Literature DB >> 35679267

Combining DNA and HPTLC profiles to differentiate a pain relief herb, Mallotus repandus, from plants sharing the same common name, "Kho-Khlan".

Kannika Thongkhao1, Chayapol Tungphatthong1, Vipawee Pichetkun1, Suthathip Gaewtongliam1, Worakorn Wiwatcharakornkul1, Suchada Sukrong1.   

Abstract

The pain relief formula "Ya Pa Som Kho-Khlan (YPSKK)" or "ยาผสมโคคลาน" in Thai is officially recorded in the Natural List of Essential Medicines (NLEM) of Thailand. The main component is Mallotus repandus (Willd.) Müll. Arg.; however, Anamirta cocculus (L.) Wight & Arn and Croton caudatus Gleiseler share the same common name: "Kho-Khlan". Confused usage of A. cocculus or C. caudatus can have effects via toxicity or unsuccessful treatment. This study aimed to combine a high-performance thin-layer chromatography (HPTLC) technique and DNA barcoding coupled with high-resolution melting (Bar-HRM) to differentiate M. repandus from the other two species. The M. repandus extract exhibited a distinct HPTLC profile that could be used to differentiate it from the others. DNA barcodes of the rbcL, matK, ITS and psbA-trnH intergenic spacer regions of all the plants were established to assist HPTLC analysis. The rbcL region was selected for Bar-HRM analysis. PCR amplification was performed to obtain 102 bp amplicons encompassing nine polymorphic nucleotides. The amplicons were subjected to HRM analysis to obtain melting curve profiles. The melting temperatures (Tm) of authentic A. cocculus (A), C. caudatus (C) and M. repandus (M) were separated at 82.03±0.09°C, 80.93±0.04°C and 80.05±0.07°C, respectively. The protocol was applied to test crude drugs (CD1-6). The HPTLC profiles of CD2-6 showed distinct bands of M. repandus, while CD1 showed unclear band results. The Bar-HRM method was applied to assist the HPTLC and indicated that CD1 was C. caudatus. While ambiguous melting curves from the laboratory-made formulae were obtained, HPTLC analysis helped reveal distinct patterns for the identification of the plant species. The combination of HPTLC and Bar-HRM analysis could be a tool for confirming the identities of plant species sharing the same name, especially for those whose sources are multiple and difficult to identify by either chemical or DNA techniques.

Entities:  

Mesh：

Substances：

Year:  2022        PMID： 35679267      PMCID： PMC9200221          DOI： 10.1371/journal.pone.0268680

Source DB:  PubMed          Journal:  PLoS One        ISSN： 1932-6203            Impact factor:   3.752


Introduction

Common name sharing among herbal species can cause confusion during herbal medicine preparation, leading to less efficient treatment and undesirable effects due to improper therapeutic potential. In Thailand, the traditional herbal formula used for pain relief is called “ยาผสมโคคลาน” in Thai or “Ya Pa Som Kho-Khlan (YPSKK)”, which is officially recorded in the National List of Essential Medicines (NLEM), an official national standard compendium. According to the NLEM, YPSKK is a mixed herbal formula consisting of Mallotus repandus (Willd.) Müll. and three other species, Elephantopus scaber L., Aegle marmelos (L.) Corrêa and Rhinacanthus nasutus (L.) Kurz [1-3]. M. repandus (Euphorbiaceae) shares the common name “Kho-Khlan” with Croton caudatus Gleiseler (Euphorbiaceae) and Anamirta cocculus (L.) Wight & Arn (Menispermaceae) (Fig 1). However, only M. repandus (Fig 1A) is an official plant species in NLEM.
Fig 1

Samples used in this study.

(A) Authentic plant species: Anamirta cocculus (L.) Wight & Arn, Croton caudatus Geiseler and Mallotus repandus (Rottler) Müll. Arg., (B) purchased crude drug samples called Kho-Khlan: CD1-CD6, and (C) commercial YPSKK formula.

Samples used in this study.

(A) Authentic plant species: Anamirta cocculus (L.) Wight & Arn, Croton caudatus Geiseler and Mallotus repandus (Rottler) Müll. Arg., (B) purchased crude drug samples called Kho-Khlan: CD1-CD6, and (C) commercial YPSKK formula. The stem of M. repandus has long been used for the relief of muscle pain in Thai traditional medicine [2]. C. caudatus is administered for headaches, visceral pain, rheumatism, fever, and constipation [4-6]. The crude extract of C. caudatus seeds can protect against mosquito larvae [7]. A. cocculus is used in the treatment of blood stasis and fever, stimulates the central nervous system [8] and is recorded as a restorative medical herb in the southern region of Thailand [9]. However, a previous report showed that C. caudatus causes irritation and allergic responses [10], while A. cocculus contains very strong neurotoxin compounds that affect the central nervous system (CNS) of vertebrates, such as picrotoxin, picrotin, methyl picrotoxate, dihydroxypicrotoxinin, picrotoxic acid and a sesquiterpene mixture of picrotoxinin [11-13]. Seeds of A. cocculus are also used to eliminate unwanted wild fish in aquaculture ponds and to kill birds [14]. Consuming A. cocculus berries causes extensive brain hemorrhage in cattle, while small amounts of A. cocculus are highly toxic and fatal if consumed by humans [11,13]. Although the substances in A. cocculus are harmful, the herb is still utilized in Thai traditional medicine due to the belief that a very small dose of toxic substances can be neutralized by other compounds in the herbal formula [15]. The stem of M. repandus is used for the YPSKK formula. Crude drugs of M. repandus are commercially provided in both powdered form and small pieces of stem, which are challenging for species differentiation (Fig 1B and 1C). Although raw materials of herbal medicine can be examined by simple organoleptic methods and macroscopic and microscopic methods, experienced personnel for taxonomic examination are required [16]. Thin-layer chromatography (TLC) and high-performance TLC (HPTLC), which are recommended in the herbal pharmacopoeias of many countries, including Thailand, are reliable methods for phytochemical constituent examination; however, the methods require a target compound as a standard reference [17,18]. HPTLC, a sophisticated form of TLC, provides good separation efficiency due to the higher quality of its separation plate. HPTLC exhibits higher accuracy, reproducibility, and ability to document the results than TLC [18]. Therefore, this method has been used to determine the phytochemical profile of herbal species. However, uncertain results may occur due to environmental factors that affect the chemical composition of herbal species and biological activities of the substances [19]. In recent years, a molecular approach called the DNA barcoding technique has gained demand in species identification because it is an accurate, cost-effective and reliable tool for species identification. The DNA barcoding method provides species-level information, and small amounts of samples are needed for the identification process [19]. Currently, DNA barcoding coupled with high-resolution melting (Bar-HRM) analysis has gained attention for its rapid identification of herbal species such as Vaccinium myrtillus L. [20], Mitragyna speciosa Korth [21] and Ardisia gigantifolia Stapf [22]. Bar-HRM, a sequencing-free method, detects signal alterations during the dissociation of double-stranded DNA generated from the PCR into single-stranded DNA. Each plant species can be differentiated by their individual melting temperature (Tm), which is correlated to their nucleotide sequences in the target region [23]. Bar-HRM analysis is a fast, cost-effective and reliable method; moreover, a small amount of sample is required for species identification. However, Bar-HRM primer design is challenging when the target sequence has high variation rates across the target amplicon, and Bar-HRM analysis is limited when low-quality DNA templates are used [24]. As mentioned above, each identification method has advantages and limitations; therefore, an integrative approach is proposed to differentiate substitutions or adulterants of herbal species [19,25]. Combined phytochemical profiles and DNA information can be applied to prevent the use of incorrect herbal species and support the quality of herbal materials to meet international standards [19]. In this study, we aimed to utilize HPTLC and Bar-HRM analysis to differentiate a pain relief herb, M. repandus, from C. caudatus and A. cocculus, which share the common name Kho-Khlan. Combined approaches were used to create a simple and rapid identification method for the quality control of the Kho-Khlan raw material in the herbal industry.

Materials and methods

Plant materials

Fresh leaves and stems of A. cocculus (n = 8), C. caudatus (n = 8) and M. repandus (n = 8) were collected from various locations across Thailand (Table 1). These collections are legally permitted. The plant samples were identified by a taxonomist, Associate Professor Chaiyo Chaichantipyuth, at the Department of Pharmacognosy and Pharmaceutical Botany of Chulalongkorn University. All voucher specimens were deposited at the Center of Excellence in DNA Barcoding of Thai Medicinal Plants, Chulalongkorn University, Thailand. Six commercial crude drugs claiming to be Kho-Khlan were purchased from local stores in Thailand. The three plant ingredients, E. scaber, A. marmelos and R. nasutus, in YPSKK were purchased from local dispensaries. All experiments were performed in accordance with relevant guidelines and regulations.
Table 1

Samples used in this study along with their DNA barcode locus accession numbers in GenBank.

Crude drugs claiming to be Kho-Khlan purchased from local markets and laboratory-made formulae are listed.

Plant speciesVoucher numberCollection locationAccession number
ITSmatKrbcLpsbA-trnH
Authentic species
Anamirta cocculus (L.) Wight & ArnSS-579BangkokLC506294LC506295LC506296LC506297
SS-583NakhonnayokLC506306LC506307LC506308LC506309
SS-587ChanthaburiLC506318LC506319LC506320LC506321
SS-622ChanthaburiLC506330LC506331LC506332LC506333
SS-706NakhonnayokLC506342LC506343LC506344LC506345
SS-707NakhonnayokLC506354LC506355LC506356LC506357
SS-711BangkokLC506366LC506367LC506368LC506369
SS-712BangkokLC506378LC506379LC506380LC506381
Croton caudatus GleiselerSS-537BangkokLC506286LC506287LC506288LC506289
SS-588NonthaburiLC506298LC506299LC506300LC506301
SS-589UbonratchathaniLC506310LC506311LC506312LC506313
SS-628BangkokLC506322LC506323LC506324LC506325
SS-715NonthaburiLC506334LC506335LC506336LC506337
SS-716PrachinburiLC506346LC506347LC506348LC506349
SS-717PrachinburiLC506358LC506359LC506360LC506361
SS-718BangkokLC506370LC506371LC506372LC506373
Mallotus repandus Müll. Arg.SS-538BangkokLC506290LC506291LC506292LC506293
SS-590RatchaburiLC506302LC506303LC506304LC506305
SS-667BangkokLC506314LC506315LC506316LC506317
SS-708YasothonLC506326LC506327LC506328LC506329
SS-709YasothonLC506338LC506339LC506340LC506341
SS-710PrachinburiLC506350LC506351LC506352LC506353
SS-713UbonratchathaniLC506362LC506363LC506364LC506365
SS-714NakhonnayokLC506374LC506375LC506376LC506377
Crude drugs
Crude drug 1 (CD1)SS-777Bangkok----
Crude drug 2 (CD2)SS-778Ubonratchathani----
Crude drug 3 (CD3)SS-779Bangkok----
Crude drug 4 (CD4)SS-780Bangkok----
Crude drug 5 (CD5)SS-781Yasothon----
Crude drug 6 (CD6)SS-782Nakhonnayok
Herbal formulae
A. cocculus-containing formula (F-A)SS-783Bangkok----
C. caudatus-containing formula (F-C)SS-784Bangkok----
M. repandus-containing formula (F-M)SS-785Bangkok----
Mixed formula of A. cocculus, C. caudatus and M. repandus (F-ACM)SS-786Bangkok----

Samples used in this study along with their DNA barcode locus accession numbers in GenBank.

