voronoi treemaps were generated to visualize proteins more abundant in S. aureus/pSD1 than in the knockdown strain at three hierarchical levels according to KEGG database: top level (A), second level (B), third level (C). Colors represent functional categories. Category size based on LFQ intensity corresponds to differences in protein abundance. (D) Whole bacterial cell lysates and culture supernatants were analyzed by immunoblotting using antibodies against alpha-hemolysin and EF-Tu. (E) Quantification of the Hla immunoblots normalized to corresponding EF-Tu protein levels in the pellet. (F) A Christie-Atkins-Munch-Peterson test was performed by streaking the S. aureus strain containing the empty vector (pSD1) and the ppnK knockdown strain (NADK sgRNA) perpendicularly to the S. aureus RN4220 strain that produces only beta-hemolysin (vertical streak) on sheep blood agar. Clearing zones indicate hemolysis.

The S. aureus strain containing the empty vector (pSD1) and the ppnK knockdown strain (NADK sgRNA) were grown at 37°C in BHI broth supplemented with H2O2. (A–C) Whole bacterial cell lysates were analyzed by LC-MS/MS. Voronoi treemaps were generated to visualize proteins more abundant in S. aureus/pSD1 than in the knockdown strain at three hierarchical levels according to KEGG database: top level (A), second level (B), third level (C). Colors represent functional categories. Category size based on LFQ intensity corresponds to differences in protein abundance.

Table 2.

Relative abundance of a subset of virulence-related proteins differentially expressed by S. aureus pSD1 and NADK sgRNA strains.

UniprotProteinDescriptionLog2R*P
Q2FWM4P0C818Q2FVK2P0C7Y1Q2FUU5Q2FVK1Q2G1 × 0Q2FWN9Q2FVK3Q2FWP0Q2G2R8AgrAPsmA4HlgCPsmA1Lip1HlgBHlyLukL2HlgALukL1SspPAccessory gene regulator proteinPhenol-soluble modulin alpha 4Gamma-hemolysin component CPhenol-soluble modulin alpha 1LipaseGamma-hemolysin component BAlpha-hemolysinLeukocidin-like protein 2Gamma-hemolysin component ALeukocidin-like protein 1Staphopain A+++++7.886.993.883.843.092.89NANANANANA3.85E-103.85E-104.14E-081.47E-082.25E-064.08E-07

Log2R=Log2[pSD1]/[NADK sgRNA]; +: protein detected in pSD1 strain and not detected from NADK sgRNA strain.

Adjusted p-value: NA: not applicable.

Figure 4—figure supplement 1.

Nicotinamide adenine dinucleotide kinase (NADK) promotes expression of S. aureus virulence determinants.

The S. aureus strain containing the empty vector (pSD1) and the ppnK knockdown strain (NADK sgRNA) were grown at 37°C in BHI broth supplemented with H2O2. (A–C) Whole bacterial cell lysates were analyzed by LC-MS/MS. Voronoi treemaps were generated to visualize proteins more abundant in S. aureus/pSD1 than in the knockdown strain at three hierarchical levels according to KEGG database: top level (A), second level (B), third level (C). Colors represent functional categories. Category size based on LFQ intensity corresponds to differences in protein abundance.

Nicotinamide adenine dinucleotide kinase (NADK) promotes expression of S. aureus virulence determinants.

The S. aureus strain containing the empty vector (pSD1) and the ppnK knockdown strain (NADK sgRNA) were grown in BHI broth at 37°C. (A–C) Whole bacterial cell lysates were analyzed by LC-MS/MS. Voronoi treemaps were generated to visualize proteins more abundant in S. aureus/pSD1 than in the knockdown strain at three hierarchical levels according to KEGG database: top level (A), second level (B), third level (C). Colors represent functional categories. Category size based on LFQ intensity corresponds to differences in protein abundance. (D) Whole bacterial cell lysates and culture supernatants were analyzed by immunoblotting using antibodies against alpha-hemolysin and EF-Tu. (E) Quantification of the Hla immunoblots normalized to corresponding EF-Tu protein levels in the pellet. (F) A Christie-Atkins-Munch-Peterson test was performed by streaking the S. aureus strain containing the empty vector (pSD1) and the ppnK knockdown strain (NADK sgRNA) perpendicularly to the S. aureus RN4220 strain that produces only beta-hemolysin (vertical streak) on sheep blood agar. Clearing zones indicate hemolysis. The S. aureus strain containing the empty vector (pSD1) and the ppnK knockdown strain (NADK sgRNA) were grown at 37°C in BHI broth supplemented with H2O2. (A–C) Whole bacterial cell lysates were analyzed by LC-MS/MS. Voronoi treemaps were generated to visualize proteins more abundant in S. aureus/pSD1 than in the knockdown strain at three hierarchical levels according to KEGG database: top level (A), second level (B), third level (C). Colors represent functional categories. Category size based on LFQ intensity corresponds to differences in protein abundance. Log2R=Log2[pSD1]/[NADK sgRNA]; +: protein detected in pSD1 strain and not detected from NADK sgRNA strain. Adjusted p-value: NA: not applicable.

NADK promotes AgrA expression by S. aureus

AgrA is a central regulator of S. aureus virulon. Therefore, the impact of NADK on AgrA observed above may account for the positive regulation of virulence factor production. To attest NADK-dependent regulation of virulence determinants controlled by Agr, we analyzed transcript levels of two additional members of the Agr regulon, the positively regulated multifunctional RNA RNAIII and the negatively regulated glutathione peroxidase gene bsaA. We carried out RT-PCR on RNA purified from the S. aureus strain containing the empty vector and the NADK knockdown strain during exponential growth in BHI broth at 37°C. Decreased RNAIII transcript levels and increased bsaA transcript levels were detected in the NADK knockdown strain (Figure 5A, B and D). These results are in accordance with the positive regulatory role of NADK on AgrA, and the regulation of AgrA on RNAIII and bsaA expression. To determine whether NADK sustains AgrA protein levels by promoting gene expression, AgrA transcript levels were compared in the S. aureus/pSD1 and S. aureus/NADK sgRNA strains. The expression of agrA was strongly decreased upon NADK knockdown (Figure 5C and D). Thus, full NADK activity is required for optimal agrA expression and subsequent virulence gene expression. To decipher the mode of action of NADK on agrA expression, we next investigated the effect of the ppnK knockdown on S. aureus oxidative content, since transcription of the agr system is repressed in oxidizing conditions (Baker et al., 2010; Rothfork et al., 2004). We compared the levels of ROS in the S. aureus/pSD1 and NADK sgRNA strains grown in aerobic conditions. Decreasing NADK levels led to a significant increase in ROS content (Figure 5E), which could contribute to negative regulation of AgrA expression. Together, our data suggest that NADK activity is important for proper agrA expression, possibly by controlling the bacterial redox state, ultimately promoting S. aureus virulence potential.
Figure 5.

Nicotinamide adenine dinucleotide kinase (NADK) is required for AgrA expression and S. aureus redox control.

The S. aureus strain containing the empty vector (pSD1) and the ppnK knockdown strain (NADK sgRNA) were grown aerobically in BHI broth at 37°C for 4 hr. (A–C) RNA was extracted and subjected to RT-PCR using oligonucleotides specific to gyrA, RNAIII, bsaA, and agrA genes, respectively. (D) Relative gene expression was normalized to gyrA transcript levels. (E) S. aureus ROS levels were quantified using the DCFH2-DA assay. Comparison of data was performed using t-test (****p<0.0001). Data are representative of at least three independent experiments.

Nicotinamide adenine dinucleotide kinase (NADK) is required for AgrA expression and S. aureus redox control.

The S. aureus strain containing the empty vector (pSD1) and the ppnK knockdown strain (NADK sgRNA) were grown aerobically in BHI broth at 37°C for 4 hr. (A–C) RNA was extracted and subjected to RT-PCR using oligonucleotides specific to gyrA, RNAIII, bsaA, and agrA genes, respectively. (D) Relative gene expression was normalized to gyrA transcript levels. (E) S. aureus ROS levels were quantified using the DCFH2-DA assay. Comparison of data was performed using t-test (****p<0.0001). Data are representative of at least three independent experiments.

