Rong Sang1,2, Cheng Wu1, Shanshan Xie1, Xiao Xu1, Yuhan Lou1, Wanzhong Ge1, Yongmei Xi3, Xiaohang Yang4,5. 1. The Women's Hospital, Institute of Genetics, School of Medicine, Zhejiang University, Hangzhou, 310058, China. 2. College of Life Sciences, Zhejiang University, Hangzhou, 310058, China. 3. The Women's Hospital, Institute of Genetics, School of Medicine, Zhejiang University, Hangzhou, 310058, China. xyyongm@zju.edu.cn. 4. The Women's Hospital, Institute of Genetics, School of Medicine, Zhejiang University, Hangzhou, 310058, China. xhyang@zju.edu.cn. 5. Joint Institute of Genetics and Genomic Medicine, Between Zhejiang University and University of Toronto, Zhejiang University, Hangzhou, 310058, China. xhyang@zju.edu.cn.
Abstract
BACKGROUND: Mental retardation is a complex neurodevelopmental disorder. NPAT, a component of the histone locus body (HLB), has been implicated as a candidate gene for mental retardation, with a mechanism yet to be elucidated. RESULTS: We identified that mxc, the Drosophila ortholog of NPAT, is required for the development of nervous system. Knockdown of mxc resulted in a massive loss of neurons and locomotion dysfunction in adult flies. In the mxc mutant or RNAi knockdown larval brains, the neuroblast (NB, also known as neural stem cell) cell fate is prematurely terminated and its proliferation potential is impeded concurrent with the blocking of the differentiation process of ganglion mother cells (GMCs). A reduction of transcription levels of histone genes was shown in mxc knockdown larval brains, accompanied by DNA double-strand breaks (DSBs). The subsidence of histone transcription levels leads to prematurely termination of NB cell fate and blockage of the GMC differentiation process. Our data also show that the increase in autophagy induced by mxc knockdown in NBs could be a defense mechanism in response to abnormal HLB assembly and premature termination of NB cell fate. CONCLUSIONS: Our study demonstrate that Mxc plays a critical role in maintaining neural stem cell fate and GMC differentiation in the Drosophila larval brain. This discovery may shed light on the understanding of the pathogenesis of NPAT-related mental retardation in humans.
BACKGROUND: Mental retardation is a complex neurodevelopmental disorder. NPAT, a component of the histone locus body (HLB), has been implicated as a candidate gene for mental retardation, with a mechanism yet to be elucidated. RESULTS: We identified that mxc, the Drosophila ortholog of NPAT, is required for the development of nervous system. Knockdown of mxc resulted in a massive loss of neurons and locomotion dysfunction in adult flies. In the mxc mutant or RNAi knockdown larval brains, the neuroblast (NB, also known as neural stem cell) cell fate is prematurely terminated and its proliferation potential is impeded concurrent with the blocking of the differentiation process of ganglion mother cells (GMCs). A reduction of transcription levels of histone genes was shown in mxc knockdown larval brains, accompanied by DNA double-strand breaks (DSBs). The subsidence of histone transcription levels leads to prematurely termination of NB cell fate and blockage of the GMC differentiation process. Our data also show that the increase in autophagy induced by mxc knockdown in NBs could be a defense mechanism in response to abnormal HLB assembly and premature termination of NB cell fate. CONCLUSIONS: Our study demonstrate that Mxc plays a critical role in maintaining neural stem cell fate and GMC differentiation in the Drosophila larval brain. This discovery may shed light on the understanding of the pathogenesis of NPAT-related mental retardation in humans.
Mental retardation, also known as intellectual disability (ID), is a common neurodevelopmental disorder which has been estimated to be present in 1% of the global population [1]. The etiology of mental retardation is complicated with both external and genetic factors often contributing to this neurological disorder [2]. Chromosomal microarray analysis (CMA) studies, where the copy number variants (CNVs) containing the NPAT locus have been categorized as the pathogenic events for mental retardation, implicate NPAT as a candidate disease gene [3, 4]. However, no point mutations within NPAT gene have yet been reported in mental retardation cases and any potentially related pathogenic mechanisms remain to be elucidated.Drosophila is an ideal model for studying central nervous system (CNS) development and deciphering causes of related diseases. In Drosophila, multi sex combs (mxc) is the ortholog of NPAT [5]. NPAT/Mxc is a key component of histone locus body (HLB) [6-8]. Studies have shown that NPAT/Mxc acts as the scaffold protein of the HLB required for HLB assembly and transcription of canonical histone genes [5]. The N-terminal of NPAT/Mxc is crucial for self-interaction, while the C-terminal is required for recruiting other members of the HLB [9, 10]. NPAT/Mxc is phosphorylated by cyclin E/Cdk2, such phosphorylation being a key factor in the formation of phase separation allowing the formation of HLB to be precisely and dynamically regulated [11, 12]. Several studies on NPAT/mxc mutations have been published with the mutations of NPAT/mxc leads to the failure of HLB formation and in the block ageing of histone transcription in cultured cells [10, 11]. The chromosome instability caused by mxc mutations affects Drosophila male meiosis [13]. In Drosophila larval hematopoietic tissue, depletion of mxc leads to tumor formation [14, 15]. Based on these reports, NPAT /mxc appears to prevent chromosome instability and acts as a tumor suppressor gene. How a “tumor suppressor” NPAT, when its function is defective, leads to human mental retardation remains a key question. Our study focuses on the specific role of NPAT/Mxc in the development of Drosophila CNS, and reveals its possible mechanisms related to mental retardation.Drosophila CNS is derived from neuroblasts (NBs), also known as neural stem cells [16]. The NB divide asymmetrically producing a self-renewing NB and a smaller ganglion mother cell (GMC). The GMCs further undergo differentiation and divide terminally, giving rise to two neurons [17, 18]. At the pupal stage, all NBs terminate their cell fate and exit the cell cycle [19, 20]. No mitotic NBs remain detectable in the central brain or ventral nerve cord of adult flies [21]. Deadpan (Dpn) and Prospero (Pros) are two important transcription factors that regulate the stemness and differentiation of NBs, and are commonly used as markers to identify NBs and their progeny [22-24]. Dpn is expressed in all NBs and mature INPs, but not in immature INPs or GMCs [25]. Ectopic expression of Dpn in immature INPs leads to dedifferentiation and tumor formation [23, 26]. Pros, as a cell fate determinant, is expressed in all NBs but only localized at the basal cortex during mitosis in the larval central brain. At telophase, Pros is exclusively segregated into the GMCs [27, 28]. Soon after the formation of GMCs, Pros enters the nucleus and acts as a transcription factor that inhibits stemness and promotes differentiation [24, 29]. At the early pupal stage, during which all CNS neurons are developed, Pros starts to accumulate in the nucleus of NBs. These NBs with nuclear Pros divide symmetrically to generate two equal sized daughters and terminate the NB cell fate [30, 31].In the present study, we identify that Mxc/NPAT functions to maintain the proliferation of NBs and their progeny in Drosophila larval brains. The lack of Mxc leads to decreased transcription levels of histones and increased DNA double strand breaks (DSBs), resulting in premature termination of NB cell fate and impaired NB self-renew potential. Knocking down mxc also inhibits the differentiation of GMCs. These abnormalities drastically reduce the numbers of neurons in the central brain, eventually leading to neurological defects. Our data also show that in the absence of Mxc, autophagy is elevated and seems to protect against the formation of Dpn+ (differentiation-halted) GMCs. These data shed a light on the possible pathogenesis of human mental retardation disease caused by NPAT mutations.
Results
Mxc deficiency leads to a massive loss of neurons and locomotion dysfunction in adult flies
To explore the potential functions of Mxc in CNS development, we employed a NB specific RNAi knockdown approach. The mxc RNAi lines were driven by wor-GAL4. mxc knockdown flies survived till the early adult stage, but all stayed on the bottom of the vials after eclosion without climbing ability and exhibited akinesia. These flies then died within the first one or two days of adulthood (n = 107; Fig. 1B). Overexpression of Mxc in mxc knockdown flies partially rescued this phenotype, in which about one third of the flies survived beyond two days (34.58%, n = 106; Fig. 1B).