Crude drugs claiming to be Kho-Khlan purchased from local markets and laboratory-made formulae are listed.

Preparation of herbal mixture samples and laboratory-made YPSKK formulae

Mixtures of (i) A. cocculus and C. caudatus, (ii) A. cocculus and M. repandus, and (iii) C. cocculus and M. repandus were prepared. Briefly, 100 g of A. cocculus, C. caudatus and M. repandus stems were weighed and ground into fine powders. The powder from each species was mixed in different proportions as follows: 10:90, 25:75 and 50:50 (w/w). A three-species mixture of A. cocculus, C. caudatus, and M. repandus (iv) was also made at a mixing ratio of 1:1:1. Laboratory-made YPSKK formulae were created according to the plant species listed in the NLEM of Thailand. The ingredient-based powder was prepared by mixing equal amounts of E. scaber, A. marmelos and R. nasutus (mixing ratio 1:1:1). Then, 3 g of base powder was combined with 1 g of A. cocculus (A), C. caudatus (C) and M. repandus (M) powders to create an A. cocculus-containing formula (F-A), a C. caudatus-containing formula (F-C) and a M. repandus-containing formula (F-M), respectively. One gram of mixed Kho-Khlan plants, including A. cocculus, C. caudatus and M. repandus, was combined with 3 g of base powder to generate a three-plant mixture (F-ACM).

HPTLC profiles

To obtain the phytochemical profiles of selected samples, including A. cocculus (SS-628), C. caudatus (SS-537) and M. repandus (SS-583), 1 g of dried stems from each species was crushed into a fine powder using a M 20 Universal mill grinder (IKA, Germany). Phytochemical constituents were extracted in ethanol (1:20, w/v) at room temperature. The solution was mixed with a vortex mixer for 30 s and subsequently incubated in an ultrasonic bath for 15 min at room temperature. The supernatant was collected after centrifugation at 10,000 rpm for 10 min at 25°C. Then, 5 μl of the extracted solution was spotted onto an HPTLC plate (20×10 cm, Silica gel 60 F254, Merck, Germany) using an Automatic TLC Sampler 4 (AST4, CAMAG, Muttenz, Switzerland). Each individual band was 8 mm in length, the distance between tracks was 2 mm, and the track distance was 11.4 mm from the lower edge of the plate. The distance from the left side was 16 mm, and the distance from the lower edge was 20 mm. Toluene:acetone:formic acid (5:4:0.5, v/v/v) was used as the mobile phase. The chamber was saturated with 20 ml of mobile phase for 20 min before development. HPTLC plate visualization was performed under ultraviolet light at short and long wavelengths of 254 nm and 366 nm, respectively. The HPTLC method was applied to test commercial Kho-Khlan crude drugs and the laboratory-made YPSKK formulae. The extraction protocol and HPTLC method were as previously mentioned.

Genomic DNA extraction

Genomic DNA from leaves of the samples, the purchased crude drugs, mixed herbal powder and laboratory-made YPSKK formulae were extracted using a DNeasy Plant Mini Kit (Qiagen, Germany) and further purified using a GENECLEAN Kit (MP Biomedicals, USA) according to the manufacturer’s protocol. DNA quantity and quality were determined using a NanoDrop One UV–Vis Spectrophotometer (Thermo Scientific, USA) and agarose gel electrophoresis, respectively. Genomic DNA was run on 0.8% (w/v) agarose in 1X TAE gel containing 1X RedSafe nucleic acid staining solution (iNtRON Biotechnology, USA) at 100 V for 30 min. Agarose gel was analyzed with a UVP GelSolo (Analytik Jena GmbH, Germany) gel documentation system, and images were taken by onboard VisionWorks software (Analytik Jena GmbH, Germany). Genomic DNA was stored at -20°C for further use.

DNA barcoding of A. cocculus, C. caudatus and M. repandus

Genomic DNA from the leaves of A. cocculus, C. caudatus and M. repandus was used as a DNA template for DNA barcode generation. The following DNA barcode regions were amplified by the primers listed in Table 2: maturase K (matK), the large subunit of ribulose-1,5-bisphosphate carboxylase/oxygenase (rbcL), the trnH-psbA intergenic spacer and the nuclear internal transcribed spacer (ITS). PCR amplification was performed in a 50 μl reaction mixture. The PCR mixture contained 1X PCR buffer with 1.5 mM MgCl2, 0.2 mM dNTP mix, 0.5 μM each forward and reverse primer and 0.5 U of Platinum Taq DNA polymerase (Invitrogen, USA). Fifty nanograms of genomic DNA was used as the DNA template. PCR was carried out in a GS-96 Gradient Touch Thermal Cycler (Hercuvan, UK) using cycling conditions of 94°C for 4 min followed by 30 cycles of 94°C for 30 sec, 57°C for 30 sec, and 72°C for 1:30 min (rbcL and matK) or 45 sec (for ITS and psbA-trnH spacer) and a final extension at 72°C for 10 min. The amplified products were determined on a 1.2% (w/v) agarose gel in 1X TAE buffer containing 1X RedSafe nucleic acid staining solution. Agarose gel analysis was performed as described above. PCR products were further sequenced by direct sequencing in both directions on an ABI 3730XL DNA analyzer using the primers listed in Table 2 and S1 Appendix. The sequencing results were analyzed by Molecular Evolutionary Genetics Analysis X (MEGA X) software version 10.1. The DNA barcode sequences were deposited in GenBank of the National Center for Biotechnology Information (NCBI) (Table 1).
Table 2

Primers for DNA barcode generation and Bar-HRM analysis.

Barcode regionPrimer namePrimer sequence (5′-3′)References
DNA barcode generation
rbcLrbcL_aF ATGTCACCACAAACAGAGACTAAAGC Levin et al., 2003
rbcL-R23 TTTTAGTAAAAGATTGGGCCG Ohi-Toma et al., 2006
matKtrnK-3914F TGGGTTGCTAACTCAATGG Johnson et al., 1994
trnK-2R AACTAGTCGGATGGAGTAG Johnson et al., 1994
matK-aF CTATATCCACTTATCTTTCAGGAGT Kato et al., 1999
matK-8R AAAGTTCTAGCACAAGAAAGTCGA Kato et al., 1999
trnH-psbApsbA_trnHF GTTATGCATGAACGTAATGCTC Sang et al., 1997
psbA-trnHR CGCGCATGGTGGATTCACAATC Sang et al., 1997
ITSITS1 TCCGTAGGTGAACCTGCGG White et al., 1990
ITS4 TCCTCCGCTTATTGATATGC White et al., 1990
Bar-HRM primers
rbcLKK-rbcL-HRM-F TTTCACTCAAGATTGGGTCTCT This study
KK-rbcL-HRM-R TCATCTCCAAAGATCTCGGTCA This study

Differentiation of M. repandus from A. cocculus and C. caudatus by Bar-HRM analysis

To design Bar-HRM primers, nucleotide sequences obtained from the four DNA barcode regions of M. repandus, A. cocculus and C. caudatus were aligned by MUSCLE with gap open = –400; gap extend = 0; clustering method = UPGMB; and Min Diag Length = 24. The rbcL region was selected to perform Bar-HRM analysis for the differentiation of M. repandus from A. cocculus and C. caudatus. Primer 3 and BLAST software were used for primer design. The Bar-HRM forward (KK-rbcL-HRM-F) and reverse primers (KK-rbcL-HRM-R) were designed based on the conserved regions of the rbcL gene of the three plants. The targeted amplicon provided a 102 bp amplicon with 9 polymorphic sites of the rbcL gene. PCR amplification was performed in a total volume of 10 μl on a CFX96 Real-time System (Bio–Rad, USA). The reaction mixture contained 10 ng of genomic DNA, 1X SsoFast EvaGreen Supermix (Bio–Rad, USA), 0.5 μM forward primer (KK-rbcL-HRM-F: 5′-TTTCACTCAAGATTGGGTCTCT—3′) and reverse primer (KK-rbcL-HRM-R: 5′-TCATCTCCAAAGATCTCGGTCA-3′). Real-time PCR conditions were as follows: initial denaturing step at 95°C for 1 min followed by 39 cycles of 95°C for 15 sec, 60°C for 15 sec, and 72°C for 15 sec. Subsequently, the PCR amplicons were denatured at 9°C for 1 min and reannealed at 60°C for 1 min to generate random DNA duplexes. Melting curves (Tm) were generated after the last extension step. The temperature was set to increase from 60°C to 95°C in 0.1°C increments, and the fluorescence intensity was collected at each increasing step. CFX Manager software (version 3.1 upgrade) and Precision Melt Analysis software (version 3.1 upgrade) were used to analyze the Tm. Normalized curves and differential melting curves were plotted. C. caudatus was set as the reference species. Reactions were performed in triplicate. Sensitivity was analyzed using genomic DNA at different concentrations: 10×10−9, 1×10−9, 0.1×10−9, 0.01×10−9 and 0.001×10−9 g.

Bar-HRM analysis of purchased crude drugs, plant mixtures and laboratory-made YPSKK formulae

The Bar-HRM method was applied to test the authenticity of the six commercial crude drugs claiming to be Kho-Khlan. The method was conducted to identify herbal species within plant mixtures and four laboratory-made YPSKK formulae. The Bar-HRM reaction and conditions were as mentioned above. The Bar-HRM analysis parameters were set as described earlier. All reactions were performed in triplicate.