Discussion

The ability of S. aureus to survive and thrive in a wide variety of niches during infection, ranging from skin to deeper tissues and abiotic devices, mirrors highly plastic metabolic capacities allowing adaptive responses to constantly changing microenvironments (Potter et al., 2020). Metabolic pathways are not only necessary for nutrient acquisition to sustain bacterial growth, but also for regulation of virulence and are therefore central to host-pathogen interactions (Eisenreich et al., 2010; Harper et al., 2018; Richardson, 2019; Teoh et al., 2021; Tomlinson et al., 2021). Here, we show for the first time that NADK contributes to bacterial pathogenic potential. NADK was necessary for successful S. aureus infection of zebrafish larvae, ultimately leading to neutropenia and death. Decreasing NADK activity led to decreased host mortality without affecting bacterial burden initially, suggesting that NADK promotes virulence factor activity and/or counteracts host defenses independently of its contribution to bacterial growth capacity. Besides neutrophils, macrophages are crucial cells in the innate immune defense against infection. We uncovered that inhibition of S. aureus NADK activity has a major impact on bacteria interactions with macrophages, reducing dramatically bacterial survival after phagocytosis. We demonstrated that NADK contributes to resistance to ROS produced by macrophages, neutralizing an important defense mechanism against bacterial infection (Pidwill et al., 2020). Along the same lines, we showed that NADK protected S. aureus from hydrogen peroxide toxicity. NADK, as the only source of NADP(H), is a key component of defense against oxidative stress (Grose et al., 2006; Mailloux et al., 2011). In bacteria, it has been shown that NADK activity is increased upon exposure to oxidative stress, acting as a metabolic switch to decrease the NAD+ pool which fuels ROS formation and increase the NADPH pool which promotes ROS scavenging activities (Singh et al., 2007). Analysis of S. aureus proteome revealed a drop in the levels of major antioxidant enzymes upon inhibition of ppnK expression. By supporting superoxide dismutase, catalase, methionine sulfoxide reductase, and other antioxidant enzymes, NADK could prevent damages caused by ROS formed during phagocytosis. However, antioxidant treatment of infected macrophages using NAC only partially mitigated growth defect of the NADK knockdown strain. NADK might thus contribute to bacterial survival within macrophages through pathways other than ROS detoxification. We showed that inhibition of ppnK expression led to growth defect upon envelope stress, a condition that is encountered in the host, particularly in macrophages where bacteria face antimicrobial peptides and hydrolytic enzymes such as lysozyme (Rosenberger et al., 2004; Cohn and Wiener, 1963; Callewaert and Michiels, 2010). S. aureus resists lysozyme through peptidoglycan modification by the O-acetyltransferase OatA (Bera et al., 2005; Bera et al., 2006). Regulation by the glycopeptide resistance-associated two-component system GraRS and D-alanylation of teichoic acid by the dlt operon gene products also contribute to S. aureus resistance to lysozyme, as well as CAMP (Herbert et al., 2007). OatA, DltA, and GraRS were less abundant when NADK was knocked down, suggesting that NADK could help S. aureus resist antibacterial envelope-targeting compounds produced by macrophages and/or secreted by the host. Strikingly, our proteomic analysis also highlighted the contribution of NADK to production of virulence factors. Among them, PSM-alpha peptides have previously been shown to lyse leucocytes, elicit phagosomal escape and play a key role in pathogenesis (Wang et al., 2007; Kobayashi et al., 2011; Peschel and Otto, 2013; Grosz et al., 2014; Kitur et al., 2015). The pore-forming toxin alpha-hemolysin has also been demonstrated to lyse leukocytes and is required for full virulence in mouse, rabbit, and rat models of infection (Patel et al., 1987; O’Callaghan et al., 1997; McElroy et al., 1999; Kitur et al., 2015; Seilie and Bubeck Wardenburg, 2017). Gamma-hemolysin leucocidin is leukotoxic as well and contributes to S. aureus bacteremia (Nilsson et al., 1999; Spaan et al., 2014). Control of these factors by NADK could thus promote bacterial survival in macrophages and zebrafish, and trigger macrophage and neutrophil death upon S. aureus infection. Remarkably, we found that inhibition of ppnK expression decreases abundance of AgrA, the response regulator of S. aureus agr system at the center of quorum-sensing and virulence. AgrA directly enhances the transcription of the PSM-alpha genes and governs RNAIII-dependent expression of multiple virulence enzymes including alpha-hemolysin and leukocidins (Queck et al., 2008). Thus, the contribution of NADK to production of virulence factors is presumably mediated through AgrA. NADK regulated expression of RNAIII and BsaA similarly to AgrA, corroborating this hypothesis. Besides lowering abundance of AgrA, NADK knockdown led to decreased levels of agrA transcript. Increased ROS levels detected in the knockdown strain could account for this regulation as transcription of the agr operon is repressed in oxidative conditions (Rothfork et al., 2004; Baker et al., 2010; Sun et al., 2012). Additionally, oxidation leads to formation of an intramolecular disulfide bond between Cys-199 and Cys-228 in the DNA binding domain of AgrA, thereby introducing a conformational change disrupting its association to promoter region of target genes (Sun et al., 2012). A recent study confirmed oxidation sensing of the agr system and revealed another mode of AgrA regulation by CoAlation of redox-active Cys199 inhibiting its DNA-binding activity (Baković et al., 2021). In summary, our study shows that NADK supports production of protective enzymes, virulence determinants, and the response regulator AgrA, possibly by controlling the bacterial redox state, ultimately promoting S. aureus pathogenic potential. NADK inhibition and quorum quenching are attractive therapeutic approaches. Further investigations are now required to fully understand the contribution of bacterial NADKs during infection processes and develop chemical inhibitors that could be used in combination with current antibiotics to fight multidrug resistant bacteria.

Materials and methods

Plasmids, bacterial strains, cell lines, and culture onditions

Bacterial strains and plasmids used in this study are listed in Table 3. All plasmids were maintained in Escherichia coli TOP10. The restriction deficient Staphylococcus aureus strain RN4220 was transformed with plasmids isolated from E. coli. The S. aureus Xen36 strain was transformed with plasmids isolated from the RN4220 strain as previously described (Gelin et al., 2020). E. coli was grown in lysogeny broth (LB) medium (Difco) with shaking at 200 rpm or on LB agar plates at 37°C. S. aureus was grown in brain heart infusion (BHI) broth (BD) or in tryptic soy broth (TSB) (Difco) with shaking at 200 rpm or on BHI agar plates at 37°C. When required, culture medium was supplemented with antibiotics (carbenicillin 100 μg/mL for E. coli, chloramphenicol 15 μg/mL, or anhydrotetracycline 100 ng/mL for S. aureus). RAW 264.7 macrophages (TIB-71, ATCC) were cultured in DMEM (Gibco) containing 10% FCS (Gibco). Macrophages were seeded into 24-well plates at 105 cells per well.
Table 3.

Strains and plasmids used in this study.

Strain/plasmidRelevant characteristicsReference
Strains
E. coli strain
  TOP10F-mcrA Δ(mrr-hsdRMS-mcrBC) φ80lacZΔM15 ΔlacX74 recA1 araD139 Δ(ara-leu) 7,697 galU galK λ- rpsL(StrR) endA1 nupGInvitrogen
S. aureus strains
  Xen36Strain derived from a clinical isolate from a bacteremic patientPerkinElmer, ATCC49525
  Xen36/pSD1Xen36 strain carrying plasmid pSD1 Gelin et al., 2020
  Xen36/NADK sgRNAXen36 strain carrying plasmid pSD1 ppnK Gelin et al., 2020
  RN4220Restriction-deficient strain derived from NCTC 8325–4 Kreiswirth et al., 1983
Plasmids
 pSD1dCas9 ATc-inducible and sgRNA constitutive expression plasmid Zhao et al., 2017
 pSD1 ppnKpSD1 plasmid carrying sgRNA targeting S. aureus ppnK Gelin et al., 2020

Bacterial growth measurement

S. aureus strains were grown overnight in BHI broth at 37°C and diluted to OD600nm=0.05 into BHI broth. For NADK inhibition experiments, culture medium was supplemented with 100 ng/mL anhydrotetracycline (Sigma-Aldrich) and 15 μg/mL chloramphenicol when required. For stress experiments, culture medium was supplemented with hydrogen peroxide (0–500 μM), catalase (10 μg/mL), lysozyme (5 mg/mL), or lysostaphin (0.05 mg/mL). Bacterial suspensions were incubated in 96-well plates with shaking at 200 rpm at 37°C. Growth was monitored with a microplate reader (Glomax Discover, Promega). Experiments were performed at least three times.

Christie-Atkins-Munch-Peterson test

S. aureus hemolytic activity was performed as described previously (Adhikari et al., 2007). Briefly, S. aureus RN4220 was streaked vertically at the center of a sheep blood agar plate. S. aureus/pSD1 and S. aureus/NADK sgRNA strains were then streaked perpendicularly to the RN4220 strain. The plate was incubated at 37°C for 18 hr. Blood agar plates were then photographed with a Scan500 imager (Interscience). The assay was repeated three times.

RNA extraction and RT-PCR

Bacteria grown for 4 hr were collected by centrifugation 20 min at 15,000 × g at 4°C. Bacterial lysis was performed using Precellys lysing kit (P000914-LYSK0-A) and the Precellys program 4 (6.500 rpm for 30 s) twice at 4°C. RNA extraction was performed in 1 mL of TRIzol (Invitrogen) according to the manufacturer’s recommendations. RT-PCR was carried out with Superscript one-step RT kit (Invitrogen). Primers used are indicated in Table 4. RT-PCR assays were repeated at least three times.
Table 4.

Primers used in this study.