Fig. 1.
Knocking down mxc causes neuronal defects. A Schematic of the structure of Drosophila adult brain, including central brain (CB) and optic lobes (OLs). B Statistics on survival rate of wt, mxc RNAi and Mxc rescue flies after eclosion. The data are plotted as mean ± SD. *p < 0.05 using a Student’s t test, p = 0.0124. Numbers of flies counted N = 99, N = 107, N = 106, respectively. C–E Z-axis projection of adult central brains of wt (C), wor > mxc RNAi (D), wor > mxc RNAi, UAS-Mxc (E), labeled by anti-Elav. Elav is a maker of differentiated neurons. Elav+ cells were distributed throughout wt central brains (arrowheads; C), but were missing in mxc RNAi central brains (arrowheads; D). Overexpressing Mxc in mxc knockdown background rescued the phenotype (arrowheads; E). Scale bars: 100 μm
Knocking down mxc causes neuronal defects. A Schematic of the structure of Drosophila adult brain, including central brain (CB) and optic lobes (OLs). B Statistics on survival rate of wt, mxc RNAi and Mxc rescue flies after eclosion. The data are plotted as mean ± SD. *p < 0.05 using a Student’s t test, p = 0.0124. Numbers of flies counted N = 99, N = 107, N = 106, respectively. C–E Z-axis projection of adult central brains of wt (C), wor > mxc RNAi (D), wor > mxc RNAi, UAS-Mxc (E), labeled by anti-Elav. Elav is a maker of differentiated neurons. Elav+ cells were distributed throughout wt central brains (arrowheads; C), but were missing in mxc RNAi central brains (arrowheads; D). Overexpressing Mxc in mxc knockdown background rescued the phenotype (arrowheads; E). Scale bars: 100 μmWe dissected brains from the adult flies within one day of eclosion and stained with anti-Elav, a pan-neuronal marker. Compared to the wt (Fig. 1A). The mxc knockdown flies showed a massive loss of neurons in the central brain (arrowheads, Fig. 1D). The exogenous overexpression of Mxc in larval NBs largely rescued this phenotype (Fig. 1E). It is interesting to note that no obvious abnormality of brain development was observed when Mxc was overexpressed in larval brain NBs of wt flies. These observations indicate that Mxc plays a vital role in the CNS development. mxc knockdown in larval NBs causes the loss of neurons in the adult brains, leading to locomotion dysfunction and early lethality of adult flies.To further evaluate the important role of Mxc in CNS development, we examined the genetic mutant of mxc. mxc is a mutant line of mxc (Obtained from BDSC), containing a deletion of 4 bp (TTCG) at residues F1823 of Mxc and resulting in a frameshift at the C-terminal [5]. Hemizygotes of mxc die at late larval or early pupal stage [32]. NB specific overexpression of exogenous Mxc in hemizygotes of mxc prolonged the survival time of the mutant animals to the late pupal stage (80.26%, n = 101) where a small percentage (10.82%, n = 101) of the flies even survived to adulthood without obvious mobility problems. This rescue data agrees well with the mxc RNAi result and suggest that Mxc is critical for CNS development.
Knockdown ofresults in premature localization of Pros in the nucleus of NBs
The massive loss of neurons in adult central brains could be due to defects in NBs and GMCs in larval brains. This prompted us to investigate the NB cell fate maintenance in mxc knockdown larval brains. In NBs, nuclear localization of Pros is recognized as a signal for the termination of stem cell fate [20, 30, 31].We observed that NB specific mxc knockdown with wor-GAL4 led to a premature accumulation of Pros in nuclei of the NBs of the third-instar larval central brains (arrowheads; Fig. 2B). To ensure the observed phenotype was not an off-target effect, a second mxc-RNAi line (THU5844, obtained from Tsinghua Drosophila Center) was used and the rescue experiment was conducted as well with a mxc overexpressed line (Fig. 2A–F). The efficiency of RNAi knockdown was confirmed using Western blotting analysis with MPM-2, an antibody recognizing cyclin E/Cdk2–dependent phosphorylation sites within Mxc [5] (Fig. 2I). The brain samples were double-labeled with anti-Dpn, a stem cell marker [23, 24] and anti-Pros. In wt third-instar larval brain NBs, Pros was not detected in the nuclei of NBs (Fig. 2A). In contrast, we observed nuclear Pros in NBs in both mxc RNAi lines (THU0893: 27.51%, n = 740; THU5844: 24.84%, n = 69; Fig. 2B, C, F). Overexpression of exogenous Mxc in mxc knockdown background partially rescued the phenotype (16.67%, n = 108; Fig. 2D, F). The overexpression of Mxc alone in wt NBs did not result in any phenotypes (Fig. 2E).
Fig. 2
Lack of Mxc leads to premature accumulation of nuclear Pros in NBs. A–E’ Confocal images of the third-instar larval brains of wt (A–A’), mxc RNAi (THU0893, THU5844) (B–C’), mxc RNAi with UAS-Mxc (D–D’) and UAS-Mxc (E–E’), labeled by anti-Pros (red) and anti-Dpn (green). In wt larval central brains, no nuclear Pros was detected in the NBs. Pros (arrowheads) was detected in the nucleus of NBs in mxc RNAi lines. This phenotype was rescued by UAS-Mxc. No phenotypes were detected in UAS-Mxc lines. All of these lines were driven by wor-Gal4. CB represents the central brain region, and OL represents the optical lobe region. Scale bars: 20 μm. F Statistics on nuclear Pros in the NBs in larval central brains of wt, mxc RNAi and Mxc rescue. The data are plotted as mean ± SD. **p < 0.01 using a Student’s t test, p = 0.0010. Numbers of NBs counted N = 360, N = 740, N = 69, N = 108, N = 187, respectively. G Schematic of Mxc protein structures in wt, mxc, and mxc. The 1837–amino acid Mxc protein contains a LisH domain (amino acids 6–38) and a SIF domain (amino acids 39–185) at the N-terminal, as well as a AT-hook motif at residues 1523–1535. mxc contains a deletion of 4 bp (TTCG) at the F1823 residue of Mxc, resulting in a frameshift at the C-terminal. It encodes an 1868–amino acid protein. mxc encodes a nonsense mutation at the N480 residue of the Mxc protein, resulting in a truncated protein containing 510 amino acids [10, 32]. H Statistics on nuclear Pros in the neuroblasts in larval central brain of wt, mxc and Mxc rescue. The data are plotted as mean ± SD. ***p < 0.001 using a Student’s t test, p = 0.0007. Numbers of neuroblasts counted N = 360, N = 373, N = 153, respectively. I The protein levels of Mxc were decreased in mxc knockdown larval brains compared to wt. MPM-2 antibody was used to recognize Mxc signals in this experiment. (J–L’) Confocal images of the larval brains of wt (J–J’), mxc (K–K’), and mxc with UAS-Mxc (L–L’) at 120 h AEL, labeled by anti-Pros (red), anti-Dpn (green), and Dapi (blue). Pros (arrowheads) was detected in the nucleus of mxc larval NBs (K). This phenotype was well rescued by worniu driven UAS-Mxc (L). Scale bars: 20 μm. (M–N’) MARCM clones of wt (M–M’) and mxc (N–N’) in third-instar larval brains, labeled by anti-Pros (red), anti-Dpn (blue) and anti-GFP (green). Nuclear Pros (arrowhead) was not detected in wt NBs (M), but was detected in mxc NBs (N). Numbers of clones observed n = 3, n = 3, respectively. Scale bars: 10 μm