Results

Species-specific patterns of HPTLC

HPTLC profiles from ethanolic extracts of A. cocculus, C. caudatus and M. repandus were obtained. Species-specific bands were obtained from authentic A. cocculus (Rf = 0.22), C. caudatus (Rf = 0.02 and 0.60) and M. repandus species (Rf = 0.08, 0.26, 0.68 and 0.72). The HPTLC profiles of six crude drugs claiming to be Kho-Khlan were compared to those of authentic plants. In general, the HPTLC patterns among CD2-CD6 were similar. A bright blue band at Rf = 0.72 for M. repandus was found in CD2-CD6. The blue band at Rf = 0.08 was present in CD2-CD6, while the band at Rf = 0.26 was present in CD2-CD6. The crude drug CD1 showed an ambiguous HPTLC pattern with a faint band at Rf = 0.02. No distinct bands of A. cocculus (Rf = 0.22) or C. caudatus (Rf = 0.60) were detected in any of the crude drug samples (Fig 2).
Fig 2

High-performance thin-layer chromatography (HPTLC) chromatogram of ethanolic extracts under UV at 366 nm.

Track 1: A. cocculus, track 2: C. caudatus, track 3: M. repandus, tracks 4–9: Crude drugs CD1-CD6. A toluene:acetone:formic acid mixture (5:4:0.5, v/v/v) was used as the mobile phase. White arrows indicate the characteristic bands of each authentic plant species.

High-performance thin-layer chromatography (HPTLC) chromatogram of ethanolic extracts under UV at 366 nm.

Track 1: A. cocculus, track 2: C. caudatus, track 3: M. repandus, tracks 4–9: Crude drugs CD1-CD6. A toluene:acetone:formic acid mixture (5:4:0.5, v/v/v) was used as the mobile phase. White arrows indicate the characteristic bands of each authentic plant species.

HPTLC profiles of plant species in the YPSKK formulae

HPTLC bands unique to A. cocculus (Rf = 0.22), C. caudatus (Rf = 0.60) and M. repandus (Rf = 0.72) were found in F-A, F-C and F-M, respectively. In the F-ACM formula, species-specific bands of A. cocculus (Rf = 0.22), C. caudatus (Rf = 0.02 and 0.60) and M. repandus (Rf = 0.08, 0.68 and 0.72) were detected. Other species-specific bands of M. repandus (Rf = 0.26) did not appear in the laboratory-made formulae (Fig 3).
Fig 3

HPTLC chromatograms of ethanolic extracts of authentic species and four laboratory-made YPSKK formulae under UV at 366 nm.

Track 1: A. cocculus, track 2: C. caudatus, track 3: M. repandus, tracks 4–5: F-A, tracks 6–7: F-C, tracks 8–9: F-M and tracks 10–11: F-ACM. A toluene:acetone:formic acid (5:4:0.5, v/v/v) mixture was used as the mobile phase. White arrows indicate the characteristic bands of each plant species.

HPTLC chromatograms of ethanolic extracts of authentic species and four laboratory-made YPSKK formulae under UV at 366 nm.

Track 1: A. cocculus, track 2: C. caudatus, track 3: M. repandus, tracks 4–5: F-A, tracks 6–7: F-C, tracks 8–9: F-M and tracks 10–11: F-ACM. A toluene:acetone:formic acid (5:4:0.5, v/v/v) mixture was used as the mobile phase. White arrows indicate the characteristic bands of each plant species.

Establishment of the four core DNA barcode regions

Core DNA barcode regions, including matK, rbcL, the psbA-trnH intergenic spacer and the ITS of A. cocculus, C. caudatus and M. repandus, were successfully amplified and sequenced. Full-length nucleotide sequences were obtained and submitted to GenBank (Table 1). Plant species collected from different locations exhibited identical nucleotide sequences in each DNA barcode region. The lengths of the rbcL, matK, ITS and psbA-trnH intergenic spacer regions were 1428, 1521–1536, 548–635 and 445–783 bp, respectively. Sequence length, GC content (%) and the percentage of variable nucleotide sites varied among the three species. In terms of nucleotide variation, the four DNA barcodes were ranked as follows: ITS (48.71%) > psbA-trnH intergenic spacer (38.27%) > rbcL (37.17%) and matK (23.15%) (Table 3). Nucleotide alignment results for the three species revealed insertions-deletions (indels) within the matK, ITS and psbA-trnH intergenic spacer regions (S2 Appendix).
Table 3

Sequence analysis of core DNA barcode regions of A. cocculus, C. caudatus and M. repandus.

RegionSpeciesProperties
Length (bp)GC content (%)Variability (%)
ITSA. cocculus54856.2048.71
C. caudatus62656.23
M. repandus63560.00
matKA. cocculus153633.3023.15
C. caudatus152130.97
M. repandus152130.37
rbcLA. cocculus142844.6837.17
C. caudatus142843.63
M. repandus142843.42
psbA-trnHA. cocculus64029.5338.27
C. caudatus44525.62
M. repandus78321.97
To conduct the PCR-Bar-HRM analysis, PCR amplification of the rbcL gene using Bar-HRM primers encompassing nine nucleotide polymorphic sites was performed in M. repandus, A. cocculus and C. caudatus. A 102 bp PCR amplicon (positions 1,089–1,191) was obtained from all three plant species (Fig 4). HRM analysis was performed to determine the melting temperatures (Tm) of each amplicon generated from Bar-HRM primers (Fig 5). Three distinct categories of melting curve profiles, -d(RFU)/dT (Fig 5A), normalized RFU (Fig 5B) and different RFU (Fig 5C), were clearly detected among the three plants. The Tm values of A. cocculus, C. caudatus and M. repandus were 82.03 ± 0.09°C, 80.93 ± 0.04°C and 80.05 ± 0.07°C, respectively (Table 4). Gold-standard Sanger sequencing of PCR amplicons and blast analysis confirmed the original species of each amplicon. Similar melting profiles among different DNA concentrations (10×10−9, 1×10−9, 0.1×10−9 and 0.01×10−9 g) were revealed for M. repandus. The melting curves displayed small changes and isolated clusters at concentrations of 0.001×10−9 and 0.0001×10−9 g when analyzed using Precision Melt Analysis software (S3 Appendix).
Fig 4

Illustration of the rbcL target region for Bar-HRM analysis on the alignment of A. cocculus, C. caudatus and M. repandus with nucleotide polymorphic sites.

Blue arrows present forward primers (KK-rbcL-HRM-F) and reverse primers (KK-rbcL-HRM-R) with their directions. Consensus sequences are indicated with dots. The altered bases indicate sequence differences.

Fig 5

High-resolution melting analysis using Bar-HRM primers targeting the (A) Melting curve plot presenting the melting temperature (Tm), (B) normalized plot and (C) difference plot.

Table 4

Bar-HRM analysis showing the Tm (°C) of authentic plant species and purchased crude drug samples.

SamplesTm (°C)Claimed speciesDetected species
Authentic species
A. cocculus82.03±0.09-A. cocculus
C. caudatus80.93±0.04-C. caudatus
M. repandus80.05±0.07-M. repandus
Crude drug samples
CD180.84±0.06M. repandusC. caudatus
CD279.90±0.07M. repandusM. repandus
CD379.93±0.04M. repandusM. repandus
CD479.93±0.04M. repandusM. repandus
CD580.00±0.04M. repandusM. repandus
CD679.90±0.07M. repandusM. repandus

Illustration of the rbcL target region for Bar-HRM analysis on the alignment of A. cocculus, C. caudatus and M. repandus with nucleotide polymorphic sites.

Blue arrows present forward primers (KK-rbcL-HRM-F) and reverse primers (KK-rbcL-HRM-R) with their directions. Consensus sequences are indicated with dots. The altered bases indicate sequence differences. High-resolution melting analysis using Bar-HRM primers targeting the (A) Melting curve plot presenting the melting temperature (Tm), (B) normalized plot and (C) difference plot.

Application of Bar-HRM for the identification of herbal materials

Six crude drugs (CD1-CD6) were investigated to identify their botanical species. CD1 exhibited a melting temperature of 80.84±0.06°C, which matched that of C. caudatus. CD2-CD6 showed melting temperatures in the range of 79.90–80.00°C and were identified as M. repandus (Table 4). Distinct curve patterns for each mixture sample were obtained by Bar-HRM analysis (Fig 6). Difference plots of the two-species mixtures with various mixing ratios clearly separated the mixtures from the authentic species (Fig 6A–6D). Moreover, the three-species mixture sample was separated from the two-species mixtures in the difference plot (Fig 6E). Among the four laboratory-made YPSKK formulae, Bar-HRM analysis revealed overlapping patterns of difference plots from F-A, F-M, F-C and F-ACM, which made Bar-HRM unable to identify the species in the herbal formulae. In the laboratory-made YPSKK without any Kho-Khlan plants, Bar-HRM analysis showed different plots compared to those of F-A, F-M, F-C and F-ACM (Fig 6F).
Fig 6

Difference plots of samples obtained by Bar-HRM.

(A) Purchased Kho-Khlan crude drugs, (B) A. cocculus and C. caudatus mixture, (C) A. cocculus and M. repandus mixture, (D) C. caudatus and M. repandus mixture, (E) mixture of two and three species at equal amounts, and (F) laboratory-made YPSKK formulae. Mixture ratios are indicated. Authentic A. cocculus, C. caudatus and M. repandus are included.

Difference plots of samples obtained by Bar-HRM.

(A) Purchased Kho-Khlan crude drugs, (B) A. cocculus and C. caudatus mixture, (C) A. cocculus and M. repandus mixture, (D) C. caudatus and M. repandus mixture, (E) mixture of two and three species at equal amounts, and (F) laboratory-made YPSKK formulae. Mixture ratios are indicated. Authentic A. cocculus, C. caudatus and M. repandus are included.