PrimerSequence (5’–3’)
RT-ppnK-F GTGACTCCAAGTCTAATGCC
RT-ppnK-R ATTTTTCAACTTCATGAGGTAACC
RT-gyrA-F GTGTTATCGTTGCTCGTG
RT-gyrA-R CGGTGTCATACCTTGTTC
RT-RNAIII-F AGTTTCCTTGGACTCAGTGCT
RT-RNAIII-R AGGGGCTCACGACCATACTT
RT-bsaA-F GCGAAGAAGCAGCTCAAAAC
RT-bsaA-R CCTTCGCGATCCACTAAAAA
RT-agrA-F GCCCTCGCAACTGATAATCC
RT-agrA-R CACCGATGCATAGCAGTGTTC
RT-rluA-F CCGCGAGAAATACCGAGTGT
RT-rluA-R TCTCCCACAATTGGATGCCC
RT-operon-F1 TGACTTGCTTAAAAAGCACACTG
RT-operon-R1 ACGAGCATTTGTCCTACTTCAGA
RT-operon-F2 AACCGTTGAAGAAACATTCGACA
RT-operon-R2 GACGCTTGTTCACCAACTTCA
RT-operon-F3 CATCGTTTGGAAAGAGCGGC
RT-operon-R3 GGCATTAGACTTGGAGTCACCT
RT-operon-F4 ACGTGTGCACGATTCTTTCAT
RT-operon-R4 ATGGCGCTCACTGTCTTCT
RT-operon-F5 AGTTCATTTGCATACGGGACG
RT-operon-R5 ACGCTCTTTTTCATCTGTGTTCA
RT-operon-F6 TAACTTGTGCGATGACGGTGG
RT-operon-R6 TTCCAATCACAATCCCCATCAA
RT-operon-F7 ACGTTGATGAATTGAAGCAAGAG
RT-operon-R7 ACTTTAGCGACACCAAAAGCA
RT-operon-F8 TCAAGTGGCGTTACAGGTGA
RT-operon-R8 TTCAAATACCGCCAACGCAT

Immunoblotting

Bacteria grown for 4 hr were collected by centrifugation 10 min at 10,000 × g at 4°C and resuspended in 500 μL of PBS. Bacteria were lysed using the Precellys lysing kit (P000914-LYSK0-A) and the Precellys program 4 (6500 rpm for 30 s) twice at 4°C. Lysates were centrifuged for 15 min at 10,000 × g at 4°C and supernatants were collected for protein quantification using the Quick start Bradford protein assay kit 2 (Biorad). Samples were mixed with Laemmli buffer (Biorad) and 10% β-mercaptoethanol and denatured for 5 min at 95°C. Samples were separated onto 4–20% Miniprotean TGX stain-free precast gel (Biorad) in TGS buffer and transferred on polyvinylidene fluoride membranes. Membranes were incubated overnight at 4°C with primary antibodies diluted in 5% blotto (R114 rabbit anti-EF-Tu polyclonal antibodies, 1:5000; R250 rabbit polyclonal anti-S. aureus NADK antibodies, 1:1000; anti-staphylococcal α-toxin (α-hemolysin) rabbit antiserum (Sigma-Aldrich S7531) 1:1000). Membranes were then incubated with 1:2500 antirabbit horseradish peroxidase-conjugated antibodies (Abcam). Blots were revealed using the ECL kit (Pierce).

RAW 264.7 macrophage infection

RAW 264.7 macrophages were seeded into 24-well plates at 100,000 cells per well. S. aureus Xen36/pSD1 and S. aureus Xen36/NADK sgRNA strains were grown to an OD600nm of 0.6, washed three times and diluted in DMEM to obtain a multiplicity of infection (MOI) of 10. Infected macrophages were centrifugated at 500 × g for 5 min and incubated for 15 min at 37°C and 5% CO2 to synchronize phagocytosis. The medium was replaced with DMEM containing gentamicin (20 μg/mL) for 30 min to kill extracellular bacteria. Cells were washed three times in DPBS and incubated in DMEM supplemented with 100 ng/mL anhydrotetracycline and 10 mM N-acetyl cysteine (NAC, Sigma-Aldrich) when indicated. Cells were incubated for 6 hr at 37°C and 5% CO2. At each time point, cells were lysed in 0.2% Triton X-100 for 10 min at 37°C. The number of bacteria released from the cells was determined by plating serial dilutions of the lysates on BHI agar plates that were incubated at 37°C for colony-forming units (CFU) enumeration.

Immunofluorescence assay

RAW 264.7 macrophages were cultured on glass coverslips in 24-well plates. At 6 hr post-infection, cells were fixed in paraformaldehyde (PFA) 4% for 15 min, permeabilized for 4 min with 0.1% Triton X-100 in 1% bovine serum albumin (BSA)-PBS and blocked in 1% BSA-PBS. Fixed cells were incubated for 30 min with rabbit anti-S. aureus (Abcam ab20920) and rat anti-LAMP1 1D4B (Abcam ab25245) primary antibodies. Cells were then incubated for 30 min with goat anti-rabbit Cy5 (Immunoresearch 111 175 144) or goat anti-rat FITC (Invitrogen A11006) secondary antibodies and DAPI (10 μg/mL). Slides were mounted with Fluoromount G (Invitrogen). Samples were observed with a Zeiss Axiovert 200 M epifluorescence microscope equipped with a Plan-apochromat objective (100 X/1.4 Oil Ph3; Carl Zeiss, Inc). Images were acquired with a CCD camera Coolsnap, processed with Metamorph software v.6 (Molecular Devices), and analyzed with ImageJ software.

Cytotoxicity assay

Overnight cultures of S. aureus/pSD1 and S. aureus/NADK sgRNA were diluted to an OD600nm 0.05 in BHI supplemented with ATc (100 ng/mL) and chloramphenicol (7 μg/mL), spread in a 96 wells plate and incubated for 6 hr at 37°C with shaking at 200 rpm. After 5hr 30min of growth, lysozyme (5 mg/mL) and lysostaphin (0.05 mg/mL) were added. At t=6 hr, 100 μL of the CellTox Green Reagent (1:500, G8741, Promega) were added to bacteria. After incubation at RT for 15 min, both OD600nm and fluorescent signal (excitation at 475 nm, emission at 500–550 nm) were measured with a microplate reader (Glomax Discover, Promega). For the cytotoxicity assay on infected macrophages, culture medium was replaced by either DPBS or by 0.2% Triton X-100 6 hr after the infection. After 10 min at 37°C, cells were washed with DPBS, and then incubated with 100 μL of CellTox Green Reagent for 15 min at RT. Fluorescent signal (excitation at 475 nm, emission at 500–550 nm) was measured with a microplate reader (Glomax Discover, Promega).

ROS levels quantification

Overnight cultures of S. aureus/pSD1 and S. aureus/NADK sgRNA were diluted to an OD600nm 0.05 in BHI supplemented with ATc (100 ng/mL) and chloramphenicol (7 μg/mL), spread in a 24-wells plate and incubated at 37°C with shaking at 200 rpm for 4 hr. After 4 hr, the OD600nm was measured and adjusted to 1, then bacteria centrifugated for 3 min at 13.000 g. DCFH2-DA (5 mM) was mixed with NaOH (0.1 M) to obtain DCF. Bacterial pellets were resuspended in 100 uL of DCF and incubated for 40 min at RT protected from light in a 96-wells black plate. Then fluorescence signal (excitation 475 nm, emission 500–550 nm) was measured with a microplate reader (Glomax Discover, Promega).

Zebrafish care and maintenance

Homozygous Tg(mfap4::mCherryF) (ump6Tg) (Phan et al., 2018) Tg(mpx::GFP)i114 (Renshaw et al., 2006) double transgenic fishes were raised in our facility. Eggs were obtained by natural spawning, bleached according to standard protocols, and then kept in Petri dishes containing Volvic spring water and, from 24 hpf onwards, 0.003% 1-phenyl-2-thiourea (PTU) (Sigma-Aldrich) was added to prevent pigmentation. Embryos were reared at 28 or 24°C according to the desired speed of development; infected larvae were always kept at 28°C. All timings in the text refer to the developmental stage at the reference temperature of 28°C. Larvae were anesthetized with 200 μg/mL of buffered tricaine methane sulfonate (MS-222, Sigma-Aldrich) during the injection procedure as well as during in vivo imaging and processing for bacterial burden evaluation.

Zebrafish infection

The volume of injected bacterial suspension was deduced from the diameter of the drop obtained after mock microinjection, as previously described (Levraud et al., 2008). Bacteria were diluted from overnight cultures and allowed to reach exponential growth. Then, they were recovered by centrifugation, washed, and resuspended at the desired concentration in PBS. 55–60 hr post-fertilization, anesthetized zebrafish larvae were microinjected intravenously (IV) with 1 nL of bacterial suspension at the desired dose as described (Colucci-Guyon et al., 2011; Mostowy et al., 2013). Infected larvae were transferred into individual wells containing 1 mL of Volvic water and 0.003% PTU in 24-well culture plates, incubated at 28°C, and regularly observed under a stereomicroscope.

Evaluation of the bacterial burden in infected zebrafish larvae

Infected zebrafish larvae were collected at 0, 24, 48, and 72 hpi and lysed for the evaluation of the bacterial burden as previously described (Boucontet et al., 2018; Mostowy et al., 2013). Each larva was placed in an individual 1.5 mL Eppendorf tube and anesthetized with tricaine (200 μg/mL), washed with 1 mL of sterile water, and placed in 150 µL of sterile water. Larvae were then homogenized using a pestle motor mixer (Argos). Each sample was transferred to an individual well of a 96-well plate and 10 X serial dilutions were performed. For CFU enumeration and to assess plasmid stability throughout the infection kinetics, serial dilutions of lysates were plated on BHI agar plates with and without chloramphenicol (15 μg/mL), that were incubated overnight at 37°C.

Zebrafish live imaging, image processing, and analysis

Quantification of total macrophages and neutrophils on living transgenic reporter larvae was performed upon infection as we previously described (Mostowy et al., 2013). Briefly, bright field, GFP, and RFP images of whole living anesthetized larvae were taken using a Leica Macrofluo Z16 APOA (zoom 16:1) macroscope equipped with a Leica PlanApo 2.0 X lens, and a Photometrics CoolSNAP HQ2 camera. Images were captured using the Metavue software version 7.5.6.0 (MDS Analytical Technologies). After capture of images, larvae were washed and transferred to a new 24-well plate filled with 1 mL of fresh water per well and incubated at 28 °C.