Lack of Mxc leads to premature accumulation of nuclear Pros in NBs. A–E’ Confocal images of the third-instar larval brains of wt (A–A’), mxc RNAi (THU0893, THU5844) (B–C’), mxc RNAi with UAS-Mxc (D–D’) and UAS-Mxc (E–E’), labeled by anti-Pros (red) and anti-Dpn (green). In wt larval central brains, no nuclear Pros was detected in the NBs. Pros (arrowheads) was detected in the nucleus of NBs in mxc RNAi lines. This phenotype was rescued by UAS-Mxc. No phenotypes were detected in UAS-Mxc lines. All of these lines were driven by wor-Gal4. CB represents the central brain region, and OL represents the optical lobe region. Scale bars: 20 μm. F Statistics on nuclear Pros in the NBs in larval central brains of wt, mxc RNAi and Mxc rescue. The data are plotted as mean ± SD. **p < 0.01 using a Student’s t test, p = 0.0010. Numbers of NBs counted N = 360, N = 740, N = 69, N = 108, N = 187, respectively. G Schematic of Mxc protein structures in wt, mxc, and mxc. The 1837–amino acid Mxc protein contains a LisH domain (amino acids 6–38) and a SIF domain (amino acids 39–185) at the N-terminal, as well as a AT-hook motif at residues 1523–1535. mxc contains a deletion of 4 bp (TTCG) at the F1823 residue of Mxc, resulting in a frameshift at the C-terminal. It encodes an 1868–amino acid protein. mxc encodes a nonsense mutation at the N480 residue of the Mxc protein, resulting in a truncated protein containing 510 amino acids [10, 32]. H Statistics on nuclear Pros in the neuroblasts in larval central brain of wt, mxc and Mxc rescue. The data are plotted as mean ± SD. ***p < 0.001 using a Student’s t test, p = 0.0007. Numbers of neuroblasts counted N = 360, N = 373, N = 153, respectively. I The protein levels of Mxc were decreased in mxc knockdown larval brains compared to wt. MPM-2 antibody was used to recognize Mxc signals in this experiment. (J–L’) Confocal images of the larval brains of wt (J–J’), mxc (K–K’), and mxc with UAS-Mxc (L–L’) at 120 h AEL, labeled by anti-Pros (red), anti-Dpn (green), and Dapi (blue). Pros (arrowheads) was detected in the nucleus of mxc larval NBs (K). This phenotype was well rescued by worniu driven UAS-Mxc (L). Scale bars: 20 μm. (M–N’) MARCM clones of wt (M–M’) and mxc (N–N’) in third-instar larval brains, labeled by anti-Pros (red), anti-Dpn (blue) and anti-GFP (green). Nuclear Pros (arrowhead) was not detected in wt NBs (M), but was detected in mxc NBs (N). Numbers of clones observed n = 3, n = 3, respectively. Scale bars: 10 μmWe further confirmed the phenotype using two mxc mutant lines, mxc, and another mxc (From BDSC; Fig. 2G). mxc contains a nonsense mutation at residues N480 of the Mxc protein, resulting in a truncated protein [5]. The hemizygotes of mxc die as first or second instar larvae [32]. As expected, nuclear Pros was observed in the NBs of mxc third-instar larval brain at 120 hours AEL (After Eggs Laying; 19.71%, n = 373; Fig. 2J–L’, H), and the phenotype was effectively rescued by overexpressing exogenous Mxc (2.00%, n = 153; Fig. 2L, H). Since the hemizygote of mxc died at the first or second instar larval stage, we performed MARCM analysis on mxc (Fig. 2M, N’) [33]. The immunofluorescent staining also showed nuclear Pros in the mxc homozygous lineages (Fig. 2N). This was consistent with the RNAi experimental data. We employed the THU0893 line (referred as the mxc RNAi line) for the following experiments.
Mxc maintains the NB number and cell fate in larval central brains
We quantified the NB numbers in the brain lobes at the 3rd instar larval stage (120 h AEL) for both wt and mxc knockdown animals (Fig. 3A). In the wt brain lobes, the average number of total Dpn+ NBs per lobe at 120 h AEL was 72.0 (n = 5 lobes), while in mxc knockdown lines, the average number of NBs was reduced to 38.5 (n = 6 lobes; Fig. 3A). In this way it appears that about half of the NBs in mxc knockdown brains were missing at the late third-instar larval stage. To exclude the possibility that apoptosis was the cause for NB number changes, wt and mxc knockdown larval brains were stained with anti-Caspase 3. No obvious signal was identified in either wt or mxc knockdown NBs (Additional file 1: Fig. S1). The cell sizes of the NBs in the mxc RNAi lines had also remained unchanged from those of the wt (Additional file 1: Fig. S2).
Fig. 3
Mxc is required for NB proliferation and cell fate maintenance.
A Statistical analysis of the numbers of NBs at different developmental stages (96 and 120 hours AEL) in wt and mxc RNAi brain lobes. Dpn+ cells larger than 8µm in diameter were considered NBs [25]. The data are plotted as mean ± SD. ****p < 0.0001 using a Student’s t test, p = 2.555E–05 and 7.502E–06, respectively. Numbers of brain lobes counted N = 5, N = 5, N = 5, N = 6, respectively. B Statistics on nuclear Pros in the NBs in mxc RNAi larval central brain at various developmental stages of 48, 72, 96 and 120 hours AEL (After Eggs Laying). The data are plotted as mean ± SD. *p < 0.05 and ****p < 0.0001 using a Student’s t test, p = 0.0160 and 3.574E–06, respectively. Numbers of NBs counted N = 239, N = 112, N = 310, N = 740, respectively. C, D Third-instar larval brains containing Type-I NB FLP-out clones of wt (C) and mxc RNAi (D), labeled by anti-GFP (green), anti-Dpn (blue) and anti-Pros (red). Doted circles mark the location of the NBs. wt clone showing one large NB with dozens of small daughter cells (C). mxc RNAi clone showing one large NB and fewer daughter cells in one lineage (D). Scale bars: 10 µm. E Statistical analysis of the numbers of cells in each wt lineage and mxc RNAi lineage. The data are plotted as mean ± SD. ****p < 0.0001 using a Student’s t test, p = 3.620E-08. Numbers of clones counted N = 5, N = 11, respectively. F–G’ Third-instar larval brains of wt (F–F’) and mxc RNAi (G–G’), labeled by anti-Dpn (red), anti-Pros (green) and anti-PH3(blue). No differences of PH3 signals in NBs between wt (F) and mxc knockdown (G) were observed. Scale bars: 20 μm. H–I’ Z-axis projection of third-instar larval brains of wt (H–H’) and mxc RNAi (I–I’), labeled by EdU (red) and anti-Dpn (green). EdU was stained for 30 min. EdU signals were detected in wt central brain (H). Much less EdU signals were detected in mxc RNAi central brain (I). Scale bars: 20 μm
To determine the time window when the observed premature NB cell fate termination had occurred, we used nuclear Pros as a marker to quantify the ratio of NBs with nuclear Pros at different developmental stages (Fig. 3B). At the second instar larval stage (48 and 72 h AEL) nuclear Pros remained undetected (48 h AEL: 0.71%, n = 239; 72 h AEL: 0.94%, n = 112; Fig. 3B). The nuclear Pros phenotype was first observed at the early third-instar larval stage (96 h AEL; 11.00%, n = 310; Fig. 3B). The average numbers of total NBs per lobe at 96 h AEL was also quantified. The number of NBs in mxc RNAi brains was slightly lower than those in the controls (wt:71.6, n = 5 lobes; mxc RNAi:65.8, n = 5 lobes; Fig. 3A). These data indicate that the NBs in mxc knockdown brains begin premature termination at the early third-instar larval stage and shows about half of the NBs missing by the late third-instar larval stage (120 h AEL).We next performed FLP-out mosaic analysis on mxc RNAi lines [34], to evaluate the effects of mxc knockdown on the proliferation of NBs. We focused on Type I NB lineages. As shown in Fig. 3C–E, GFP-labeled clonal lineages containing mxc knockdown NBs were significantly smaller than those of the wt (wt: 42.40 cells, n = 5 clones; mxc RNAi: 7.18 cells, n = 11 clones). This indicates that, over a given time, cell cycling becomes limited in mxc knockdown NBs. In addition, the six-fold cell number difference between the wt and the mxc knockdown NB lineages also suggests that the cell cycles of GMCs have either become elongated or arrested. To further confirm this, wt and mxc knockdown larval brains were stained with anti-PH3 (Fig. 3F–G’). No obvious differences of PH3 signals in NBs between wt and mxc knockdown were observed (Fig. 3F, G). We carried out a standard EdU incorporation experiment (Fig. 3H–I’) and observed far fewer EdU signals in mxc knockdown NBs (Fig. 3I), indicating that the lack of Mxc had led to slower rate of cell cycling. These data indicate that Mxc is required for the maintenance of NB cell fate and proliferation in Drosophila larval brains.Mxc is required for NB proliferation and cell fate maintenance.