Discussion

Confusion of herbal materials due to the same vernacular name may impact consumer safety and treatment efficiency. Numerous reports have identified problems with the name used for medicinal plants. For example, Pueraria candollei Wall. ex Benth., Butea superba Roxb. ex Willd. and Mucuna collettii Lace are all called “Kwao Khruea” in Thai. However, misidentification of the Kwao Khruea species may lead to undesirable effects because the species have different properties [26]. Two popular vegetables, Melientha suavis Pierre and Sauropus androgynus (L.) Merr. share a common name, “Phak Wan”, with the poisonous species Urobotrya siamensis Hiepko [24]. Unintentional consumption of U. siamensis resulted in comas and deaths in 2005 [27]. Recently, a number of reports have been published on the successful application of Bar-HRM and HPTLC analysis for the identification of related and nonclosely related species in herbal medicines. In 2018, Dual et al. applied the Bar-HRM method to identify Rhizoma Paridis and its common adulterants [28]. Acanthus ebracteatus Vahl, Andrographis paniculate (Burm.f.) Nees and Rhinacanthus nasutus (L.) Kurz were successfully discriminated by Bar-HRM analysis [29]. Moreover, Bar-HRM was applied to differentiate the poisonous plant U. siamensis from the edible vegetables M. suavis and S. androgynus for consumer safety purposes [24]. The HPTLC fingerprint revealed different phytochemical profiles between two nonrelated species, Cyanthillium cinereum (L.) H. Rob. (a smoking cessation herb) and its adulterant, Emilia sonchifolia (L.) DC [19]. Combining HPTLC with the DNA barcode technique was previously reported for the identification of herbal raw materials such as Aristolochia species [30]. Confusion in the use of C. caudatus or A. cocculus instead of M. repandus in a pain relief formula, YPSKK, would lead to treatment failure and impact consumer safety. Therefore, the HPTLC method as a phytochemical fingerprint was used for the differentiation of Kho-Khlan (M. repandus) from C. caudatus and A. cocculus. Application of the HPTLC fingerprinting method for testing the purchased Kho-Khlan crude drugs revealed that the chemical constituents varied among samples, although equal amounts of plant materials were used in this study. Variation in chemical composition may be influenced by environmental factors such as growth conditions, collection location, the plant part used and plant age [31]. Although the HPTLC profiles of M. repandus, C. caudatus and A. cocculus fluctuated, some HPTLC bands specific to each species were observed in the polyherbal mixture samples. This result validates the performance of the HPTLC technique for the identification of multiherbal formulae. This result agrees with reports showing that the HPTLC method is able to identify species within herbal formulae, such as an Iranian traditional medicine formula called “Zemad” and a multiherbal ingredient formula called “Gegen Qinlian decoction” [32,33]. Bar-HRM analysis is a versatile, sequencing-free and reliable method. The assay has proven accurate in the rapid identification of species in diverse research fields, for instance, herbal medicine and their commercial products [34], medicines [35] and food science [36]. However, the suitable location for Bar-HRM primers should be carefully considered. From the DNA barcode sequence analysis results, the ITS region exhibited a higher percentage of nucleotide variation than the other candidate regions, which resulted in high variation and rendered the ITS a worse choice for Bar-HRM primers, similar to the results for the psbA-trnH intergenic spacer region. The matK gene has been reported to have high discrimination power for species identification [24]. In our study, however, nucleotide sequences in the matK gene of the three plants from different genera were variable and caused this region to be unsuitable for designing Bar-HRM primers. Since the gene sequences in the rbcL regions of A. cocculus, C. caudatus and M. repandus possess two conserved sites flanking nine nucleotide polymorphism sites, this region is suitable for the design of Bar-HRM primers. The rbcL region was chosen as a targeted amplified region for Bar-HRM analysis. The nucleotide variation within 102 bp of PCR amplicons amplified from the three species resulted in different melting temperatures when analyzed by the Bar-HRM approach. An amplicon of 102 bp is in the range of desired amplicon lengths for the Bar-HRM analysis (<300 bp) suggested by Osathanunkul et al., 2015 [25]. The melting temperature obtained by Bar-HRM analysis remained unchanged in the fourth round of DNA template dilution (S3 Appendix). This finding was consistent with previous works on the stability of HRM results showing that the melting temperature did not vary within four logarithms of the initial concentration [23,37]. Moreover, the use of the rbcL region for species differentiation at the genus level has been revealed [38]. These results support our conclusion on the reliability of the rbcL region as a potential DNA barcode marker for discrimination of the nonrelated species that belong to different genera, A. cocculus, C. caudatus and M. repandus. The results from Bar-HRM analysis were obtained within 3.5 h, which shortened the detection time compared to that of Sanger sequencing, the gold standard. Application of Bar-HRM analysis for testing claimed Kho-Khlan crude drugs (CD1-CD6) revealed that five (CD2, 3, 4, 5 and 6) out of six crude drugs were M. repandus, the correct species for preparing YPSKK formulae, which was confirmed by sequencing data (S1 Fig). Although the crude drug CD1 exhibited an ambiguous phytochemical pattern in the HPTLC assay, Bar-HRM analysis yielded a Tm of 80.84±0.06°C, indicating that it was C. caudatus, not M. repandus, as claimed. This suggested that Bar-HRM and HPTLC can complement each other to distinguish C. caudatus and M. repandus when uncertainty in phytochemical constituents is observed. Bar-HRM analysis using genetic information can be used to clarify the ambiguous result, as the genetic information is stable. The poison species A. cocculus was fortunately not detected in any crude drugs. The detection of C. caudatus implies that drugs with incorrect species labels are sold on the market; therefore, more attention should be given to quality control in terms of the identification of Kho-Khlan crude drugs. In the present study, Bar-HRM analysis revealed the specificity of normalized and difference plots to DNA ratios of two- and three-species mixtures, which should be further developed for quantitative detection in the future. However, Bar-HRM may be limited for the identification of polyherbal formulae; therefore, more sensitive DNA methods, such as next-generation sequencing (NGS), could be applied. Taken together, this work suggests that Bar-HRM is a practical approach for the identification of raw materials and can complement the HPTLC method when phytochemical profiles exhibit unclear results and vice versa.

Conclusion

YPSKK is a multiherbal formula for pain relief treatment in the NLEM of Thailand. The main ingredient, M. repandus, shares the vernacular name Kho-Khlan with C. cocculus and M. caudatus. This can cause confusion in terms of usage and may have serious effects via either toxicity or unsuccessful treatment. The present study established a combined Bar-HRM and HPTLC technique for identifying the correct Kho-Khlan species, M. repandus. This method was successfully applied to identify crude drugs and multiherbal mixed formulae and serves as a quality control tool for preventing accidental confusion of herbal species sharing the same common name. The DNA and chemical signatures of M. repandus obtained here can help manufacturers increase the quality control of M. repandus raw material in commercialized pain relief products.

Confirmation of CD3 (M. repandus) by sequencing of PCR amplicons after Bar-HRM analysis.

(A) DNA alignment of the CD3 sequence with sequences of authentic A. cocculus, C. caudatus and M. repandus, (B) electropherogram showing the partial sequence obtained from the Bar-HRM amplicon. The red box presents identical nucleotide sequences among the authentic M. repandus sequence and CD3 sequence. The green box shows the same area of nucleotide alignment and electropherogram. “⋅” indicates an identical nucleotide sequence. “-” indicates no electropherogram result. (PDF) Click here for additional data file.

Additional primers used for DNA barcode generation in this study.

(PDF) Click here for additional data file.

Sequence alignment of four core DNA barcode regions among A. cocculus, C. caudatus and M. repandus.

(PDF) Click here for additional data file.

Melting temperatures of PCR amplicons and cluster groups generated by various DNA concentrations.