Whole-mount immunohistochemistry and confocal imaging

Whole larvae were fixed in 4% formaldehyde/PBS overnight at 4°C. After washes in PBSDT (PBS, 1% DMSO, and 0.1% Tween), fixed larvae were treated with acetone at –20° for 20 min, rinsed with 1×HBSS/0.1% Tween, permeabilized with a collagenase solution for up to 1 hr (Svoboda et al., 2001), washed in PBSDT, blocked with 10% Western Blocking Reagent (Merck; 11921673001)/PBSDT, and then incubated for 24–48 hr at 4°C with the primary antibodies. Chicken anti-GFP (1:1000, ab13970, Abcam), and anti-Staphylococcus aureus (1:500, ab20920, Abcam) antibodies were used. Following washes, samples were blocked in 10% Western blocking solution/PBSDT before overnight incubation with secondary antibodies at 4°C with agitation. The secondary antibodies were Alexa Fluor 488-conjugated goat anti-chicken (1:1000, A11039, Invitrogen) and Cy5-conjugated goat anti-rabbit (1:200, 111-175-144, Jackson Immunoresearch). Larvae were progressively embedded in glycerol (for conservation and microscopic observation) and mounted in lateral position for imaging. Confocal fluorescent imaging of fixed injected larvae was performed as previously described (Colucci-Guyon et al., 2020). Briefly, injected larvae were positioned in lateral position in 35 mm glass-bottom µ-Dishes (81158, Ibidi). Larvae were immobilized in the dish using a drop of 1% low-melting-point agarose (V2111, Promega) solution in 80% glycerol. A Leica SP8 confocal microscope equipped with two PMT and one Hybrid detector, a 20 X multi-IMM (water-oil-glycerol) objective (HC PL APO CS2 20 X/0.75), a X–Y motorized stage and the LAS-X software was used to image injected larvae. All samples were acquired using the same settings.

Total protein extraction

For in vitro samples, overnight cultures of S. aureus/pSD1 and S. aureus/NADK sgRNA were diluted to an OD600nm 0.05 in BHI with 200 μM H2O2 when indicated, spread in a 24-well plate, and incubated at 37°C with shaking at 200 rpm. After 6 hr, bacteria were centrifugated for 15 min at 10,000 g at 4°C, and the bacterial pellets were stored at –80°C. For in vivo samples, zebrafish larvae were infected with S. aureus/pSD1 or S. aureus/NADK sgRNA strains (see above). At 12 hpi, 5 larvae of each condition were isolated, anesthetized with tricaine, washed with 1 mL of sterile water, dried, placed on dry ice, and stored at –80°C. All samples were then resuspended in 1 mL of Tris 100 mM pH 7/urea 8 M. Proteins were extracted using the Precellys kit SK38 (P000915-LYSK0-A0, Bertin), in a Cryolys homogenizer (Bertin) by 6 cycles of agitation at 6500 rpm for 15 s and 30 s rest.

Protein digestion and cleanup of peptides

Proteins were reduced using 5 mM TCEP for 30 min at room temperature. Alkylation of the reduced disulfide bridges was performed using 10 mM iodoacetamide for 30 min at room temperature in the dark. Proteins were then digested in two steps, first with 1 µg r-LysC Mass Spec Grade (Promega) for 4 hr at 30°C and then samples were diluted below 2 M urea with 100 mM Tris HCl pH 8.5 and 1 µg Sequencing Grade Modified Trypsin was added for the second digestion overnight at 37°C. Proteolysis was stopped by adding formic acid (FA) at a final concentration of 5%. The peptide samples were cleaned using C18 cartridges (Agilent Technologies) in the automated AssayMAP Bravo Platform. The protocol for peptide cleanup included in the platform was used as a scaffold using the following settings. Cartridges were primed with 100 μL of 100% acetonitrile (ACN) at 300 μL/min. Equilibration was done with 50 μL of 0.1% FA at 10 μL/min. The sample was loaded at 5 μL/min. Cup wash (25 μL) and the internal cartridge wash (50 μL at 10 μL/min) were performed with 0.1% FA. Peptides were eluted with 50 μL of 50% ACN/0.1% FA at 5 μL/min. Samples were dried and stored at −80°C until further use. Peptides were resuspended in 2% acetonitrile (ACN)/0.1% FA prior to LC-MS injection.

Liquid chromatography-mass spectrometry

LC-MS/MS analysis was performed on a Orbitrap Q Exactive Plus Mass Spectrometer (Thermo Fisher Scientific) coupled with a Proxeon EASY-nLC 1200 (Thermo Fisher Scientific). One µg of peptides was injected onto a home-made 30 cm C18 column (1.9 μm particles, 100 Å pore size, ReproSil-Pur Basic C18, Dr. Maisch GmbH, Ammerbuch-Entringen, Germany). Column equilibration and peptide loading were done at 900 bars in buffer A (0.1% FA). Peptides were separated with a multi-step gradient from 2 to 7% buffer B (80% ACN, 0.1% FA) in 5 min, 7 to 23% buffer B in 70 min, 23 to 45% buffer B in 30 min at a flow rate of 250 nL/min. Column temperature was set to 60°C. MS data were acquired using Xcalibur software using a data-dependent method. MS scans were acquired at a resolution of 70,000 and MS/MS scans (fixed first mass 100 m/z) at a resolution of 17,500. The AGC target and maximum injection time for the survey scans and the MS/MS scans were set to 3E6, 20ms, and 1E6, 60ms, respectively. An automatic selection of the 10 most intense precursor ions was activated (Top 10) with a 45 s dynamic exclusion. The isolation window was set to 1.6 m/z and normalized collision energy fixed to 28 for HCD fragmentation. We used an underfill ratio of 1.0% corresponding to an intensity threshold of 1.7E5. Unassigned precursor ion charge states as well as 1, 7, 8, and >8 charged states were rejected and peptide match was disabled.

Data analysis

Acquired Raw files were analyzed using the MaxQuant software version 1.6.6.0 (Cox et al., 2011) using the Andromeda search engine (Cox and Mann, 2008; Tyanova et al., 2016). Sample were grouped by type of experiment. The MS/MS spectra were searched against the S. aureus Uniprot reference proteome (2889 entries). All searches were performed with oxidation of methionine and protein N-terminal acetylation as variable modifications and cysteine carbamidomethylation as fixed modification. Trypsin was selected as protease allowing for up to two missed cleavages. The minimum peptide length was set to five amino acids and the peptide mass was limited to a maximum of 8000 Da. The false discovery rate (FDR) for peptide and protein identification was set to 0.01. The main search peptide tolerance was set to 4.5 ppm and to 20 ppm for the MS/MS match tolerance. Second peptides were enabled to identify co-fragmentation events. One unique peptide to the protein group was required for the protein identification. A false discovery rate cut-off of 1% was applied at the peptide and protein levels. The mass spectrometry proteomics data have been deposited to the ProteomeXchange Consortium via the PRIDE partner repository with the dataset identifier PXD032968. The statistical analysis of the proteomics data was performed as follows: Five biological replicates were acquired per condition. To highlight significantly differentially abundant proteins between two conditions, differential analyses were conducted through the following data analysis pipeline: (1) deleting the reverse and potential contaminant proteins; (2) keeping only proteins with at least three quantified values in one of the two compared conditions to limit misidentifications and ensure a minimum of replicability; (3) log2-transformation of the remaining intensities of proteins; (4) normalizing the intensities by median centering within conditions thanks to the normalizeD function of the R package DAPAR (Wieczorek et al., 2017), (5) putting aside proteins without any value in one of both compared conditions: as they are quantitatively present in a condition and absent in another, they are considered as differentially abundant proteins, and (6) performing statistical differential analysis on them by requiring a minimum fold-change of 2.5 between conditions and by using a LIMMA t-test (Smyth, 2005; Ritchie et al., 2015) combined with an adaptive Benjamini-Hochberg correction of the p values thanks to the adjust.p function of the R package cp4p (Giai Gianetto et al., 2016). The robust method of Pounds and Cheng was used to estimate the proportion of true null hypotheses among the set of statistical tests (Pounds and Cheng, 2006). The proteins associated with an adjusted p-value inferior to an FDR level of 1% have been considered as significantly differentially abundant proteins. Finally, the proteins of interest are therefore the proteins that emerge from this statistical analysis supplemented by those being quantitatively absent from one condition and present in another.