A Statistical analysis of the numbers of NBs at different developmental stages (96 and 120 hours AEL) in wt and mxc RNAi brain lobes. Dpn+ cells larger than 8µm in diameter were considered NBs [25]. The data are plotted as mean ± SD. ****p < 0.0001 using a Student’s t test, p = 2.555E–05 and 7.502E–06, respectively. Numbers of brain lobes counted N = 5, N = 5, N = 5, N = 6, respectively. B Statistics on nuclear Pros in the NBs in mxc RNAi larval central brain at various developmental stages of 48, 72, 96 and 120 hours AEL (After Eggs Laying). The data are plotted as mean ± SD. *p < 0.05 and ****p < 0.0001 using a Student’s t test, p = 0.0160 and 3.574E–06, respectively. Numbers of NBs counted N = 239, N = 112, N = 310, N = 740, respectively. C, D Third-instar larval brains containing Type-I NB FLP-out clones of wt (C) and mxc RNAi (D), labeled by anti-GFP (green), anti-Dpn (blue) and anti-Pros (red). Doted circles mark the location of the NBs. wt clone showing one large NB with dozens of small daughter cells (C). mxc RNAi clone showing one large NB and fewer daughter cells in one lineage (D). Scale bars: 10 µm. E Statistical analysis of the numbers of cells in each wt lineage and mxc RNAi lineage. The data are plotted as mean ± SD. ****p < 0.0001 using a Student’s t test, p = 3.620E-08. Numbers of clones counted N = 5, N = 11, respectively. F–G’ Third-instar larval brains of wt (F–F’) and mxc RNAi (G–G’), labeled by anti-Dpn (red), anti-Pros (green) and anti-PH3(blue). No differences of PH3 signals in NBs between wt (F) and mxc knockdown (G) were observed. Scale bars: 20 μm. H–I’ Z-axis projection of third-instar larval brains of wt (H–H’) and mxc RNAi (I–I’), labeled by EdU (red) and anti-Dpn (green). EdU was stained for 30 min. EdU signals were detected in wt central brain (H). Much less EdU signals were detected in mxc RNAi central brain (I). Scale bars: 20 μm
Absence of Mxc results in the ectopic expression of Dpn in GMCs
In the central brains of the wt larvae, the stem cell marker Dpn is expressed in NBs and mature INPs, but not in GMCs [22, 23, 25]. In addition to normal large sized NBs, we observed many smaller Dpn positive (Dpn+) cells in mxc knockdown larval brains (Fig. 4A, B). The sizes of these extra Dpn+ cells were similar to those of GMCs. To estimate total numbers of Dpn+ cells in the central brain, we quantified all Dpn+ cells in each brain lobe. An average of 129.0 Dpn+ cells/lobe (n = 6 lobes) in wt brains and 276.5 Dpn+ cells/lobe (n = 4 lobes) in mxc knockdown brains were observed (Fig. 4C). This more than two-fold change in Dpn+ cell number suggest that more cells are in an undifferentiated state in the absence of Mxc. Since the total number of NBs decreased in mxc knockdown brains (Fig. 3A), it is most likely that GMC-like neural precursor cells with Dpn expression contribute to the increased Dpn+ populations. As the total number of GMCs is much larger than that of INPs, we focused on the possibility that in the absence of Mxc, large numbers of GMC-like cells, if not all, displayed altered cell fates and ectopically expressed Dpn.
Fig. 4
Absence of Mxc results in ectopic expression of Dpn in the progeny of NBs. A, B Confocal images of the third-instar larval brains of wt (A) and mxc RNAi (B), labeled by anti-Dpn (red). Compared to the control (A), more Dpn+ cells were shown in mxc RNAi central brains (B). Different cell cycle stages may affect the patterns of Dpn in NB nucleus. (C) Statistical analysis of the numbers of Dpn+ cells in the larval central brains of wt and mxc RNAi lines. The data are plotted as mean ± SD. ****p < 0.0001 using a Student’s t test, p = 5.709E–07. Numbers of brain lobes counted N = 6, N = 4, respectively. D–E’ Third-instar larval brains containing Type-I NB FLP-out clones of wt (D–D’) and mxc RNAi (E–E’), labeled by anti-Dpn (red) and anti-GFP (green). In the wt clone (D), Dpn was only expressed in the NBs. In the mxc RNAi clone (E), Dpn was detected in the GMCs (arrowheads). Scale bars: 10 μm. F–G’ Type I NB MARCM clones of wt (F–F’) and mxc (G–G’) in third-instar larval brains, labeled by anti-Dpn (red) and anti-GFP (green). Dpn (arrowheads) was detected in the GMCs in mxc clone (G), but not in wt GMCs (F). Scale bars: 10 μm
We then established mxc RNAi FLP-out clones to analyze the pattern of Dpn in Type I NB lineages (Fig. 4D–E’). In the wt Type I NB lineages, the NB was the only Dpn+ cell (Fig. 4D). However, as judged by cell sizes, in mxc knockdown lineages not just NBs but also GMCs were Dpn positive (Fig. 4E). Similar experiments were carried with genetic mutants (Fig. 4F–G’). In mxc Type I NB MARCM clones, the GMCs were also Dpn+ (Fig. 4G). This was identical to the RNAi data (Fig. 4E). These Dpn+ GMC-like cells became the major populations of Dpn+ cells in the mxc knockdown larval brains. We concluded that Mxc acts to suppress the expression of Dpn in GMCs and promotes GMC differentiation.Absence of Mxc results in ectopic expression of Dpn in the progeny of NBs. A, B Confocal images of the third-instar larval brains of wt (A) and mxc RNAi (B), labeled by anti-Dpn (red). Compared to the control (A), more Dpn+ cells were shown in mxc RNAi central brains (B). Different cell cycle stages may affect the patterns of Dpn in NB nucleus. (C) Statistical analysis of the numbers of Dpn+ cells in the larval central brains of wt and mxc RNAi lines. The data are plotted as mean ± SD. ****p < 0.0001 using a Student’s t test, p = 5.709E–07. Numbers of brain lobes counted N = 6, N = 4, respectively. D–E’ Third-instar larval brains containing Type-I NB FLP-out clones of wt (D–D’) and mxc RNAi (E–E’), labeled by anti-Dpn (red) and anti-GFP (green). In the wt clone (D), Dpn was only expressed in the NBs. In the mxc RNAi clone (E), Dpn was detected in the GMCs (arrowheads). Scale bars: 10 μm. F–G’ Type I NB MARCM clones of wt (F–F’) and mxc (G–G’) in third-instar larval brains, labeled by anti-Dpn (red) and anti-GFP (green). Dpn (arrowheads) was detected in the GMCs in mxc clone (G), but not in wt GMCs (F). Scale bars: 10 μm
The nuclear localization of Pros in NBs and the differentiation of GMCs depend on Mxc-mediated HLB assembly and histone gene transcription
Mxc is a key component of the HLB (Additional file 1: Fig. S3). Using MPM-2 and anti-Mute antibodies, we observed that Mxc was colocalized with another component of HLB, Mute [5, 10, 35, 36], in the nucleus of wt NBs, forming unambiguous nuclear foci (arrowhead; Additional file 1: Fig. S4A). The localization of Mute in HLB was Mxc-dependent [5]. In mxc knockdown NBs no MPM-2 puncta were detected and the Mute staining pattern was less condensed and with increased numbers of multiple smaller puncta observed compared to the wt (Additional file 1: Fig. S4B–B”). Overexpression of Mxc in mxc RNAi NBs reversed this phenotype; MPM-2 and Mute restored colocalization at nuclear foci (arrowheads; Additional file 1: Fig. S4C–C”). These data indicate that, in the absence of Mxc, Mute is less condensed and exhibits multiple dot-shaped distributions. Additional experiments were carried out with mxc mutants and mxc MARCM clones. Similar results were observed in both two mutant lines (Additional file 1: Fig. S4D–G”). These results confirm that knockdown mxc in larval brain NBs leads to less organized Mute distribution which ultimately impairs HLB assembly.We considered whether the absence of Mxc would affect the transcription of histone genes in third-instar larval brains. An elav-GAL4 line was used to drive mxc RNAi in the larval brains. qPCR analyses showed that the transcription levels of five canonical histone genes were all significantly decreased in both mxc knockdown (Fig. 5A) and mxc mutant larval brains (Fig. 5B). Western blot also showed that His3 protein levels had decreased in the mxc knockdown larval brains (Fig. 5C), which was consistent with our qPCR results.