(PDF) Click here for additional data file. (PDF) Click here for additional data file. 7 Mar 2022
PONE-D-22-00460
Combining DNA and HPTLC profiles to differentiate a pain relief herb, Mallotus repandus, from plants sharing the same common name (“Kho-Khlan”), Anamirta cocculus and Croton caudatus
PLOS ONE Dear Dr. Sukrong, Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process. Introduction should be more focused. Additional clarification related to material and methodology used are needed. Table 2 should be reorganized as suggested by Reviewer #1. In Figure 3 some data are missing. The authors should considerably widen the Discussion section towards providing scientific and empirical justification of the presented methodologies for non-closely related species. The manuscript would greatly benefit if being proofread by a native English speaker. Please submit your revised manuscript by Apr 21 2022 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. Please include the following items when submitting your revised manuscript:
A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'. If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter. If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols. We look forward to receiving your revised manuscript. Kind regards, Branislav T. Šiler, Ph.D. Academic Editor PLOS ONE Journal Requirements: 1. When submitting your revision, we need you to address these additional requirements. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf 2. Thank you for stating in your Funding Statement: (This research was supported by the Ratchadapisek Somphot Fund for Posdoctoral Fellowship, Chulalongkorn University. The authors are grateful to Professor Chaiyo Chaichantippayut for species identification. We thank the Faculty of Pharmaceutical Sciences, Chulalongkorn University, for providing facilities.) Please provide an amended statement that declares *all* the funding or sources of support (whether external or internal to your organization) received during this study, as detailed online in our guide for authors at http://journals.plos.org/plosone/s/submit-now.  Please also include the statement “There was no additional external funding received for this study.” in your updated Funding Statement. Please include your amended Funding Statement within your cover letter. We will change the online submission form on your behalf. 3. Thank you for stating the following in the Acknowledgments Section of your manuscript: (This research was supported by the Ratchadapisek Somphot Fund for Posdoctoral Fellowship, Chulalongkorn University. The authors are grateful to Professor Chaiyo Chaichantippayut for species identification. We thank the Faculty of Pharmaceutical Sciences, Chulalongkorn University, for providing facilities.) We note that you have provided funding information that is not currently declared in your Funding Statement. However, funding information should not appear in the Acknowledgments section or other areas of your manuscript. We will only publish funding information present in the Funding Statement section of the online submission form. Please remove any funding-related text from the manuscript and let us know how you would like to update your Funding Statement. Currently, your Funding Statement reads as follows: (The authors have declared that no competing interests exist.) Please include your amended statements within your cover letter; we will change the online submission form on your behalf." 4. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels. In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions. Additional Editor Comments: Introduction should be more focused. Additional clarification related to material and methodology used are needed. Table 2 should be reorganized as suggested by Reviewer #1. In Figure 3 some data are missing. The authors should considerably widen the Discussion section towards providing scientific and empirical justification of the presented methodologies for non-closely related species. The manuscript would greatly benefit if being proofread by a native English speaker. [Note: HTML markup is below. Please do not edit.] Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Partly Reviewer #2: Yes ********** 2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: No Reviewer #2: Yes ********** 3. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes Reviewer #2: Yes ********** 4. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: No Reviewer #2: Yes ********** 5. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: The research article entitled “Combining DNA and HPTLC profiles to differentiate a pain relief herb, Mallotus repandus, from plants sharing the same common name (“Kho-Khlan”), Anamirta cocculus and Croton caudatus” highlights the use of HPTLC and BAR-HRM to distinguish the study plants. The study is potentially interesting, it has to be improved a lot before it is suitable for publication. Comments • One of the foremost concerns is that though the article is well written, still the proficiency of English is lacking in the article and it needs to improved. • Introduction (line 93-94): “Phytochemical composition may be uncertain due to environmental factors”. What authors would like to convey by making such statements in the introduction? This sentence is presented out of nowhere in introduction. • Line 101: What are those benefits and limitations of BAR-HRM, and what are the benefits of using integrative approach for identification of plants? • The introduction lacks a coherence, and authors failed to showcase why they wanted to use HPTLC and BAR-HRM in their study, why not simple TLC or other chromatographic methods to distinguish the study species. • Methodology: Authors failed to provide the details of herbarium voucher specimen details for the study species?. Also, authors state that fresh leaves were collected, however, they used stem samples for HPTLC analysis? Therefore, authors needs to specify the source of such stem samples used in HPTLC. • Line 143: Crushed? How did the authors crushed the dried stem samples? • Line 147: sprayed or spotted? • Line 150: Authors state that the track distance is 11.4 mm, however they did not indicate whether it is from lower edge of the plate or from the sample spot? • Table 2: It is confusing to see these primer pairs and sequence in table 2. Authors indicate in few primers as “This study”, then what is the purpose of providing other primer pair details in table 2? Also, ““This study”, is not indicated in ITS and psbA-trnH primer pairs. Authors should clarify and include only the primer pairs used in the study, also if they used more than one primer pair to amplify one particular barcode region, it should be included in discussion part. • Authors failed to provide the details of primer design and the tools used to design for the BAR-HRM primer “KK-rbcL-HRM-F” and “KK-rbcL-HRM-R” • Authors can really shorten the DNA extraction part and PCR amplification part in the methodology section • One of my concern with the DNA barcoding and BAR-HRM in this study is, authors have not used any closely related plant groups as control or to highlight that BAR-HRM can distinguish closely related species. It is obvious and no surprise that the study plants belong to Euphorbiaceae and Menispermaceae which shows enough genetic variation to be distinguished. In fact, experienced filed botanist and microscopy analysis can easily distinguish these study species, why anyone wants to use BAR-HRM to distinguish plants that belong to different families and has enough morphological variation itself. • Another concern with HPTLC is, why authors have not derivatized the HPTLC plate using any derivatizing reagents?, without derivatization, and using only 366 nm, only UV active compounds are visible and the data provided by authors are not sufficient to claim that the authors developed a HPTLC method. Reviewer #2: The present study established a combined Bar-HRM and HPTLC technique to identify the correct species, Mallotus repandus, from authentic Anamirta cocculus and Croton caudatus. This method was successfully applied to identify crude drugs and multiherbal mixed formulae and serve as a quality control tool for preventing accidental confusion of herbal species sharing the same common name. The experiment design is logical and fine. However, there are still some issues that merit authors’ attention. 1. The writing of the “Introduction” is too wordy, especially lines 59-76. Simply explain that A. cocculus and C. caudatus can't be used as substitutes of M. repandus in clinical practices. 2. The description of the existing identification methods in the second paragraph of “Introduction” is logically confused. Please rewrite. 3. Why did authors select the rbcL region for bar-HRM analysis for the differentiation of M. repandus from A. cocculus and C. caudatus? 4. I cannot find the HPTLC bands of C. caudatus (Rf = 0.55) in tracks 6-7 in figure 3. Besides, the enlarged image on the right in Figure 3 should have a scale. 5. This study showed that compared with A. cocculus, species C. caudatus and M. repandus were more difficult to distinguish. It is suggested that authors add some discussion to elaborate on how the two methods, Bar-HRM and HPTLC, complement each other to distinguish the three species, especially the distinction between C. caudatus and M. repandus. ********** 6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: Yes: Seethapathy Gopalakrishnan Saroja Reviewer #2: No [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step. 22 Apr 2022 We appreciate the editor and the reviewers for the constructive comments. Each comment has been carefully considered point by point and responded. Responses to the reviewers and changes in the revised manuscript are as following: A point-by-point response to the comments Editor comments Comment 1: Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process. Response: Thank you editor for providing us a change to improve the manuscript. You encouraged us to revise as best as we can to make the manuscript high quality to publish in PLOS ONE. Comment 2: Introduction should be more focused. Response: The introduction section was revised to be more focused as suggestion from editor and reviewer #1 and #2. Please read our responses to “Comment 4 of the reviewer #1” and “Comment 1 of the reviewer #2”. Comment 3: Additional clarification related to material and methodology used are needed. Response: The manuscript has been revised. Additional clarification related to material and methodology used in the study has been added in the “Introduction” and “Materials and Methods” sections. “Introduction” Section Line 84-97 and Line 100-113 were added to the Introduction Section to provide more information to the HPTLC and Bar-HRM methods, respectively, as following: Line 84-97 of the revised manuscript: “Thin-layer chromatography (TLC) and high-performance TLC (HPTLC), which are recommended in the herbal pharmacopoeias of many countries, including Thailand, are reliable methods for phytochemical constituent examination; however, the methods require a target compound as a standard reference [17, 18]. HPTLC, a sophisticated form of TLC, provides good separation efficiency due to the higher quality of its separation plate. HPTLC exhibits higher accuracy, reproducibility, and ability to document the results than TLC [18]. Therefore, this method has been used to determine the phytochemical profile of herbal species. However, uncertain results may occur due to environmental factors that affect the chemical composition of herbal species and biological activities of the substances [19]. In recent years, a molecular approach called the DNA barcoding technique has gained demand in species identification because it is an accurate, cost-effective and reliable tool for species identification. The DNA barcoding method provides species-level information, and small amounts of samples are needed for the identification process [19].” Line 100-113 of the revised manuscript: Bar-HRM, a sequencing free method, detects signal alteration during the dissociation of double-stranded DNA into single stranded DNA. Each plant species can be differentiated by their individual melting temperature (Tm) which correlated to their nucleotide sequences in the target region [23]. Bar-HRM analysis exhibits fast, cost-effective and reliable method, moreover, small amount of sample is required for species identification. However, Bar-HRM primer design is challenging when the target sequence has high variation rates across the target amplicon and the Bar-HRM analysis has limited when low quality of DNA template is used [24]. As mentioned above, each identification method has advantages and limitations, therefore, an integrative approach is proposed to differentiate substitutions and adulterants of herbal species [19, 25]. Combined methods can be applied to prevent the use of incorrect herbal species and support the quality of herbal materials to meet international standards [19]. “Materials and Methods” Section The section has been revised. Original: Line 121-123 of the original manuscript: Fresh leaves of A. cocculus (n=8), C. caudatus (n=8) and M. repandus (n=8) were collected from various locations across Thailand for the DNA barcoding experiment (Table 1). Revision: Line 121-123 of the revised manuscript: Fresh leaves and stems of A. cocculus (n=8), C. caudatus (n=8) and M. repandus (n=8) were collected from various locations across Thailand (Table 1). These collections are legally permitted. More information was added in the revised manuscript. Line 129-130 of the revised manuscript: All experiments were performed in accordance with relevant guidelines and regulations. Comment 4: Table 2 should be reorganized as suggested by Reviewer #1. Response: Table 2 has been reorganized as suggested by Reviewer #1. Selected sequencing primers were removed to Appendix S1. Please see the "Response to Reviewers" file. Comment 5: In Figure 3 some data are missing. Response: Thank you editor for asking. The authors repeated the HPTLC experiments in order to see the missing species-specific band of C. caudatus. We adjusted the mobile phase from toluene:acetone:formic acid mixture (5:3:0.5, v/v/v) into toluene:acetone:formic acid mixture (5:4:0.5, v/v/v) . This adjustment of mobile phase system affects the Rf in the HPTLC result therefore, the HPTLC result was rewrite. The original Fig. 2 and Fig. 3 were replaced by the revised Fig. 2 and the revised Fig. 3, respectively. Please see the revised figures in the "Response to Reviewers" file. Additional rewrite after changing of mobile phase in HPTLC experiments. Line 167 of the original manuscript: Toluene:acetone:formic acid (5:-:0.5, v/v/v) was used as the mobile phase Line 167 of the revised manuscript: Toluene:acetone:formic acid (5:4:0.5, v/v/v) was used as the mobile phase. The HPTLC results were revised as following. Original sentences: Line 229-230 of the original manuscript: “Species-specific bands were obtained for authentic A. cocculus (Rf = 0.18), C. caudatus (Rf = 0.08 and 0.55) and M. repandus species (Rf = 0.05, 0.20, 0.63 and 0.68).” Line 232-237 of the original manuscript: “A bright blue band at Rf = 0.68 for M. repandus was found in CD2-CD6. The blue band at Rf = 0.05 was present in CD2-CD5, while the band at Rf = 0.20 was present in CD2 and CD3. The crude drug CD1 showed an ambiguous HPTLC pattern with a faint band at Rf = 0.08. No distinct bands of A. cocculus (Rf = 0.18) or C. caudatus (Rf = 0.55) were detected in any of the crude drug samples (Fig 2).” Revised sentences: Line 245-246 of the revised manuscript: “Species-specific bands were obtained from authentic A. cocculus (Rf = 0.22), C. caudatus (Rf = 0.02 and 0.60) and M. repandus species (Rf = 0.08, 0.26, 0.68 and 0.72).” Line 248-253 of the revised manuscript: “A bright blue band at Rf = 0.72 for M. repandus was found in CD2-CD6. The blue band at Rf = 0.08 was present in CD2-CD6, while the band at Rf = 0.26 was present in CD2-CD6. The crude drug CD1 showed an ambiguous HPTLC pattern with a faint band at Rf = 0.02. No distinct bands of A. cocculus (Rf = 0.22) or C. caudatus (Rf = 0.60) were detected in any of the crude drug samples (Fig 2).” Comment 6: The authors should considerably widen the Discussion section towards providing scientific and empirical justification of the presented methodologies for non-closely related species. Response: The manuscript has been revised by widen the Discussion section as recommended by the editor. The authors added a paragraph according to the scientific and empirical justification of the presented methodologies for non-closely related species in the discussion section as following. Line 353-364 of the revised