Statistical analysis

Results are expressed as means ± SEM of at least three replicates. Statistical analysis was performed using GraphPad Prism (GraphPad Prism 9.1.2. Software). One-way, two-ways ANOVA or t-test were used to compare data. Differences between groups were considered significant when the p-value was lower than 0.05. Survival data were plotted using the Kaplan-Meier estimator and log-rank (Mantel-Cox) tests were performed to assess differences between groups. This work demonstrates that nicotinamide adenine dinucleotide phosphate is essential for the virulence of Staphylococcus aureus. The enzyme that catalyses the final step in the synthesis of this cofactor promotes virulence by protecting bacteria from host antimicrobial defences and is also involved in quorum sensing mechanisms. These data shed new light on the pathogenesis of S. aureus. In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses. Decision letter after peer review: [Editors’ note: the authors resubmitted a revised version of the paper for consideration. What follows is the authors’ response to the first round of review.] Thank you for submitting the paper "NAD kinase controls antibiotic susceptibility and pathogenic potential in Staphylococcus aureus" for consideration by eLife. Your article has been reviewed by 2 peer reviewers, and the evaluation has been overseen by a Reviewing Editor and a Senior Editor. The reviewers have opted to remain anonymous. We are sorry to say that, after consultation with the reviewers, we have decided that this work will not be considered further for publication by eLife. Your manuscript raised a very interesting model about how pink knock-down sensitizes bacteria to several stresses or more specifically ROS and is constituted of an incremental complexity of experiments from in vitro to in vivo. Unfortunately, it falls short of providing mechanistic insights on to the observations and alternatives are not considered. We recommend using the reviews provided here to consolidate the findings before submitting to another journal. Reviewer #1: The authors set out to examine the role of the enzyme NADK in enabling S. aureus to cause infection and survive antibiotic exposure. The main strength is that the authors managed to reduce the expression of NADK in S. aureus and go on to produce some interesting findings. The main weaknesses are that the work lacks depth and a number of important controls. There is limited investigation of the mechanisms that underpin the phenotype, resulting in a very superficial analysis of each phenotype. Importantly, alternative explanations for their observations are not investigated. The magnitude of differences in antibiotic susceptibility seems very small and of questionable physiological or clinical relevance. The overall aim was partly achieved in that the authors showed that NADK influences pathogenesis but the data on antibiotic susceptibility is very weak. Conclusions on the role of NADK in antibiotic susceptibility and ROS susceptibility are compromised by the lack of control and approaches used. It's not clear why the authors used the Xen36 strain or whether the findings could be applied to other strains? Figure supplement 1 shows the relQ operon for NCTC8325. Is this identical to the operon in Xen36? If so, why show for NCTC3525? Line 123: It would be useful to estimate the degree to which ppnK expression and NADK production were knocked down. Lines 122-123 fail to mention the growth defect of the KD strain, which is important and could impact many other phenotypes. Given the relationship of NADK to oxidative stress, it would be useful to see if this growth defect is abolished under anaerobic conditions. This will determine whether growth is due to increase susceptibility to oxidative stress or e.g. decreased metabolic activity. Knockdown of NADK production sensitises S. aureus to H2O2, but it's not clear why. It would be useful to show that catalase production is unaffected in the KD strain. Lines 153-154: For the triclosan susceptibility experiments, the effect shown in panel 3A is not obviously different between the KD strain and control. It doesn't appear that any statistical tests were done here to show differences (the only comparisons appear to be to No Treatment, not between strains). For panel B, it's unclear why catalase promotes growth of the KD strain. Is this strain catalase deficient? The EM analysis in figure supplement 2D isn't particularly convincing since most of the cells look fine. It could be that the images represent debris from the culture. A better, more quantitative test of membrane integrity would be to use a stain such as propidium iodide. It would also be useful to examine bacterial susceptibility to agents that target the membrane such as gramicidin, nisin or daptomycin. I note the subsequent experiment with polymyxin B, but this is typically used to combat Gram-negative bacteria as it has a high affinity for LPS and it's not clear what the concentrations used in this work do to the bacterial membrane, especially since there's only ~20% growth inhibition. Line 189 refers to bacterial survival during antibiotic stress, but the assay measures growth. These are two very different things. Survival is usually measured by time-course killing assays and growth by determination of the minimum inhibitory concentration. For the antibiotic assays it is not clear to me how the antibiotics were chosen. Polymyxin B is not used to treat S. aureus infections, nor is kanamycin or levofloxacin used routinely. It would be informative to include an ant-staphylococcal penicillin such as oxacillin. I'm also unsure of the relevance of this assay. It seems like there are very small differences in susceptibility between KD and control strain and the drug concentrations used are chosen specifically to focus on these small differences. If the author wants to investigate the role of ROS, they should repeat experiments under anaerobic conditions. Line 194: All Gram-positive bacteria are resistant to polymyxins since they lack LPS. Activity against Gram-positives is thought to be due to the surfactant properties of the antibiotic but this is not well established. A much better choice here would be daptomycin since it is used against S. aureus and targets the membrane. When measuring survival of S. aureus in phagocytes, it is important to consider whether there are differences in production of cytolytic toxins, which can disrupt immune cell function. Quantitative measurements of hemolytic activity or π staining of immune cells would suffice. This is especially important since the author observed escape from phagosomes, which is likely toxin mediated. The zebrafish data could be a consequence of different growth rates of the KD and control strain or differences in toxin production. In fact, toxin production seems more likely since relatively high CFU were found in fish, but the fish survived. Furthermore, there seems to be a depletion of phagocytic cells. Therefore, it's important to determine whether there are differences in toxin production between strains. If the authors wish to confirm the importance of oxidative immune defences, they should use a fish line defective for the oxidative burst. Figure 6A, B doesn't appear to have been analysed using any statistical tests. Line 317. ROS levels were not measured so this conclusion is unsupported. There are several other antibacterial factors in macrophages, including antimicrobial peptides that target the bacterial membrane. Line 345: If an inhibitor of NADK is available this should be used to confirm key findings. Line 392. What time point was used for antibiotic-mediated growth inhibition experiments and why? Reviewer #2: This work describes the role of Staphylococcal NADK in bacterial pathogenesis. It uses CRISPR-based interference to knock-down expression of the ppnK gene that encodes for NADK in Staphylococcus aureus. Comparing the behaviour of wild-type and ppnK knock-down S. aureus, the authors show that NADK protects the bacteria against oxidative stresses directly induced by 1) peroxide, 2) inhibition of fatty acid elongation, 3) exposure to various classes of antibiotics, and 4) uptake by macrophages. In addition, they show that NADK protects against some non-oxidative stresses like osmotic shock and exposure to other antibiotics. Lastly, they show that NADK knockdown impairs S. aureus survival in macrophages and impairs pathogenicity in a zebrafish infection model. The observations in the paper are well described. However, more technical detail is required to unequivocally support the major conclusion. Specifically, the authors start with showing that ppnK is part of an operon. Therefore, targeting ppnK via CRISPR-based interference could also affect genes downstream in this operon as described by Zhao et al. who devised the system (described in Applied and Environmental Microbiol 2017). To unequivocally show that NADK mediates the observed phenotypes, the authors should complement their knockdown strain with exogenous ppnK expression, or measure and complement NADP(H) levels. The CRISPR-based interference that is used depends on a vector that allows for constitutive expression of sgRNA and inducible expression of dCas9 to mediate the interference. Zhao et al. described that ATc induction leads to a 100-fold knockdown of a target gene. The knockdown is reversible and non-induced leaky expression will still lead to 3-fold reduction in expression of the target gene. The authors should comment on what this means for the NADK expression during the macrophage and zebrafish infection experiments that run over longer periods. Perhaps the authors know whether initial absence of NADK during infection is sufficient to evoke the better survival of fish at 72h? Or whether the non-induced strain is also less pathogenic? 1. The way the introduction is written, it is not directly clear whether the paper would focus on bacterial or human NADK. Stating this earlier could make the paper easier to read. 2. Looking at the described experiments and the points raised in the general discussion, the regulation of NADKs by calcium and calmodulin seem redundant. Perhaps the authors can clarify why they highlight this in the introduction? 3. Readers would benefit from a broader perspective in the discussion about known ways in which S. aureus deals with ROS during infection. For example, production of catalase, staphyloxanthin, and the MPO inhibitor SPIN. 4. Line 111: to my opinion, this finding does not "confirm importance", but suggests it. Your manuscript raised a very interesting model about how pink knock-down sensitizes bacteria to several stresses or more specifically ROS and is constituted of an incremental complexity of experiments from in vitro to in vivo. Unfortunately, it falls short of providing mechanistic insights on to the observations and alternatives are not considered. We recommend using the reviews provided here to consolidate the findings before submitting to another journal. Reviewer #1: The authors set out to examine the role of the enzyme NADK in enabling S. aureus to cause infection and survive antibiotic exposure. The main strength is that the authors managed to reduce the expression of NADK in S. aureus and go on to produce some interesting findings. The main weaknesses are that the work lacks depth and a number of important controls. There is limited investigation of the mechanisms that underpin the phenotype, resulting in a very superficial analysis of each phenotype. Importantly, alternative explanations for their observations are not investigated. The magnitude of differences in antibiotic susceptibility seems very small and of questionable physiological or clinical relevance. The overall aim was partly achieved in that the authors showed that NADK influences pathogenesis but the data on antibiotic susceptibility is very weak. Conclusions on the role of NADK in antibiotic susceptibility and ROS susceptibility are compromised by the lack of control and approaches used. We thank the reviewer for highlighting the production of interesting findings by reducing NADK expression in S. aureus. We have worked to address suggestions on depth, controls, mechanisms, alternatives, and antibiotic susceptibility. It's not clear why the authors used the Xen36 strain or whether the findings could be applied to other strains? The Xen36 strain has been used for several reasons. Xen36 is a relevant strain to study pathogenicity as it is derived from a clinical strain isolated from a bacteremic patient (ATCC 49525). This is indicated in Table 3 (page 25). As a matter of fact, we and many others have been using this strain to investigate S. aureus-host interactions for more than a decade (Koskinen et al., 2007; Munro et al., 2010; Pribaz et al., 2012; Peetermans et al., 2014; Bostian et al., 2017; Trikha et al., 2020 etc.). Additionally, Xen36 is commercially available and can be readily obtained from PerkinElmer, as indicated in Table 3 (page 25). Most importantly, we previously showed that we could modify genetically this strain to knockdown NADK expression (Gelin et al., 2020). This is mentioned lines 94-96. To assess if our findings could be applied to other strains, we compared growth of the S. aureus USA300 strain containing the empty vector to that of the NADK knockdown strain upon exposure to hydrogen peroxide. USA300 is a globally distributed, methicillin-resistant, hypervirulent strain of community- and healthcare-associated S. aureus (Planet, 2017). As expected, growth of USA300 in BHI was affected by NADK knockdown (Author response image 1). When bacteria were exposed to a 200 μM concentration of H2O2, the USA300/pSD1 strain was not affected. In contrast, the USA300/NADK sgRNA strain showed a significant growth defect ( (Author response image 1) ). These results indicate that NADK protects USA300 from hydrogen peroxide toxicity, as demonstrated in Xen36 (Figure 3, page 14). Therefore, our findings could be applied to both methicillin-sensitive and MRSA strains.
Author response image 1.