Fig. 5
Knocking down or recapitulates the phenotypes. A, B Quantitative RT-PCR results revealed that transcription levels of canonical histone genes were decreased in mxc RNAi (A) and mxc (B) larval brains. The data are plotted as mean ± SD. ****p < 0.0001, ***p < 0.001 and **p < 0.01 using a Student’s t test, p = 0.0003, 0.0002, 7.758E–05, 0.0001, 0.0014 in (A) and 0.0006, 0.0003, 0.0007, 0.0013, 4.019E-05 in (B), respectively. Both of the numbers of repetitions N = 3. C The western blot results shown that the protein levels of His3 are reduced in mxc knockdown larval brain compared to wt. D–F’ Third-instar larval brains of wt (D–D’), His3 RNAi (E–E’), and His4 RNAi (F–F’), labeled by anti-Pros (red) and anti-Dpn (green). Pros (arrowheads) was detected in the nucleus of NBs in both His3 (E) and His4 (F) RNAi lines. Scale bars: 20 μm. G Statistical data of nuclear Pros in the NBs in wt, His3 RNAi, His4 RNAi, and mxc RNAi larval central brain. The data are plotted as mean ± SD. **p < 0.01 and ***p < 0.001 using a Student’s t test, p = 0.0037 and 9.958E-04, respectively. Numbers of NBs counted N = 360, N = 740, N = 151, N = 85, N = 740, respectively. H–J’ Type-I NB FLP-out clones of wt (H–H’), His3 RNAi (I–I’) and His4 RNAi J–J’, labeled by anti-Dpn (red) and anti-GFP (green). In wt clones (H), Dpn was only expressed in the NBs. In both His3 and His4 RNAi clones (I, J), Dpn was detected in the GMCs (arrowheads). Scale bars: 10 μm. K Statistical analysis of the numbers of Dpn+ cells in the larval central brains of wt, His3 RNAi, His4 RNAi and mxc RNAi lines. The data are plotted as mean ± SD. **p < 0.01 using a Student’s t test, p = 0.0075 and 0.0070, respectively. Numbers of brain lobes counted N = 6, N = 5, n = 4, N = 4, respectively
Knocking down or recapitulates the phenotypes. A, B Quantitative RT-PCR results revealed that transcription levels of canonical histone genes were decreased in mxc RNAi (A) and mxc (B) larval brains. The data are plotted as mean ± SD. ****p < 0.0001, ***p < 0.001 and **p < 0.01 using a Student’s t test, p = 0.0003, 0.0002, 7.758E–05, 0.0001, 0.0014 in (A) and 0.0006, 0.0003, 0.0007, 0.0013, 4.019E-05 in (B), respectively. Both of the numbers of repetitions N = 3. C The western blot results shown that the protein levels of His3 are reduced in mxc knockdown larval brain compared to wt. D–F’ Third-instar larval brains of wt (D–D’), His3 RNAi (E–E’), and His4 RNAi (F–F’), labeled by anti-Pros (red) and anti-Dpn (green). Pros (arrowheads) was detected in the nucleus of NBs in both His3 (E) and His4 (F) RNAi lines. Scale bars: 20 μm. G Statistical data of nuclear Pros in the NBs in wt, His3 RNAi, His4 RNAi, and mxc RNAi larval central brain. The data are plotted as mean ± SD. **p < 0.01 and ***p < 0.001 using a Student’s t test, p = 0.0037 and 9.958E-04, respectively. Numbers of NBs counted N = 360, N = 740, N = 151, N = 85, N = 740, respectively. H–J’ Type-I NB FLP-out clones of wt (H–H’), His3 RNAi (I–I’) and His4 RNAi J–J’, labeled by anti-Dpn (red) and anti-GFP (green). In wt clones (H), Dpn was only expressed in the NBs. In both His3 and His4 RNAi clones (I, J), Dpn was detected in the GMCs (arrowheads). Scale bars: 10 μm. K Statistical analysis of the numbers of Dpn+ cells in the larval central brains of wt, His3 RNAi, His4 RNAi and mxc RNAi lines. The data are plotted as mean ± SD. **p < 0.01 using a Student’s t test, p = 0.0075 and 0.0070, respectively. Numbers of brain lobes counted N = 6, N = 5, n = 4, N = 4, respectivelyTo clarify that the reduced histone gene expression is responsible for the mxc knockdown-induced NB phenotypes in larval brain, we performed knockdown of either His3 or His4 in larval brains and characterized the phenotypes. Nuclear Pros was observed in NBs of both two His3 RNAi and His4 RNAi lines (His3 RNAi:23.03%, n = 151; His4 RNAi:16.34%, n = 85; Fig. 5D–G), indicating a premature termination of NB cell fate. Quantification of the Dpn+ cells in each brain lobe of His3 RNAi and His4 RNAi lines showed that averages of 194.4 Dpn+ cells (n = 4 lobes) in His3 knockdown brain lobes and 183.3 Dpn+ cells (n = 3 lobes) in His4 knockdown brain lobes represented significant increases beyond those of the wt (129, n = 6 lobes; Fig. 5K). Furthermore, His3 RNAi and His4 RNAi FLP-out clones in Type I NB also confirmed that Dpn was ectopically expressed in the GMCs in both His3 (Fig. 5H-) and His4 knockdown lineages (Fig. 5J–J’). These data indicate that reduced transcription of histone genes contribute to the blockage of GMC differentiation.As canonical histones make up the nucleosomes that package the genome to form chromatin [37], a reduction in canonical histone gene transcription of may cause DNA damage and genomic instability. We used anti-phosphorylated H2Av, a marker of DNA double-strand breaks (DSBs) [38-40], to visualize DNA damages in mxc knockdown larval brains (Additional file 1: Fig. S5). Obvious phosphorylated H2Av signals were observed (arrowheads; Additional file 1: Fig. S5B), suggesting occurrences of DSBs in the NBs of mxc RNAi lines. We also stained the larval brains of His3 and His4 RNAi lines with anti-phosphorylated H2Av and observed similarly phosphorylated H2Av signals in these NBs (arrowheads; Additional file 1: Fig. S5C, D). This indicates that knockdown of His3 or His4 recapitulates the mxc phenotypes. Taken together, these results demonstrate that Mxc-mediated HLB assembly and histone gene transcription are critical for the maintenance of NBs cell fate and their progeny in larval brains.