manuscript: “Recently, a number of reports have been published on the successful application of Bar-HRM and HPTLC analysis for the identification of related and nonclosely related species in herbal medicines. In 2018, Dual et al. applied the Bar-HRM method to identify Rhizoma Paridis and its common adulterants [28]. Acanthus ebracteatus Vahl, Andrographis paniculate (Burm.f.) Nees and Rhinacanthus nasutus (L.) Kurz were successfully discriminated by Bar-HRM analysis [29]. Moreover, Bar-HRM was applied to differentiate the poisonous plant U. siamensis from the edible vegetables M. suavis and S. androgynus for consumer safety purposes [24]. The HPTLC fingerprint revealed different phytochemical profiles between two nonrelated species, Cyanthillium cinereum (L.) H. Rob. (a smoking cessation herb) and its adulterant, Emilia sonchifolia (L.) DC. [19]. Combining HPTLC with the DNA barcode technique was previously reported for the identification of herbal raw materials such as Aristolochia species [30].” Comment 7: The manuscript would greatly benefit if being proofread by a native English speaker. Response: For the revised version, the manuscript has been proofread and edited by the American Journal Experts (AJE) service in order to improve the language. The AJE certificated was attached. Reviewer #1: The research article entitled “Combining DNA and HPTLC profiles to differentiate a pain relief herb, Mallotus repandus, from plants sharing the same common name (“Kho-Khlan”), Anamirta cocculus and Croton caudatus” highlights the use of HPTLC and BAR-HRM to distinguish the study plants. The study is potentially interesting, it has to be improved a lot before it is suitable for publication. Comments 1: One of the foremost concerns is that though the article is well written, still the proficiency of English is lacking in the article and it needs to improved. Response: Thank you reviewer for your suggestions. The authors apologize for the unproficiency of English in the manuscript. For the revised manuscript, the authors submitted the manuscript for a language service in order to improve it English proficiency and the revised manuscript has been edited by the American Journal Experts service (AJE). Please find the certificate in the "Response to Reviewers" file. Comments 2: Introduction (line 93-94): “Phytochemical composition may be uncertain due to environmental factors”. What authors would like to convey by making such statements in the introduction? This sentence is presented out of nowhere in introduction. Response: We are sorry about this mistake. Authors agree with the reviewer. The sentence has been deleted. Comments 3: Line 101: What are those benefits and limitations of BAR-HRM, and what are the benefits of using integrative approach for identification of plants? Response: BAR-HRM analysis has benefits and limitations. The authors added more information about benefits and limitations of BAR-HRM in line 100-108. The benefit of using integrative approach for identification of plants is added in the line 102-105. Revised sentences: Line 100-108 of the revised manuscript: “Bar-HRM, a sequencing-free method, detects signal alterations during the dissociation of double-stranded DNA generated from the PCR into single-stranded DNA. Each plant species can be differentiated by their individual melting temperature (Tm), which is correlated to their nucleotide sequences in the target region [23]. Bar-HRM analysis is a fast, cost-effective and reliable method; moreover, a small amount of sample is required for species identification. However, Bar-HRM primer design is challenging when the target sequence has high variation rates across the target amplicon, and Bar-HRM analysis is limited when low-quality DNA templates are used [24].” Line 109-113 of the revised manuscript: “As mentioned above, each identification method has advantages and limitations; therefore, an integrative approach is proposed to differentiate substitutions or adulterants of herbal species [19, 25]. Combined phytochemical profiles and DNA information can be applied to prevent the use of incorrect herbal species and support the quality of herbal materials to meet international standards [19].” Comments 4: The introduction lacks a coherence, and authors failed to showcase why they wanted to use HPTLC and BAR-HRM in their study, why not simple TLC or other chromatographic methods to distinguish the study species. Response: Thank you for bringing this into notice. In this study, the authors designed to use HPTLC instead of the TLC method as the HPTLC has higher resolution than that of the simple TLC, therefore, the HPTLC was chosen to distinguish phytochemical pattern in this work. Therefore, the author revised the manuscript by adding the advantage of HPTLC in Line 85-93. As the introduction part lacks a coherence, the manuscript has been edited to make a coherence within the section by adding more information in the introduction part to explain the reason of using the HPTLC and BAR-HRM method for species identification in this study in Line 85-93 and Line 100-108, respectively. Line 85-93 of the revised manuscript: “Thin-layer chromatography (TLC) and high-performance TLC (HPTLC), which recommended in herbal pharmacopoeias of many countries, are reliable methods for phytochemical constituents examination because the methods require target compound as standard reference [17, 18]. HPTLC, a sophisticated form of TLC, provides good separation efficiency due to higher quality of its separation plate. HPTLC exhibits higher accuracy, reproducibility, and ability to document the results compare to TLC [18]. Therefore, this method has been used for phytochemical profile of herbal species. However, uncertain results may occur by environmental factors which affect the chemical composition of herbal species and biological activities of the substances [19].” Line 100-108 of the revised manuscript: “Bar-HRM, a sequencing free method, detects signal alteration during the dissociation of double-stranded DNA into single stranded DNA. Each plant species can be differentiated by their individual melting temperature (Tm) which correlated to their nucleotide sequences in the target region [23]. Bar-HRM analysis exhibits fast, cost-effective and reliable method, moreover, small amount of sample is required for species identification. However, Bar-HRM primer design is challenging when the target sequence has high variation rates across the target amplicon and the Bar-HRM analysis has limited when low quality of DNA template is used [24].” Comments 5: Methodology: Authors failed to provide the details of herbarium voucher specimen details for the study species? Response: In the previous manuscript version, the authors used the “Code” to present herbarium voucher specimen in Table 1. Therefore, in this revised manuscript, the authors change the column “Code” to “Voucher number”. Comments 6: Methodology: Also, authors state that fresh leaves were collected, however, they used stem samples for HPTLC analysis? Therefore, authors need to specify the source of such stem samples used in HPTLC. Response: Thank you reviewer for bringing into notice. In this study, stems were used for HPTLC analysis. Therefore, the revised version of manuscript was edited in Line 121-123 to specify source of sample used in HPTLC experiment. The authors also revised the Method part (HPTLC profiles) and provided detail of sample (Line 156-157 in revised version) used in HPTLC analysis as following. Original sentence: Line 110-111 of the original manuscript: “Fresh leaves of A. cocculus (n=8), C. caudatus (n=8) and M. repandus (n=8) were collected from various locations across Thailand for the DNA barcoding experiment (Table 1).” Revised sentence: Line 121-123 of the revised manuscript: “Fresh leaves and stems of A. cocculus (n=8), C. caudatus (n=8) and M. repandus (n=8) were collected from various locations across Thailand (Table 1). These collections are legally permitted.” Original sentence: Line 142-143 of the original manuscript: “To obtain the phytochemical profiles of A. cocculus, C. caudatus and M. repandus, 1 g of dried stems from each species were crushed into a fine powder.” Revised sentence: Line 156-157 of the revised manuscript: “To obtain the phytochemical profiles of selected samples, including A. cocculus (SS-628), C. caudatus (SS-537) and M. repandus (SS-583),…” Comments 7: Line 143: Crushed? How did the authors crushed the dried stem samples? Response: We are sorry for missing information. The author crushed the dried stem samples using a grinder. The sentence has been revised in line 157-158. Original sentence: Line 142-143 of the original manuscript: “…,1 g of dried stems from each species were crushed into a fine powder.” Revised sentence: Line 157-158 of the revised manuscript: “…,1 g of dried stems from each species was crushed into a fine powder using a M 20 Universal mill grinder (IKA, Germany).” Comments 8: Line 147: sprayed or spotted? Response: Sorry for the mistake. The sentence has been edited by changing “sprayed to spotted” in Line 162-163. Original sentence: Line 147 of the original manuscript: “Then, 5 µl of the extracted solution was sprayed onto an HPTLC plate…” Revised sentence: Line 162-163 of the revised manuscript: “Then, 5 µl of the extracted solution was spotted onto an HPTLC plate...” Comments 9: Line 150: Authors state that the track distance is 11.4 mm, however they did not indicate whether it is from lower edge of the plate or from the sample spot? Response: Sorry for missing information. The sentence has been revised by adding details of the HPTLC plate setting in Line 164-166 of the revised manuscript. Original manuscript: Line 149-150 of the original manuscript: “Each individual band was 8 mm in length, the distance between tracks was 2 mm, and the track distance was 11.4 mm.” Revised manuscript: Line 164-166 of the revised manuscript: “Each individual band was 8 mm in length, the distance between tracks was 2 mm, and the track distance was 11.4 mm from the lower edge of the plate.” Comments 10: Table 2: It is confusing to see these primer pairs and sequence in table 2. Authors indicate in few primers as “This study”, then what is the purpose of providing other primer pair details in table 2? Also, ““This study”, is not indicated in ITS and psbA-trnH primer pairs. Authors should clarify and include only the primer pairs used in the study, also if they used more than one primer pair to amplify one particular barcode region, it should be included in discussion part. Response: Primers listed in Table 2 are the amplification and sequencing primers. The “This study” terms refer to primers that are originally designed in this work. For those primers without the term “This study” refer to primers that are previously reported. This work, the DNA barcode regions; ITS and psbA-trnH intergenic spacers regions, were amplifiable using the published ITS primers (ITS1 and ITS4) and psbA-trnH primers (psbA-trnHF and psbA-trnHR), respectively. However, matK region required more primers to complete the full length of nucleotide sequences for Mallotus repandus and Croton caudatus. As suggested by the reviewer, the authors agreed to reorganize the Table 2 and the additional primers for matK region of Mallotus repandus and Croton caudatus have been moved to the Appendix S1. Please see the detail in "Response to Reviewers" file. Comments 11: Authors failed to provide the details of primer design and the tools used to design for the BAR-HRM primer “KK-rbcL-HRM-F” and “KK-rbcL-HRM-R” Response: Thank you for raising to this point. The authors used the MUSCLE program was used for DNA barcode sequences alignment followed by Primer 3 and BLAST software for Bar-HRM primers design. The manuscript has been revised by adding details of primer design including tools which used for the BAR-HRM primer “KK-rbcL-HRM-F” and “KK-rbcL-HRM-R” design. The information has been added in line 210-212 and line 214-217. Line 210-212 of the revised manuscript: “To design Bar-HRM primers, nucleotide sequences obtained from the four DNA barcode regions of M. repandus, A. cocculus and C. caudatus were aligned by MUSCLE with gap open = –400; gap extend = 0; clustering method = UPGMB; and Min Diag Length = 24.” Line 214-217 of the revised manuscript: “Primer 3 and BLAST software were used for primer design. The Bar-HRM forward (KK-rbcL-HRM-F) and reverse primers (KK-rbcL-HRM-R) were designed based on the conserved regions of the rbcL gene of the three plants. The targeted amplicon provided a 102 bp amplicon with 9 polymorphic sites of the rbcL gene.” Comments 12: Authors can really shorten the DNA extraction part and PCR amplification part in the methodology section. Response: Thank you reviewer for your suggestion. The manuscript has been revised by shorten the DNA extraction part and PCR amplification part in Line 175-184 of the revised manuscript. Original paragraph of DNA extraction part: Line 159-173 of the original manuscript: “Fresh leaves of authentic A. cocculus, C. caudatus and M. repandus were ground into a fine powder with liquid nitrogen. Genomic DNA was extracted from 50 mg of fine powder using a DNeasy Plant Mini Kit (Qiagen, Germany) following the manufacturer’s instructions. A GENECLEAN Kit (MP Biomedicals, USA) was used to purify the genomic DNA according to the manufacturer’s protocol. The quantity of the extracted DNA was determined spectrophotometrically using a NanoDrop One UV-Vis Spectrophotometer (Thermo Scientific, USA). DNA quality was observed by agarose gel electrophoresis. Genomic DNA was run on 0.8% (w/v) agarose in 1X TAE gel containing 1X RedSafe nucleic acid staining solution (iNtRON Biotechnology, USA) at 100 V for 30 min. The agarose gel was analyzed with a UVP GelSolo (Analytik Jena GmbH, Germany) gel documentation system. Images were taken by onboard VisionWorks software (Analytik Jena GmbH, Germany). Genomic DNA was stored at -20 ℃ for further use. Genomic DNA was extracted and purified from the purchased crude drugs called “Kho-Khlan”, mixed powder of plants and laboratory-made YPSKK formulae using the methods described above. Genomic DNA quantification and qualification were conducted as described for the authentic plant samples.” Revised paragraph of DNA extraction part: Line 175-184 of the revised manuscript: “Genomic DNA from leaves of the samples, the purchased crude drugs, mixed herbal powder and laboratory-made YPSKK formulae were extracted using a DNeasy Plant Mini Kit (Qiagen, Germany) and further purified using a GENECLEAN Kit (MP Biomedicals, USA) according to the manufacturer’s protocol. DNA quantity and quality were determined using a NanoDrop One UV–Vis Spectrophotometer (Thermo Scientific, USA) and agarose gel electrophoresis, respectively. Genomic DNA was run on 0.8% (w/v) agarose in 1X TAE gel containing 1X RedSafe nucleic acid staining solution (iNtRON Biotechnology, USA) at 100 V for 30 min. Agarose gel was analyzed with a UVP GelSolo (Analytik Jena GmbH, Germany) gel documentation system, and images were taken by onboard VisionWorks software (Analytik Jena GmbH, Germany). Genomic DNA was stored at -20℃ for further use.” Comments 13: One of my concern with the DNA barcoding and BAR-HRM in this study is, authors have not used any closely related plant groups as control or to highlight that BAR-HRM can distinguish closely related species. It is obvious and no surprise that the study plants belong to Euphorbiaceae and Menispermaceae which shows enough genetic variation to be distinguished. In fact, experienced filed botanist and microscopy analysis can easily distinguish these study species, why anyone wants to use BAR-HRM to distinguish plants that belong to different families and has enough morphological variation itself. Response: Thank you reviewer for your comment. We totally appreciate your concern. The reason that the authors have not used any closely related species in this study because the plants called “Kho-Khlan”, in fact, they are only three herbal species; A. cocculus, C. caudatus and M. repandus found in Thai herbal markets. Therefore, we have not used other plants in this study. In the herbal markets, normally the herbal materials are sold in the processed forms such as small pieces of stem and powder which its identities have been lost. This is challenging us to identify small pieces of stem or herbal powder by morphological analysis or microscopic examination. Bar-HRM analysis will benefit people who involved with regulatory policy of herbal products and herbal industry as the Bar-HRM analysis supports species identification of highly processed raw materials. The Bar-HRM analysis also requires low amount of DNA sample and the method is able to amplify fragmented DNA, which