NADK protects S. aureus USA300 from hydrogen peroxide toxicity.

Growth of the USA300 strain containing the empty plasmid (USA300 pSD1, grey) and the NADK knockdown strain (USA300 sgRNA, blue) was monitored at OD600nm in BHI broth at 37°C (NT, open circles) or in BHI exposed to hydrogen peroxide (H2O2, closed circles). Bars indicate the standard errors of the means of biological replicates (n=3).

NADK protects S. aureus USA300 from hydrogen peroxide toxicity.

Growth of the USA300 strain containing the empty plasmid (USA300 pSD1, grey) and the NADK knockdown strain (USA300 sgRNA, blue) was monitored at OD600nm in BHI broth at 37°C (NT, open circles) or in BHI exposed to hydrogen peroxide (H2O2, closed circles). Bars indicate the standard errors of the means of biological replicates (n=3). Figure supplement 1 shows the relQ operon for NCTC8325. Is this identical to the operon in Xen36? If so, why show for NCTC3525? We thank the reviewer for this question. At the time of submission, the genome of the Xen36 strain had not been sequenced. Since the relQ operon is highly conserved in sequenced strains of S. aureus, we showed the relQ operon of the prototypical NCTC3525 strain. We agree that showing the relQ operon of Xen36 would be more relevant to our study. We have since sequenced the genome of Xen36. Figure supplement 1 (page 49) now shows the Xen36 relQ operon with corresponding coordinates. It can be estimated that the degree of NADK knockdown is high, since the ppnK transcript and NADK protein are barely detectable in the NADK sgRNA strain (Figure supplement 1A and 1B, page 49). These results corroborate our previous findings showing that levels of NADK and NADP(H)/NAD(H) ratio are strongly reduced in the knockdoen strain (Gelin et al., 2020) It can be estimated that the degree of NADK knockdown is high, since the ppnK transcript and NADK protein are barely detectable in the NADK sgRNA strain (Figure supplement 1A and 1B, page 49). These results corroborate our previous findings showing that levels of NADK and NADP(H)/NAD(H) ratio are strongly reduced in the knockdoen strain (Gelin et al., 2020) Lines 122-123 fail to mention the growth defect of the KD strain, which is important and could impact many other phenotypes. Given the relationship of NADK to oxidative stress, it would be useful to see if this growth defect is abolished under anaerobic conditions. This will determine whether growth is due to increase susceptibility to oxidative stress or e.g. decreased metabolic activity. We thank the reviewer for this comment. The growth defect attesting the efficiency of the knockdown has been introduced in the text (lines 99-100). To test the relationship between NADK and oxidative stress, rather than studying growth under anaerobic conditions which leads to massive changes in gene expression and metabolic pathways (Fuchs et al., 2007), we measured growth of S. aureus containing the empty vector and NADK knockdown strains in BHI supplemented or not with catalase. As expected, growth of Xen36 in BHI was affected by NADK knockdown (Author response image 2). Addition of catalase to the culture medium decreased this growth defect (Author response image 2). These results suggest that reactive oxygen species generated during aerobic growth contribute to the growth defect of the knockdown strain.
Author response image 2.

Reactive oxygen species contribute to S. aureus growth defect upon NADK knockdown.

Aerobic growth of the Xen36 strain containing the empty plasmid (pSD1, grey) and the NADK knockdown strain (NADK sgRNA, blue) was monitored at OD600nm in BHI broth at 37°C (NT, open circles) or in BHI supplemented with 10 ug/mL catalase (closed circles). Bars indicate the standard errors of the means of biological replicates (n=3).

Reactive oxygen species contribute to S. aureus growth defect upon NADK knockdown.