The increase in autophagy induced by mxc knockdown as a defense mechanism in NBs
Persistent DNA DSBs can represent genotoxic stress on a cellular level, in which the DNA damage response (DDR) pathway is activated to combat this, which induces a variety of biological processes [41]. Autophagy, a lysosome-dependent degradation pathway, is one of the processes activated via the DDR pathway [42, 43]. According to previous reports, autophagy is thought to have dual roles in responding to DNA damage [44-48]. To explore whether autophagy is activated in mxc knockdown NBs, we stained wt and mxc knockdown larval brains with anti-Atg8a, a marker of autophagosomes [49]. In wt NBs, only a basal Atg8a signal was detected (Fig. 6A), suggesting autophagy only occurred at a low level. In contrast, an increased signal of Atg8a puncta was observed in the cytoplasm of mxc knockdown NBs (arrowheads; Fig. 6B), indicating an accumulation of autophagosomes. We quantified the Atg8a puncta in wt and mxc knockdown NBs (Fig. 6C). The number of dots per NB in mxc knockdown lines (2.30; n = 87) was significantly higher than that in the wt NBs (0.52; n = 60). To further verify the activation of autophagy, exogenous ATG8a-GFP was expressed as a visual reporter of autophagosome in NBs (Additional file 1: Fig. S6D, E). ATG8a-GFP puncta were clearly observed as accumulated in the cytoplasm of mxc knockdown NBs (arrowheads; Additional file 1: Fig. S6E), but with almost no obvious corresponding signals in wt NBs (Additional file 1: Fig. S6D). Similar experiments were carried out with mxc mutants (Additional file 1: Fig. S6A, B). The number of ATG8a-GFP dots per NB in mxc mutants (3.48; n = 50) were also significantly higher than that those of wt NBs (0.33; n = 57; Additional file 1: Fig. S6C). These results were consistent with mxc knockdown data, indicating that mxc deficiency triggers an increased autophagy in NBs.
Fig. 6
Autophagy was activated to inhibit the production of Dpn
+ GMCs in knockdown NBs. A–B’ Third-instar larval brains of wt (A–A’) and mxc RNAi (B–B’), labeled by anti-Dpn (red) and anti-Atg8a (green). In wt larval central brain (A), only basic signals of Atg8a were detected. In mxc RNAi larval central brain (B), an increased number of Atg8a puncta (arrowheads) was detected in the cytoplasm of the NB. Scale bars: 20 μm. C Statistical analysis of autophagy levels in the NBs of wt and mxc RNAi larval central brains. The data are plotted as mean ± SD. ****p < 0.0001 using a Student’s t test, p = 1.764E-08. Numbers of NBs counted N = 60, N = 87, respectively. D–G Third-instar larval brains of wt (D), Atg1 RNAi (E), mxc RNAi (F) and Atg1 RNAi, mxc RNAi double knockdown (G) lines, labeled by anti-Dpn (red). Atg1 RNAi (E) larval brains showed the same phenotype as the wt (D). Central brains in Atg1 RNAi, mxc RNAi double knockdown lines (G) showed more Dpn+ cells than those in mxc RNAi lines (F). Scale bars: 20 μm. (H) Statistical data of the numbers of Dpn+ cells in the larval central brains of wt, mxc RNAi, Atg1 RNAi and Atg1 RNAi, mxc RNAi double knockdown lines. The data are plotted as mean ± SD. **p < 0.01 and ns not significant using a Student’s t test, p = 0.0043 and 0.6104, respectively. Numbers of brain lobes counted N = 6, N = 4, N = 4, N = 3, respectively
Autophagy was activated to inhibit the production of Dpn
+ GMCs in knockdown NBs. A–B’ Third-instar larval brains of wt (A–A’) and mxc RNAi (B–B’), labeled by anti-Dpn (red) and anti-Atg8a (green). In wt larval central brain (A), only basic signals of Atg8a were detected. In mxc RNAi larval central brain (B), an increased number of Atg8a puncta (arrowheads) was detected in the cytoplasm of the NB. Scale bars: 20 μm. C Statistical analysis of autophagy levels in the NBs of wt and mxc RNAi larval central brains. The data are plotted as mean ± SD. ****p < 0.0001 using a Student’s t test, p = 1.764E-08. Numbers of NBs counted N = 60, N = 87, respectively. D–G Third-instar larval brains of wt (D), Atg1 RNAi (E), mxc RNAi (F) and Atg1 RNAi, mxc RNAi double knockdown (G) lines, labeled by anti-Dpn (red). Atg1 RNAi (E) larval brains showed the same phenotype as the wt (D). Central brains in Atg1 RNAi, mxc RNAi double knockdown lines (G) showed more Dpn+ cells than those in mxc RNAi lines (F). Scale bars: 20 μm. (H) Statistical data of the numbers of Dpn+ cells in the larval central brains of wt, mxc RNAi, Atg1 RNAi and Atg1 RNAi, mxc RNAi double knockdown lines. The data are plotted as mean ± SD. **p < 0.01 and ns not significant using a Student’s t test, p = 0.0043 and 0.6104, respectively. Numbers of brain lobes counted N = 6, N = 4, N = 4, N = 3, respectivelyWe performed knockdown of Atg1, a key gene of the autophagy pathway [50, 51], in the NBs of both wt and mxc knockdown lines (Fig. 6D–H). No obvious phenotype was observed in Atg1 knockdown wt larval brains (Fig. 6E, H), which was consistent with the low levels of autophagy detected above (Fig. 6A). In Atg1 and mxc double knockdown larval brains, more GMC-like Dpn+ cells were detected, as compared with that in only mxc knockdown larval brains (Fig. 6F, G). Quantification showed a higher number with about 368 Dpn+ cells/lobe (n = 4 lobes) in double knockdown brain lobes, as compared with that in mxc knockdown brains, with about 276.5 Dpn+ cells/lobe (n = 4 lobes; Fig. 6H). These data suggest that elevated autophagy induced by Mxc deficiency in NBs might be a defense mechanism responding to abnormal HLB assembly and consequently pre-terminated NB cell fate.