normally found in the DNA of highly processed materials. Comments 14: Another concern with HPTLC is, why authors have not derivatized the HPTLC plate using any derivatizing reagents?, without derivatization, and using only 366 nm, only UV active compounds are visible and the data provided by authors are not sufficient to claim that the authors developed a HPTLC method. Response: We appreciate the reviewers’ comments. The reason why the authors did not derivatize the HPTLC plate because the species-specific bands of the Mallotus repandus, Anamirta cocculus and Croton caudatus were simply detected under the wavelength of 366 nm plus the high quality of HPTLC plate that provides good separation efficiency, therefore, no further derivatizing reagents is needed in this study. Moreover, the authors agree that HPTLC method we adapt in this study are not sufficient to claim that the authors develop a HPTLC method. Therefore, the term “develop HPTLC” has been change to “HPTLC”. Reviewer #2: The present study established a combined Bar-HRM and HPTLC technique to identify the correct species, Mallotus repandus, from authentic Anamirta cocculus and Croton caudatus. This method was successfully applied to identify crude drugs and multiherbal mixed formulae and serve as a quality control tool for preventing accidental confusion of herbal species sharing the same common name. The experiment design is logical and fine. However, there are still some issues that merit authors’ attention. Comments 1: The writing of the “Introduction” is too wordy, especially lines 59-76. Simply explain that A. cocculus and C. caudatus can't be used as substitutes of M. repandus in clinical practices. Response: We appreciate the reviewers’ comments. The authors agree with the reviewer that the introduction is too wordy. Therefore, the authors rewrite the paragraph to be more concise. Although the A. cocculus and C. caudatus cannot be used as substitutes of M. repandus in clinical practices but the A. cocculus and C. caudatus also possess their own medicinal properties. Therefore, the authors would like to use the first paragraph in the Introduction part to describe their healing properties to mention that they cannot be used because of the difference in healing properties and the paragraph has been revised in line 57-74 as following. Original sentence: Line 59-76 of the original manuscript: “However, at least three herbs, namely, Mallotus repandus (Willd.) Müll. Arg. (Euphorbiaceae), Croton caudatus Gleiseler (Euphorbiaceae) and Anamirta cocculus (L.) Wight & Arn (Menispermaceae), share the common name “Kho-Khlan”, and they have different healing properties [4] (Fig 1). M. repandus is the only official “Kho-Khlan” species and is prescribed as a main component in the formula. M. repandus has long been used for the relief of muscle pain [2]. C. caudatus is administered for headaches, visceral pain, and rheumatism [5]. This species is also reported to treat malaria, fever, numbness, and constipation [6]. In some parts of Asia, C. caudatus is applied as a poultice to treat fever and sprains [7]. In addition, the crude extract of C. caudatus seeds can protect against larvae of mosquitoes [8]. The folk literature indicates that most of the plants in the genus Croton cause irritation and allergic responses [9]. A. cocculus is used in the treatment of blood stasis and fever and stimulates the central nervous system [11]. This species is recorded as a restorative medical herb in the southern region of Thailand [11]. The plant, however, contains very strong neurotoxin compounds, such as picrotoxin, picrotin, methyl picrotoxate, dihydroxypicrotoxinin, picrotoxic acid and a sesquiterpene mixture of picrotoxinin, that affect the central nervous system (CNS) of vertebrates [12-14]. Seeds of A. cocculus are used to eliminate unwanted wild fish in aquaculture ponds and to kill birds [15]. A case study reported that consuming A. cocculus berries caused extensive brain hemorrhage in cattle [14]. Small amounts of A. cocculus are highly toxic and fatal if consumed by humans [12]. Although the substances in A. cocculus are harmful, the herb is still utilized in Thai traditional medicine due to the belief that a very small dose of toxic substances can be neutralized by other compounds in the herbal formula [16]”. Revised sentence: Line 57-74 of the revised manuscript: “M. repandus (Euphorbiaceae) shares the common name “Kho-Khlan” with Croton caudatus Gleiseler (Euphorbiaceae) and Anamirta cocculus (L.) Wight & Arn (Menispermaceae) (Fig. 1). However, only M. repandus (Fig. 1A) is an official plant species in NLEM. The stem of M. repandus has long been used for the relief of muscle pain in Thai traditional medicine [2]. C. caudatus is administered for headaches, visceral pain, rheumatism, fever, and constipation [4-6]. The crude extract of C. caudatus seeds can protect against mosquito larvae [7]. A. cocculus is used in the treatment of blood stasis and fever, stimulates the central nervous system [8] and is recorded as a restorative medical herb in the southern region of Thailand [9]. However, a previous report showed that C. caudatus causes irritation and allergic responses [10], while A. cocculus contains very strong neurotoxin compounds that affect the central nervous system (CNS) of vertebrates, such as picrotoxin, picrotin, methyl picrotoxate, dihydroxypicrotoxinin, picrotoxic acid and a sesquiterpene mixture of picrotoxinin [11-13]. Seeds of A. cocculus are also used to eliminate unwanted wild fish in aquaculture ponds and to kill birds [14]. Consuming A. cocculus berries causes extensive brain hemorrhage in cattle, while small amounts of A. cocculus are highly toxic and fatal if consumed by humans [11, 13]. Although the substances in A. cocculus are harmful, the herb is still utilized in Thai traditional medicine due to the belief that a very small dose of toxic substances can be neutralized by other compounds in the herbal formula [15].” Comments 2: The description of the existing identification methods in the second paragraph of “Introduction” is logically confused. Please rewrite. Response: Thank you reviewer for raising this point. The Introduction part was rewritten to be more logical. The introduction section has been revised in line 80-117 of the revised manuscript as following. Original paragraph: Line 83-106 of the original manuscript: “Only M. repandus is used for YPSKK preparation, and it is challenging to differentiate among the three “Kho-Khlan” species (Fig 1A) when they are in processed forms (Fig 1B-C). Thus, a precise identification tool is necessary to avoid negative health effects that can occur by using raw materials from incorrect species. Classical procedures for the identification of herbs involve organoleptic methods and micro- and macroscopic and chemical characters [17]. The organoleptic and micro- and macroscopic methods are basic techniques that require simple equipment and experienced personnel for taxonomic examination. Thin-layer chromatography (TLC) is used for phytochemical identification of raw herbal material and is also recommended in the Thai Herbal Pharmacopoeia [18]. TLC and other tools, such as high-performance TLC (HPTLC) and high-performance liquid chromatography (HPLC), require standard compounds as references. Phytochemical composition may be uncertain due to environmental factors. Although genetic methods based on DNA sequence analysis require specialists and are cost effective, these methods provide species-level information, and a small number of samples is needed for the identification process [19]. For a decade, DNA barcoding has been established and applied for species authentication and identification. DNA barcoding coupled with high-resolution melting (Bar-HRM) analysis have gained attention for its fast identification of herbal species such as Vaccinium myrtillus [20], Mitragyna speciosa [21] and Ardisia gigantifolia [22]. However, Bar-HRM methods have different benefits and limitations; therefore, an integrative approach is proposed to differentiate substitutions and adulterants of herbal species [19, 23]. In this study, we aimed to utilize phytochemical profiles and DNA information to differentiate M. repandus from C. caudatus and A. cocculus. HPTLC and Bar-HRM approaches were combined to create a simple and fast identification method for the quality control of “Kho-Khlan” raw material in the herbal industry.” Revised paragraph: Line 80-117 of the revised manuscript: “The stem of M. repandus is used for the YPSKK formula. Crude drugs of M. repandus are commercially provided in both powdered form and small pieces of stem, which are challenging for species differentiation (Fig. 1B-C). Although raw materials of herbal medicine can be examined by simple organoleptic methods and macroscopic and microscopic methods, experienced personnel for taxonomic examination are required [16]. Thin-layer chromatography (TLC) and high-performance TLC (HPTLC), which are recommended in the herbal pharmacopoeias of many countries, including Thailand, are reliable methods for phytochemical constituent examination; however, the methods require a target compound as a standard reference [17, 18]. HPTLC, a sophisticated form of TLC, provides good separation efficiency due to the higher quality of its separation plate. HPTLC exhibits higher accuracy, reproducibility, and ability to document the results than TLC [18]. Therefore, this method has been used to determine the phytochemical profile of herbal species. However, uncertain results may occur due to environmental factors that affect the chemical composition of herbal species and biological activities of the substances [19]. In recent years, a molecular approach called the DNA barcoding technique has gained demand in species identification because it is an accurate, cost-effective and reliable tool for species identification. The DNA barcoding method provides species-level information, and small amounts of samples are needed for the identification process [19]. Currently, DNA barcoding coupled with high-resolution melting (Bar-HRM) analysis has gained attention for its rapid identification of herbal species such as Vaccinium myrtillus L. [20], Mitragyna speciosa Korth [21] and Ardisia gigantifolia Stapf [22]. Bar-HRM, a sequencing-free method, detects signal alterations during the dissociation of double-stranded DNA generated from the PCR into single-stranded DNA. Each plant species can be differentiated by their individual melting temperature (Tm), which is correlated to their nucleotide sequences in the target region [23]. Bar-HRM analysis is a fast, cost-effective and reliable method; moreover, a small amount of sample is required for species identification. However, Bar-HRM primer design is challenging when the target sequence has high variation rates across the target amplicon, and Bar-HRM analysis is limited when low-quality DNA templates are used [24]. As mentioned above, each identification method has advantages and limitations; therefore, an integrative approach is proposed to differentiate substitutions or adulterants of herbal species [19, 25]. Combined phytochemical profiles and DNA information can be applied to prevent the use of incorrect herbal species and support the quality of herbal materials to meet international standards [19]. In this study, we aimed to utilize HPTLC and Bar-HRM analysis to differentiate a pain relief herb, M. repandus, from C. caudatus and A. cocculus, which share the common name Kho-Khlan. Combined approaches were used to create a simple and rapid identification method for the quality control of the Kho-Khlan raw material in the herbal industry.” Comments 3: Why did authors select the rbcL region for Bar-HRM analysis for the differentiation of M. repandus from A. cocculus and C. caudatus? Response: The authors selected rbcL gene as a target region for Bar-HRM analysis due to the sequence alignment result of the DNA barcode regions among M. repandus, A. cocculus and C. caudatus, we found the rbcL region possess a target site of 102 bp which contained two conserve regions and one variable region. The 102 bp amplicon has one conserve region at the 5´- and another at the 3´-end. Nine nucleotide sites (within the variable region) flanked the two conserve regions and results in the difference of melting temperature among each 102 bp amplicons of M. repandus, A. cocculus and C. caudatus. These characters, two conserve regions flank by nucleotide variable sites and the amplicon site less than 300 bp, suite for Bar-HRM primer design and only rbcl gene exhibits the characters. Therefore, the authors added the reason for the selection of the rbcL region for Bar-HRM analysis to differentiate M. repandus from A. cocculus and C. caudatus in line 389-396 and line 400-403 as following. Line 389-396 of the revised manuscript: “Since the gene sequences in the rbcL regions of A. cocculus, C. caudatus and M. repandus possess two conserved sites flanking nine nucleotide polymorphism sites, this region is suitable for the design of Bar-HRM primers. The rbcL region was chosen as a targeted amplified region for Bar-HRM analysis. The nucleotide variation within 102 bp of PCR amplicons amplified from the three species resulted in different melting temperatures when analyzed by the Bar-HRM approach. An amplicon of 102 bp is in the range of desired amplicon lengths for the Bar-HRM analysis (<300 bp) suggested by Osathanunkul et al., 2015 [25].” Line 400-403 of the revised manuscript: “Moreover, the use of the rbcL region for species differentiation at the genus level has been revealed [38]. These results support our conclusion on the reliability of the rbcL region as a potential DNA barcode marker for discrimination of the nonrelated species that belong to different genera, A. cocculus, C. caudatus and M. repandus.” Comments 4: I cannot find the HPTLC bands of C. caudatus (Rf = 0.55) in tracks 6-7 in figure 3. Besides, the enlarged image on the right in Figure 3 should have a scale. Response: Thank you for raising this point. The authors agreed with reviewer that HPTLC bands of C. caudatus (Rf = 0.55) in tracks 6-7 in figure 3 are missing. In order to see the missing band, the authors adjusted mobile phase ratio from toluene:acetone:formic acid, 5:3:0.5 (v/v/v) to 5:4:0.5 (v/v/v). This change resulted in the Rf alteration of species-specific band from Rf=0.55 to Rf=0.60 (see the revised Fig. 2). Therefore, the authors changed the original Fig. 3 with the revised Fig. 3. Scale in revised Fig. 3 has been added in the enlarge image revised Fig. 3. Please see detail in the "Response to Reviewers" file. Comments 5: This study showed that compared with A. cocculus, species C. caudatus and M. repandus were more difficult to distinguish. It is suggested that authors add some discussion to elaborate on how the two methods, Bar-HRM and HPTLC, complement each other to distinguish the three species, especially the distinction between C. caudatus and M. repandus. Response: Thank you for reviewer’s suggestion. The authors added information in the discussion section to elaborate on how the two methods, Bar-HRM and HPTLC, complement each other to distinguish the three species in the discussion part in line 411-414 as following. Line 411-414 of the revised manuscript: “This suggested that Bar-HRM and HPTLC can complement each other to distinguish C. caudatus and M. repandus when uncertainty in phytochemical constituents is observed. Bar-HRM analysis using genetic information can be used to clarify the ambiguous result, as the genetic information is stable.” ************************* Submitted filename: Response to Reviewers.docx Click here for additional data file. 6 May 2022 Combining DNA and HPTLC profiles to differentiate a pain relief herb, Mallotus repandus, from plants sharing the same common name, “Kho-Khlan” PONE-D-22-00460R1 Dear Dr. Sukrong, We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements. Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication. An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org. If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org. Kind regards, Branislav T. Šiler, Ph.D. Academic Editor PLOS ONE Additional Editor Comments (optional): Reviewers' comments: 2 Jun 2022 PONE-D-22-00460R1 Combining DNA and HPTLC profiles to differentiate a pain relief herb, Mallotus repandus, from plants sharing the same common name, “Kho-Khlan” Dear Dr. Sukrong: I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org. If we can help with anything else, please email us at plosone@plos.org. Thank you for submitting your work to PLOS ONE and supporting open access. Kind regards, PLOS ONE Editorial Office Staff on behalf of Dr. Branislav T. Šiler Academic Editor PLOS ONE
  23 in total