Aerobic growth of the Xen36 strain containing the empty plasmid (pSD1, grey) and the NADK knockdown strain (NADK sgRNA, blue) was monitored at OD600nm in BHI broth at 37°C (NT, open circles) or in BHI supplemented with 10 ug/mL catalase (closed circles). Bars indicate the standard errors of the means of biological replicates (n=3). Knockdown of NADK production sensitises S. aureus to H2O2, but it's not clear why. It would be useful to show that catalase production is unaffected in the KD strain. The reviewer brings up an important aspect of the role of NADK, which we investigated to understand the mechanism of the increased sensitivity to H2O2 of the knockdown strain. Comparative proteomic analysis of S. aureus/pSD1 and S. aureus/NADK sgRNA strains revealed that NADK deficiency led to decreased relative abundance of S. aureus catalase (Table 1, page 16; Table supplement 1, page 55; Table supplement 4, page 55; Figure supplement 3, page 53). These results and our new data showing that NADK supports other major antioxidant enzymes (Table 1, page 16; Table supplement 1, page 55; Table supplement 4, page 55; Figure supplement 3, page 53), suggest that deficiency in the antioxidant arsenal upon NADK knockdown contributes to sensitize S. aureus to oxidative stress. Lines 153-154: For the triclosan susceptibility experiments, the effect shown in panel 3A is not obviously different between the KD strain and control. It doesn't appear that any statistical tests were done here to show differences (the only comparisons appear to be to No Treatment, not between strains). For panel B, it's unclear why catalase promotes growth of the KD strain. Is this strain catalase deficient? We decided to remove these experiments from the new manuscript for clarity and focus our study on the role of NADK in S. aureus pathogenicity and its mechanism. The EM analysis in figure supplement 2D isn't particularly convincing since most of the cells look fine. It could be that the images represent debris from the culture. A better, more quantitative test of membrane integrity would be to use a stain such as propidium iodide. It would also be useful to examine bacterial susceptibility to agents that target the membrane such as gramicidin, nisin or daptomycin. I note the subsequent experiment with polymyxin B, but this is typically used to combat Gram-negative bacteria as it has a high affinity for LPS and it's not clear what the concentrations used in this work do to the bacterial membrane, especially since there's only ~20% growth inhibition. For the reasons indicated above, we decided to remove these experiments from the new manuscript. Line 189 refers to bacterial survival during antibiotic stress, but the assay measures growth. These are two very different things. Survival is usually measured by time-course killing assays and growth by determination of the minimum inhibitory concentration. We agree with the reviewer. This sentence has been suppressed from the new manuscript. For the antibiotic assays it is not clear to me how the antibiotics were chosen. Polymyxin B is not used to treat S. aureus infections, nor is kanamycin or levofloxacin used routinely. It would be informative to include an ant-staphylococcal penicillin such as oxacillin. I'm also unsure of the relevance of this assay. It seems like there are very small differences in susceptibility between KD and control strain and the drug concentrations used are chosen specifically to focus on these small differences. If the author wants to investigate the role of ROS, they should repeat experiments under anaerobic conditions. We apologize for the lack of clarity in the text. Our goal was not to investigate a putative role of NADK in resistance to clinically relevant antibiotics. At first, we hypothesized that NADK could be involved in bacterial response to antibiotic stress. We therefore used subinhibitory concentration of antibiotics acting on different bacterial targets. We realized that this part of the original manuscript could be source of confusion. Since antibiotic stress and pathogenicity are different aspects, we decided to remove these experiments from the new manuscript and focus on pathogenicity. Line 194: All Gram-positive bacteria are resistant to polymyxins since they lack LPS. Activity against Gram-positives is thought to be due to the surfactant properties of the antibiotic but this is not well established. A much better choice here would be daptomycin since it is used against S. aureus and targets the membrane. For the reasons indicated above, we decided to remove these experiments from the new manuscript. When measuring survival of S. aureus in phagocytes, it is important to consider whether there are differences in production of cytolytic toxins, which can disrupt immune cell function. Quantitative measurements of hemolytic activity or π staining of immune cells would suffice. This is especially important since the author observed escape from phagosomes, which is likely toxin mediated. We thank the reviewer for these helpful suggestions. We have now quantified the levels of major S. aureus cytolysins, hemolytic activity and immune cell viability. Strikingly, our comparative proteomic study highlights a role of NADK in toxin production (Figure 4, page 18; Table 2, page 19; Figure supplement 3, page 53; Table supplement 6, page 56). We also demonstrate that NADK promotes hemolytic activity (Figure 4, page 18) and cytotoxicity (Figure 2, page 11). The zebrafish data could be a consequence of different growth rates of the KD and control strain or differences in toxin production. In fact, toxin production seems more likely since relatively high CFU were found in fish, but the fish survived. Furthermore, there seems to be a depletion of phagocytic cells. Therefore, it's important to determine whether there are differences in toxin production between strains. If the authors wish to confirm the importance of oxidative immune defences, they should use a fish line defective for the oxidative burst. We thank the reviewer for these comments and suggestions. As mentioned by the reviewer, it is unlikely that different growth rates of the two strains explain the zebrafish data. Indeed, we show that similar numbers of S. aureus/pSD1 and S. aureus/NADK sgRNA are recovered from zebrafish at 6 hours and 24 hours post-infection (Figure supplement 2, page 51). We have demonstrated that NADK supports toxin production, as hypothesized by the reviewer (Figure 4, page 18; Table 2, page 19; Figure supplement 3, page 53; Table supplement 6, page 56). Additionally, we now show that production of antioxidant enzymes by the knockdown strain is defective in infected zebrafish (Table supplement 4, page 55; Table supplement 5, page 55), possibly sensitizing S. aureus to host defenses. Figure 6A, B doesn't appear to have been analysed using any statistical tests. Statistical analysis has now been performed (Figure 1A, page 8). Figure 1B showing a combination of living and dead larvae precludes a statistical test, as previously published by experts in the field of zebrafish infection (Prajsnar et al., 2008, 2012). Line 317. ROS levels were not measured so this conclusion is unsupported. There are several other antibacterial factors in macrophages, including antimicrobial peptides that target the bacterial membrane. This sentence has been changed. In fact, we now show that NADK protect S. aureus from both oxidative and cell-wall targeting compounds (Figure 3, page 14). Line 345: If an inhibitor of NADK is available this should be used to confirm key findings. Line 392. What time point was used for antibiotic-mediated growth inhibition experiments and why? For the reasons indicated above, we decided to remove the antibiotic experiments from the new manuscript. Reviewer #2: This work describes the role of Staphylococcal NADK in bacterial pathogenesis. It uses CRISPR-based interference to knock-down expression of the ppnK gene that encodes for NADK in Staphylococcus aureus. Comparing the behaviour of wild-type and ppnK knock-down S. aureus, the authors show that NADK protects the bacteria against oxidative stresses directly induced by 1) peroxide, 2) inhibition of fatty acid elongation, 3) exposure to various classes of antibiotics, and 4) uptake by macrophages. In addition, they show that NADK protects against some non-oxidative stresses like osmotic shock and exposure to other antibiotics. Lastly, they show that NADK knockdown impairs S. aureus survival in macrophages and impairs pathogenicity in a zebrafish infection model. The observations in the paper are well described. However, more technical detail is required to unequivocally support the major conclusion. We thank the reviewer for these comments. We have worked to add data supporting the major conclusion of our study. Specifically, the authors start with showing that ppnK is part of an operon. Therefore, targeting ppnK via CRISPR-based interference could also affect genes downstream in this operon as described by Zhao et al. who devised the system (described in Applied and Environmental Microbiol 2017). To unequivocally show that NADK mediates the observed phenotypes, the authors should complement their knockdown strain with exogenous ppnK expression, or measure and complement NADP(H) levels. We thank the reviewer for these helpful comments. The essential role of NADK in published experimental settings (Cassette et al., 2003; Kobayashi et al., 2003; Grose et al., 2006; Chaudhuri et al., 2009) excludes the straightforward phenotypic comparison of wild-type, deletion mutant and complemented strains. We have therefore used a CRISPR-based pSD1-mediated strategy (Zhao et al., 2017), to decrease the expression of NADK. We have previously demonstrated that our NADK sgRNA vector targets NADK as it reduces the NADP(H)/NAD(H) ratio in S. aureus (Gelin et al., 2020). The system designed by Zhao and colleagues is based on interference induction upon addition of ATc. As mentioned below by the reviewer, the system is leaky and reversible, making complementation experiments and their interpretation uneasy. To determine if the NADK sgRNA vector had any polar effect on the expression of the gene located downstream of ppnK in the operon, we decided to analyze the levels of rluA transcript by RT-PCR. S. aureus/pSD1 and the knockdown strain had similar levels of rluA (Figure supplement 1, page 49), while the levels of ppnK was strongly reduced in the knockdown strain (Figure supplement 1, page 49). These results suggest that targeting ppnK does not affect expression of its downstream gene. The CRISPR-based interference that is used depends on a vector that allows for constitutive expression of sgRNA and inducible expression of dCas9 to mediate the interference. Zhao et al. described that ATc induction leads to a 100-fold knockdown of a target gene. The knockdown is reversible and non-induced leaky expression will still lead to 3-fold reduction in expression of the target gene. The authors should comment on what this means for the NADK expression during the macrophage and zebrafish infection experiments that run over longer periods. Perhaps the authors know whether initial absence of NADK during infection is sufficient to evoke the better survival of fish at 72h? Or whether the non-induced strain is also less pathogenic? We agree with the reviewer. Non-induced basal expression of the PtetO promoter has been previously reported in vitro and in vivo (Sipo et al., 2006; Tian et al., 2009; Tatsuke et al., 2013; Akmammedov et al., 2017; Zhao et al., 2017). We made a similar observation in our experimental conditions (Gelin et al., 2020). Indeed, expression of NADK is decreased in non-induced conditions (Gelin et al., 2020). The levels of NADK expression as a function of time during infection of macrophages and zebrafish with the knockdown strain are unknown. One can hypothesize that the interference is maintained as the vector is still carried by the strain in absence of antibiotics 48 hours post-infection (Figure supplement 2A, page 51). 1. The way the introduction is written, it is not directly clear whether the paper would focus on bacterial or human NADK. Stating this earlier could make the paper easier to read. We have now referred to bacterial NADK in the first sentence of the introduction. 2. Looking at the described experiments and the points raised in the general discussion, the regulation of NADKs by calcium and calmodulin seem redundant. Perhaps the authors can clarify why they highlight this in the introduction? We agree with the reviewer. The paragraph on NADK regulation in plants, which was dispensable to understand the study, has been deleted. 3. Readers would benefit from a broader perspective in the discussion about known ways in which S. aureus deals with ROS during infection. For example, production of catalase, staphyloxanthin, and the MPO inhibitor SPIN. We thank the reviewer for this suggestion. Since we uncovered the regulatory role of NADK on protective enzymes, toxins, and the response regulator AgrA, the discussion has been entirely rewritten to emphasize the mechanisms by which NADK promotes to S. aureus pathogenesis. 4. Line 111: to my opinion, this finding does not "confirm importance", but suggests it. We agree with the reviewer. This paragraph has been deleted due to the focus of the new manuscript. References Akmammedov A, Geigges M, Paro R. Single vector non-leaky gene expression system for Drosophila melanogaster. Sci Rep. 2017 Jul 31;7(1):6899. doi: 10.1038/s41598-017-07282-w. PMID: 28761084; PMCID: PMC5537222. Bostian PA, Karnes JM, Cui S, Robinson LJ, Daffner SD, Witt MR, Emery SE. Novel rat tail discitis model using bioluminescent Staphylococcus aureus. J Orthop Res. 2017 Sep;35(9):2075-2081. doi: 10.1002/jor.23497. Epub 2017 Mar 15. PMID: 27918144; PMCID: PMC5459675. Chaudhuri RR, Allen AG, Owen PJ, Shalom G, Stone K, Harrison M, Burgis TA, Lockyer M, Garcia-Lara J, Foster SJ, Pleasance SJ, Peters SE, Maskell DJ, Charles IG. Comprehensive identification of essential Staphylococcus aureus genes using Transposon-Mediated Differential Hybridisation (TMDH). BMC Genomics. 2009 Jul 1;10:291. doi: 10.1186/1471-2164-10-291. PMID: 19570206; PMCID: PMC2721850. Fuchs S, Pané-Farré J, Kohler C, Hecker M, Engelmann S. Anaerobic gene expression in Staphylococcus aureus. J Bacteriol. 2007 Jun;189(11):4275-89. doi: 10.1128/JB.00081-07. Epub 2007 Mar 23. PMID: 17384184; PMCID: PMC1913399. Gelin M, Paoletti J, Nahori MA, Huteau V, Leseigneur C, Jouvion G, Dugué L, Clément D, Pons JL, Assairi L, Pochet S, Labesse G, Dussurget O. From Substrate to Fragments to Inhibitor Active InVivo against Staphylococcus aureus. ACS Infect Dis. 2020 Mar 13;6(3):422-435. doi: 10.1021/acsinfecdis.9b00368. Epub 2020 Feb 14. PMID: 32017533. Grose JH, Joss L, Velick SF, Roth JR. Evidence that feedback inhibition of NAD kinase controls responses to oxidative stress. Proc Natl Acad Sci U S A. 2006 May 16;103(20):7601-6. doi: 10.1073/pnas.0602494103. Epub 2006 May 8. PMID: 16682646; PMCID: PMC1472491. Kobayashi K, Ehrlich SD, Albertini A, Amati G, Andersen KK, Arnaud M, Asai K, Ashikaga S, Aymerich S, Bessieres P, Boland F, Brignell SC, Bron S, Bunai K, Chapuis J, Christiansen LC, Danchin A, Débarbouille M, Dervyn E, Deuerling E, Devine K, Devine SK, Dreesen O, Errington J, Fillinger S, Foster SJ, Fujita Y, Galizzi A, Gardan R, Eschevins C, Fukushima T, Haga K, Harwood CR, Hecker M, Hosoya D, Hullo MF, Kakeshita H, Karamata D, Kasahara Y, Kawamura F, Koga K, Koski P, Kuwana R, Imamura D, Ishimaru M, Ishikawa S, Ishio I, Le Coq D, Masson A, Mauël C, Meima R, Mellado RP, Moir A, Moriya S, Nagakawa E, Nanamiya H, Nakai S, Nygaard P, Ogura M, Ohanan T, O'Reilly M, O'Rourke M, Pragai Z, Pooley HM, Rapoport G, Rawlins JP, Rivas LA, Rivolta C, Sadaie A, Sadaie Y, Sarvas M, Sato T, Saxild HH, Scanlan E, Schumann W, Seegers JF, Sekiguchi J, Sekowska A, Séror SJ, Simon M, Stragier P, Studer R, Takamatsu H, Tanaka T, Takeuchi M, Thomaides HB, Vagner V, van Dijl JM, Watabe K, Wipat A, Yamamoto H, Yamamoto M, Yamamoto Y, Yamane K, Yata K, Yoshida K, Yoshikawa H, Zuber U, Ogasawara N. Essential Bacillus subtilis genes. Proc Natl Acad Sci U S A. 2003 Apr 15;100(8):4678-83. doi: 10.1073/pnas.0730515100. Epub 2003 Apr 7. PMID: 12682299; PMCID: PMC153615. Koskinen K, Nevalainen S, Karikoski M, Hänninen A, Jalkanen S, Salmi M. VAP-1-deficient mice display defects in mucosal immunity and antimicrobial responses: implications for antiadhesive applications. J Immunol. 2007 Nov 1;179(9):6160-8. doi: 10.4049/jimmunol.179.9.6160. PMID: 17947691. Munro P, Benchetrit M, Nahori MA, Stefani C, Clément R, Michiels JF, Landraud L, Dussurget O, Lemichez E. The Staphylococcus aureus epidermal cell differentiation inhibitor toxin promotes formation of infection foci in a mouse model of bacteremia. Infect Immun. 2010 Aug;78(8):3404-11. doi: 10.1128/IAI.00319-10. Epub 2010 May 17. PMID: 20479081; PMCID: PMC2916266. Peetermans M, Vanassche T, Liesenborghs L, Claes J, Vande Velde G, Kwiecinksi J, Jin T, De Geest B, Hoylaerts MF, Lijnen RH, Verhamme P. Plasminogen activation by staphylokinase enhances local spreading of S. aureus in skin infections. BMC Microbiol. 2014 Dec 17;14:310. doi: 10.1186/s12866-014-0310-7. PMID: 25515118; PMCID: PMC4274676. Planet PJ. Life After USA300: The rise and fall of a superbug. J Infect Dis. 2017 Feb 15;215(suppl_1):S71-S77. doi: 10.1093/infdis/jiw444. Prajsnar TK, Cunliffe VT, Foster SJ, Renshaw SA. A novel vertebrate model of Staphylococcus aureus infection reveals phagocyte-dependent resistance of zebrafish to non-host specialized pathogens. Cell Microbiol. 2008 Nov;10(11):2312-25. doi: 10.1111/j.1462-5822.2008.01213.x. Epub 2008 Aug 18. PMID: 18715285. Prajsnar TK, Hamilton R, Garcia-Lara J, McVicker G, Williams A, Boots M, Foster SJ, Renshaw SA. A privileged intraphagocyte niche is responsible for disseminated infection of Staphylococcus aureus in a zebrafish model. Cell Microbiol. 2012 Oct;14(10):1600-19. doi: 10.1111/j.1462-5822.2012.01826.x. Epub 2012 Jul 4. PMID: 22694745; PMCID: PMC3470706. Pribaz JR, Bernthal NM, Billi F, Cho JS, Ramos RI, Guo Y, Cheung AL, Francis KP, Miller LS. Mouse model of chronic post-arthroplasty infection: noninvasive in vivo bioluminescence imaging to monitor bacterial burden for long-term study. J Orthop Res. 2012 Mar;30(3):335-40. doi: 10.1002/jor.21519. Epub 2011 Aug 11. PMID: 21837686; PMCID: PMC3217109. Sassetti CM, Boyd DH, Rubin EJ. Genes required for mycobacterial growth defined by high density mutagenesis. Mol Microbiol. 2003 Apr;48(1):77-84. doi: 10.1046/j.1365-2958.2003.03425.x. PMID: 12657046. Sipo I, Hurtado Picó A, Wang X, Eberle J, Petersen I, Weger S, Poller W, Fechner H. An improved Tet-On regulatable FasL-adenovirus vector system for lung cancer therapy. J Mol Med (Berl). 2006 Mar;84(3):215-25. doi: 10.1007/s00109-005-0009-1. Epub 2005 Dec 31. PMID: 16437213. Tatsuke T, Lee JM, Kusakabe T, Iiyama K, Sezutsu H, Uchino K. Tightly controlled tetracycline-inducible transcription system for explosive gene expression in cultured silkworm cells. Arch Insect Biochem Physiol. 2013 Apr;82(4):173-82. doi: 10.1002/arch.21083. Epub 2013 Jan 31. PMID: 23371880. Tian X, Wang G, Xu Y, Wang P, Chen S, Yang H, Gao F, Xu A, Cao F, Jin X, Manyande A, Tian Y. An improved tet-on system for gene expression in neurons delivered by a single lentiviral vector. Hum Gene Ther. 2009 Feb;20(2):113-23. doi: 10.1089/hum.2008.018. PMID: 20377365. Trikha R, Greig D, Kelley BV, Mamouei Z, Sekimura T, Cevallos N, Olson T, Chaudry A, Magyar C, Leisman D, Stavrakis A, Yeaman MR, Bernthal NM. Inhibition of angiotensin converting enzyme impairs antistaphylococcal immune function in a preclinical model of implant infection. Front Immunol. 2020 Sep 11;11:1919. doi: 10.3389/fimmu.2020.01919. PMID: 33042111; PMCID: PMC7518049. Zhao C, Shu X, Sun B. Construction of a gene knockdown system based on catalytically inactive ("Dead") Cas9 (dCas9) in Staphylococcus aureus. Appl Environ Microbiol. 2017 May 31;83(12):e00291-17. doi: 10.1128/AEM.00291-17. PMID: 28411216; PMCID: PMC5452804.
  77 in total