Discussion
NPAT/Mxc is a component of the HLB, participating in transcription of canonical histone genes and in pre-mRNA processing [5, 10]. Although NPAT gene has been reported as a candidate gene for mental retardation, no genetic mutations of NPAT gene have been found in clinic cases. Our study shows that knockdown mxc in larval brain NBs causes the reduction of transcription levels of histone genes and increased DNA DSBs. These defects lead to premature termination of NB cell fate and blockage of GMC differentiation processes, resulting in neuronal and locomotion defects in adult flies.In mxc knockdown flies, total NB numbers decrease and its proliferation potential is disrupted, leading to severe neuronal loss in the adult central brain. The mutant flies show locomotion disorder and survive no more than two days after eclosion. It is notable that the hemizygotes of mxc die as late larvae or early pupae. NB specific overexpression of Mxc in mxc mutants rescues these animals, at least to the late pupal stage. Some of these flies then go on to survive to adulthood without obvious mobility problems. This indicates that mxc mutant lethality at larval or early pupal stage is mainly due to the disruption of CNS development. Such results support the hypothesis that NPAT/mxc deficiency could act as a pathogenic factor for neurodevelopmental disorders such as mental retardation.Notably the hemizygotes of mxc exhibits weaker phenotype of nuclear Pros in NBs and die as late larvae or early pupae. Since mxc mutation only occurred from the 1824 aa at the very C-terminal end with the rest aa sequence unchanged, it is likely that the very C-terminal sequence is required for colocalization of MPM2 and Mute in NBs while some other domain(s) resided within unchanged N-terminal region maintain(s) function to prevent nuclear Pros formation.It has been reported that the ectopic expression of Dpn in immature INP cells can transform these cells into NBs-like cells that divide uncontrollably, causing tumor formation [23]. Although Dpn+ GMCs might have proliferation potential, no tumor over-growth phenotype is observed in our study. This may reflect the fact that in addition to NBs, the cell-cycles of GMCs in mxc knockdown lines are also slowed down or even arrested. The slowed down cell cycle seems to protect NBs and GMCs from tumor over-growth. We propose that in wt NBs, Mxc acts to suppress Dpn expression in GMCs and promotes GMC differentiation. This conclusion is consistent with notion that in the absence of Mxc functions, large populations of GMC-like cells continue to express Dpn, and their differentiation process is blocked. The results from His3 and His4 RNAi lines also show Dpn+ GMCs phenotypes consistent to the mxc data.DSBs are often considered to be a factor for tumor formation [52]. A previous report demonstrated that mxc knockdown and mxc led to larval lymph gland hyperplasia [14]. Interestingly, in our study, although knockdown of mxc or histone genes cause severe DSBs in the larval brains, there was no evidence suggesting the over-growth of NBs or GMCs. Such a discrepancy of Mxc function between lymph gland cells [14] and NBs could possibly be due to the cell fate determinant, Pros. The premature accumulation of nuclear Pros in larval brain NBs is likely to be a mechanism to prevent NBs from over-proliferation when under a state of DSBs stress or perhaps under other instances of genomic instability. Similar results have been reported in that ionizing radiation treatments are noted to induce both DSBs and prematurely accumulated nuclear Pros in Drosophila larval brain NBs [53], with no NB over-proliferation observed. Premature nuclear Pros, that early terminates the NB cell fate and diminishes their proliferative properties, may play a role as a protective mechanism to avoid NB over-growth.Autophagy is a conserved cellular process which can be induced under stress conditions such as nutrient starvation or DNA damage [43, 54]. At present, no data has been presented describing the role of autophagy in the larval brain NB development of Drosophila. Based on our data, autophagy shows a protective role against Dpn+ GMC formation. In the wt larval brain NBs, autophagy is kept at a low level. However, the autophagy levels are elevated in mxc knockdown NBs. Blocking the autophagy process by knocking down Atg1 enhances the Dpn+ GMC population. Although autophagy does not appear to be required in wt larval brain NBs under normal conditions, it represents a protective function under the DSBs stress induced by mxc knockdown.
Conclusions
Our study revealed the functions of Mxc in the CNS development (Fig. 7). The lack of canonical histone genes caused by mxc knockdown leads to lower NB proliferation potential and premature termination of NB cell fate, as well as blockage of differentiation process of GMCs, which ultimately results in neuronal defects in adult flies. Our study provides the first important clue that NPAT/mxc may act as a pathogenic factor for neurological disease, potentially those related to mental retardation.
Fig. 7
Diagram depicting the mechanisms of neuronal and locomotion defects caused by mxc knockdown in Drosophila larval brain NBs. A In wt, Mxc is required for HLB assembly and histone transcription, which maintains genomic stability and CNS development. B The absence of Mxc impairs HLB assembly which in turn reduces the transcription levels of canonical histone genes and induces DSBs. NB proliferation and GMC differentiation is affected under this stress, resulting in neuronal and locomotion defects in adult flies. Nuclear Pros is prematurely accumulated in third-instar larval brain NBs to terminate NB cell fate, potentially protecting from NB over-growth. Autophagy is also elevated in mxc knockdown NBs to impede Dpn+ GMC formation
Diagram depicting the mechanisms of neuronal and locomotion defects caused by mxc knockdown in Drosophila larval brain NBs. A In wt, Mxc is required for HLB assembly and histone transcription, which maintains genomic stability and CNS development. B The absence of Mxc impairs HLB assembly which in turn reduces the transcription levels of canonical histone genes and induces DSBs. NB proliferation and GMC differentiation is affected under this stress, resulting in neuronal and locomotion defects in adult flies. Nuclear Pros is prematurely accumulated in third-instar larval brain NBs to terminate NB cell fate, potentially protecting from NB over-growth. Autophagy is also elevated in mxc knockdown NBs to impede Dpn+ GMC formation
Materials and methods
Fly stocks and genetics
All flies were maintained at 25℃. The Drosophila stocks (and their sources), used in this study include: w, UAS-Dicer2; wor-GAL4, mxc (THU0893 and THU5844, Tsinghua Drosophila center), mxc (7133, BDSC), mxc (7128, BDSC), His3 (THU4319, Tsinghua Drosophila center), His4 (109,060, VDRC), Atg1 (THU2357, Tsinghua Drosophila center), elav-GAL4, UAS-Atg8a-GFP (51,656, BDSC).UAS-Mxc was generated in this study. To generate pUAST-mxc construct, the full‐length mxc cDNA was amplified with the primers 5′‐CGGAATTCATGGAGTCGATTGTCCTGCATTC‐3′ and 5′‐TAAAGCGGCCGCTCAGGTGCCGTGCAGATGTGA‐3′. The sequence was cloned into a pUAST vector. The construct was injected into the VK33 lines at the Core Facility of Drosophila Resource and Technology, CEMCS, CAS, following standard methods.MARCM analysis were performed as previously described [33, 55]. For mxc clones, we used the fly line with the genotype of hsFLP, P{FRT}19 A tub-GAL80/FM6; wor-GAL4, UAS-CD8-GFP/CyO as the tool. P{FRT}19 A mxc/FM6 was obtained by homologous recombination of lines P{FRT}19 A (1744, BDSC) and mxc/FM7c (7128, BDSC). The MARCM clones were GFP labeled.For FLP-out mosaic analysis, the fly line with the genotype of hsFLP; act > y>GAL4, UAS-CD8-GFP was used to cross with RNAi lines [34]. The FLP-out clones were labeled with GFP. Both MARCM clones and RNAi FLP-out clones were induced using a 45 min heat-shock treatment of 37 °C at 32–36 h after egg laying.
Antibody generation
The sequence of Mute for the antibody, aa 3-164, was selected according to Bulchand’s work [36]. The sequence was cloned into a pGEX-4T-1 expression vector. The antigen was bacterially produced and the antibody was raised in guinea pigs.
Immunofluorescence staining and antibodies
Different stages of larval brains and adult brains were dissected in ice-cold Schneider’s Drosophila Medium (Gibco). Samples were fixed for 18 min in PBS (10 mM NaH2PO4/Na2HPO4, 175 mM NaCl, pH7.4) with 4% paraformaldehyde at room temperature [55, 56]. The samples were incubated with primary antibodies at 4℃ overnight, and then with secondary antibodies at room temperature for 1–2 h. Antifade Mounting Medium (P0126, Beyotime, China) was used to protect the fluorescent signals of the samples. The images were obtained using an Olympus FV1000 confocal microscope and processed using Adobe Photoshop CC 2018.The primary antibodies in this study were as follows: mouse anti-Pros (1:50, DSHB); guinea pig anti-Dpn (1:1000, a gift from Y. Cai); rabbit anti-Ase (1:1000, a gift from Y. Cai); chicken anti-GFP (1:1000, ab13970, Abcam); rabbit anti-Mute (1:1000, this study); mouse MPM-2 (1:1000, 05-368MG, Sigma-Aldrich); rabbit anti-Caspase 3 (1:1000, Asp175, Cell Signaling); rabbit anti-Phospho-Histone3 (Ser10) (1:1000, Millipore); rat anti-Elav (1:50, DSHB); rabbit anti-Histone H2AvD pS137 (1:1000, Rockland); rabbit anti-GABARAP + GABARAPL1 + GABARAPL2, used as anti-Atg8a in Drosophila (1:200, ab109364, Abcam) [49]. All commercial secondary antibodies used were from the Jackson Laboratory. DNA was stained with DAPI (C1002, Beyotime) at 1:2000. For EdU analysis, samples were incubated for 30 min in 5 mM EdU before fixing, using Click-iT EdU Imaging Kits (Alexa Fluor 555) (C10338, Invitrogen).