Review 1.  Plants as source of drugs.

Authors:  S M Rates
Journal:  Toxicon       Date:  2001-05       Impact factor: 3.033

2.  Use of high-performance thin layer chromatography by the American Herbal Pharmacopoeia.

Authors:  Roy T Upton
Journal:  J AOAC Int       Date:  2010 Sep-Oct       Impact factor: 1.913

3.  Inhibition of Heinz body induction in an in vitro model and total antioxidant activity of medicinal Thai plants.

Authors:  Attakorn Palasuwan; Suphan Soogarun; Tamaporn Lertlum; Paweena Pradniwat; Viroj Wiwanitkit
Journal:  Asian Pac J Cancer Prev       Date:  2005 Oct-Dec

4.  Medicinal plants used with Thai Traditional Medicine in modern healthcare services: a case study in Kabchoeng Hospital, Surin Province, Thailand.

Authors:  Somtanuek Chotchoungchatchai; Promchit Saralamp; Thaya Jenjittikul; Saowapa Pornsiripongse; Sompop Prathanturarug
Journal:  J Ethnopharmacol       Date:  2012-02-17       Impact factor: 4.360

5.  Three poisonous plants (Oenanthe, Cicuta and Anamirta) that antagonise the effect of γ-aminobutyric acid in human brain.

Authors:  Michael R Lee; Estela Dukan; Iain Milne
Journal:  J R Coll Physicians Edinb       Date:  2020-03

6.  Discrimination of the Thai rejuvenating herbs Pueraria candollei (White Kwao Khruea), Butea superba (Red Kwao Khruea), and Mucuna collettii (Black Kwao Khruea) using PCR-RFLP.

Authors:  Suchaya Wiriyakarun; Woraluk Yodpetch; Katsuko Komatsu; Shu Zhu; Nijsiri Ruangrungsi; Suchada Sukrong
Journal:  J Nat Med       Date:  2012-10-21       Impact factor: 2.343

7.  Development of a single nucleotide polymorphism barcode to genotype Plasmodium vivax infections.

Authors:  Mary Lynn Baniecki; Aubrey L Faust; Stephen F Schaffner; Daniel J Park; Kevin Galinsky; Rachel F Daniels; Elizabeth Hamilton; Marcelo U Ferreira; Nadira D Karunaweera; David Serre; Peter A Zimmerman; Juliana M Sá; Thomas E Wellems; Lise Musset; Eric Legrand; Alexandre Melnikov; Daniel E Neafsey; Sarah K Volkman; Dyann F Wirth; Pardis C Sabeti
Journal:  PLoS Negl Trop Dis       Date:  2015-03-17

8.  A Wound Healing Formulation Based on Iranian Traditional Medicine and Its HPTLC Fingerprint.

Authors:  Maryam Jahandideh; Homa Hajimehdipoor; Seyed Alireza Mortazavi; Ahmadreza Dehpour; Gholamreza Hassanzadeh
Journal:  Iran J Pharm Res       Date:  2016       Impact factor: 1.696

9.  Multiplex Real-Time PCR with HRM for Detection of Lactobacillus sakei and Lactobacillus curvatus in Food Samples.

Authors:  Konstantin A Kurbakov; Evgenii A Konorov; Mikhail Y Minaev; Oksana A Kuznetsova
Journal:  Food Technol Biotechnol       Date:  2019-03       Impact factor: 3.918

Review 10.  DNA barcode markers applied to seafood authentication: an updated review.

Authors:  Telmo J R Fernandes; Joana S Amaral; Isabel Mafra
Journal:  Crit Rev Food Sci Nutr       Date:  2020-08-25       Impact factor: 11.176
View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.