1.  From Substrate to Fragments to Inhibitor Active In Vivo against Staphylococcus aureus.

Authors:  Muriel Gelin; Julie Paoletti; Marie-Anne Nahori; Valérie Huteau; Clarisse Leseigneur; Grégory Jouvion; Laurence Dugué; David Clément; Jean-Luc Pons; Liliane Assairi; Sylvie Pochet; Gilles Labesse; Olivier Dussurget
Journal:  ACS Infect Dis       Date:  2020-02-14       Impact factor: 5.084

2.  Why are pathogenic staphylococci so lysozyme resistant? The peptidoglycan O-acetyltransferase OatA is the major determinant for lysozyme resistance of Staphylococcus aureus.

Authors:  Agnieszka Bera; Silvia Herbert; Andreas Jakob; Waldemar Vollmer; Friedrich Götz
Journal:  Mol Microbiol       Date:  2005-02       Impact factor: 3.501

3.  Comparative analysis of USA300 virulence determinants in a rabbit model of skin and soft tissue infection.

Authors:  Scott D Kobayashi; Natalia Malachowa; Adeline R Whitney; Kevin R Braughton; Donald J Gardner; Dan Long; Juliane Bubeck Wardenburg; Olaf Schneewind; Michael Otto; Frank R Deleo
Journal:  J Infect Dis       Date:  2011-09-15       Impact factor: 5.226

4.  The presence of peptidoglycan O-acetyltransferase in various staphylococcal species correlates with lysozyme resistance and pathogenicity.

Authors:  Agnieszka Bera; Raja Biswas; Silvia Herbert; Friedrich Götz
Journal:  Infect Immun       Date:  2006-08       Impact factor: 3.441

5.  Oxidative stress evokes a metabolic adaptation that favors increased NADPH synthesis and decreased NADH production in Pseudomonas fluorescens.

Authors:  Ranji Singh; Ryan J Mailloux; Simone Puiseux-Dao; Vasu D Appanna
Journal:  J Bacteriol       Date:  2007-06-15       Impact factor: 3.490

6.  A novel vertebrate model of Staphylococcus aureus infection reveals phagocyte-dependent resistance of zebrafish to non-host specialized pathogens.

Authors:  Tomasz K Prajsnar; Vincent T Cunliffe; Simon J Foster; Stephen A Renshaw
Journal:  Cell Microbiol       Date:  2008-08-18       Impact factor: 3.715

7.  Alpha-toxin damages the air-blood barrier of the lung in a rat model of Staphylococcus aureus-induced pneumonia.

Authors:  M C McElroy; H R Harty; G E Hosford; G M Boylan; J F Pittet; T J Foster
Journal:  Infect Immun       Date:  1999-10       Impact factor: 3.441

8.  Toxin-induced necroptosis is a major mechanism of Staphylococcus aureus lung damage.

Authors:  Kipyegon Kitur; Dane Parker; Pamela Nieto; Danielle S Ahn; Taylor S Cohen; Samuel Chung; Sarah Wachtel; Susan Bueno; Alice Prince
Journal:  PLoS Pathog       Date:  2015-04-16       Impact factor: 6.823

9.  Staphylococcus aureus Responds to the Central Metabolite Pyruvate To Regulate Virulence.

Authors:  Divya Balasubramanian; Elizabeth A Ohneck; Lamia Harper; William E Sause; Jessica Chapman; Bryan Mejia-Sosa; Tenzin Lhakhang; Adriana Heguy; Aristotelis Tsirigos; Beatrix Ueberheide; Jeffrey M Boyd; Desmond S Lun; Victor J Torres
Journal:  mBio       Date:  2018-01-23       Impact factor: 7.867

10.  DAPAR & ProStaR: software to perform statistical analyses in quantitative discovery proteomics.

Authors:  Samuel Wieczorek; Florence Combes; Cosmin Lazar; Quentin Giai Gianetto; Laurent Gatto; Alexia Dorffer; Anne-Marie Hesse; Yohann Couté; Myriam Ferro; Christophe Bruley; Thomas Burger
Journal:  Bioinformatics       Date:  2016-09-06       Impact factor: 6.937

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.