Western blot
Third-instar larval brains were lysed in RIPA lysis buffer [50 mM Tris-HCl pH 8.0, 150 mM NaCl, 0.5% sodium deoxycholate, 0.1% SDS, 1% IGEPAL CA-630 and complete protease inhibitor cocktail (Roche)]. About 30 brains were lysed in each sample. Samples were subjected to SDS‐PAGE and transferred to a polyvinylidene fluoride membrane. Mouse anti-His3 (1:1000; Active Motif) and mouse anti-β-Tubulin (1:1000; DSHB) were used as primary antibodies, and HRP, anti‐mouse (1:5000; Abcam) were used as secondary antibodies.
Quantitative RT-PCR
RNA was extracted by the TRIzol (Invitrogen) method. About 30 brains of third-instar larvae were dissected for each sample. HiScript III 1st Strand cDNA Synthesis Kit (Vazyme, China) was used for reverse transcription according to the manufacturer’s protocol. Note that it was necessary to select Random hexamers rather than Oligo (dT) for reverse transcription of histone mRNA.7900HT Fast Real-Time PCR System (Applied Biosystems) was used for quantitative RT-PCR. PCR was carried out in the system with Power SYBR Green PCR Mix and Dye I (Vazyme) in 96-well plates. Each well contained 1 µl of the retro-transcription product, 0.25 µl Dye I and 0.5 µl forward and reverse primers (6.25µM) in 1× SYBR Green Mix, in a final volume of 12.5 µl. rp49 was used as an internal control. The program was: 50 °C for 2 min, 95 °C denaturation for 10 min, followed by 40 amplification cycles (15 s at 95 °C, 60 s at 60 °C), and ended by a melting curve (15 s at 95 °C, 60 s at 60 °C, 30 s at 95 °C and 15 s at 60 °C). Forward and reverse primers were used in this paper: For rp49, forward: 5′ GCTAAGCTGTCGCACAAA, reverse: 5′ TCCGGTGGGCAGCATGTG; for His3, forward: 5′ ACCGAGCTTCTAATCCGCAAG, reverse: 5′ ACCAACCAGGTAGGCTTCGC; for His4, forward: 5′ TGGCGTTCTGAAGGTTTTCTTG, reverse: 5′ AACCGCCAAATCCGTAGAGG; for H2a, forward: 5′ GAATTATTCCGCGTCATCTGC, reverse: 5′ TTCTCGGTCTTCTTGGGCAAC; for H2b, forward: 5′ CGTCGAAGGCGATGAGCATAA, reverse: 5′ AGGCGAACAGCCGTTTGGATC; for H1, forward: 5′ GCCGAAAATAAGAAAACTGA, reverse: 5′ CTTTGACGCTTTCGCTACTA.
Statistical analysis
All data are expressed as the mean ± SD. All statistical data are processed using unpaired two-tailed Student’s t-test in GraphPad Prism.Additional file 1: Figure S1. Knockingdown mxc does not induce apoptosis. (A-B’) Third‐instar larval brains of wt (A-A’) and mxc RNAi (B-B’), labeled by anti‐Dpn (red) and anti‐Caspase3(green). Only background Caspase3 signals were detected in the wt (A) and mxc RNAi (B) larvalbrains. Scale bars: 20 μm. Figure S2. No cell size change in mxc RNAi NBs.Statistical data of cell size of the NB in wt and mxc RNAi third-instar larval brains. The data areplotted as mean ± SD. No significant difference using a Student’s ttest, p = 0.3439. Both of the numbers of neuroblasts counted N = 15. FigureS3. Schematic of the components of Histone locus body (HLB). The HLBis formed via a hierarchical recruitment of components. Mxc and FLASH are thecore components of HLB formation. Mute, Slbp, U7 snRNP and other components arerecruited by Mxc and FLASH for canonical histone gene transcription and pre-RNAprocessing 5,16. Figure S4. Absence of mxc impairs HLBformation in NBs. (A-C”) Third‐instarlarval NBs of wt (A-A”), mxcRNAi (B-B”), and mxc RNAi with UAS-Mxc (C-C”) labeled by anti‐Mute (red), MPM2 antibody (green) and Dapi(blue). In wt NBs (A-A”), MPM2signals and Mute signals were colocalized and formed nuclear foci (arrowheads).In mxc RNAi NBs (B-B”), no MPM2 puncta were detected (B’). The Mute patterns (arrowheads) wereless condensed and multiple smaller puncta were observed in the NBs (B”). Overexpression of Mxc in mxcRNAi background (C-C”) rescued the phenotype, MPM2 and Mute were colocalized atthe nuclear foci (arrowheads). Scale bars: 10 μm. (D-E”) Third‐instarlarval NBs of wt (D-D”) and mxc16a-1(E-E”), labeled by anti‐Mute(red), MPM2 antibody (green) and Dapi (blue). Multiple smaller puncta were observed in mxc16a-1NBs and these MPM2 and Mute signals were not colocalized (E-E”). Scale bars: 10μm. (F-G”) MARCM clones of wt (F-F”) and mxc22a-6 (G-G”)in third‐instar larval brains, labeled by MPM2 (red),anti-Mute (blue) and anti-GFP (green). In mxc22a-6NBs, noMPM2 puncta were detected(G’), and Mute patterns were also shown as multiple puncta (G”). Scale bars: 10μm. Figure S5. Knocking down mxc or histone genes leads to DNA DSBs. (A-D’)Confocal images of the third‐instarlarval brains of wt (A-A’), mxcRNAi (B-B’), His3 RNAi (C-C’) and His4 RNAi (D-D’), labeled byanti‐H2Av pS137 (red) and anti‐Dpn (green). In wt larval central brain (A), no obviously phosphorylated H2Avsignals were detected. Strong signals (arrowheads) were detected in the centralbrains of mxc RNAi (B), His3 RNAi (C) and His4 RNAi (D)lines. Scale bars: 20 μm. Figure S6. Autophagy was activated in mxcknockdown or mutant NBs. (A-B) Third‐instarlarval brains of wt (A) and mxc16a-1(B), labeled by anti‐Dpn (red) and anti‐GFP (green). These lines contained UAS-Atg8a-GFPdriven by wor-GAL4. In the wtlarval central brain (A), only the basic signal of Atg8a-GFP was detected. Inthe mxc16a-1 larval central brain (B), obvious Atg8a puncta(arrowheads) were detected in the cytoplasm of the NB. Scale bars: 20 μm. (C) Statistical analysis of autophagy levelsin the NBs of wt and mxc16a-1larval central brains. The data are plotted as mean ± SD. ****p <0.0001 using a Student’s t test, p = 7.441E-11. Numbers of NBscounted N = 57, N = 50, respectively.(D-E) Third‐instar larval brains of wt (D) and mxc RNAi (E), labeledby anti‐Dpn (red) and anti‐GFP(green). These lines contained UAS-Atg8a-GFP which was driven by wor-GAL4.Obvious Atg8a-GFP puncta (arrowheads) were also detected in the cytoplasm of mxcknockdown NB. Scale bars: 20 μm.
Authors: Xiao-cui Yang; Ivan Sabath; Lalitha Kunduru; Andre J van Wijnen; William F Marzluff; Zbigniew Dominski Journal: J Biol Chem Date: 2014-10-22 Impact factor: 5.157
Authors: Li Yu; Fengyi Wan; Sudeshna Dutta; Sarah Welsh; ZhiHua Liu; Eric Freundt; Eric H Baehrecke; Michael Lenardo Journal: Proc Natl Acad Sci U S A Date: 2006-03-17 Impact factor: 11.205
Authors: Erin B Kaminsky; Vineith Kaul; Justin Paschall; Deanna M Church; Brian Bunke; Dawn Kunig; Daniel Moreno-De-Luca; Andres Moreno-De-Luca; Jennifer G Mulle; Stephen T Warren; Gabriele Richard; John G Compton; Amy E Fuller; Troy J Gliem; Shuwen Huang; Morag N Collinson; Sarah J Beal; Todd Ackley; Diane L Pickering; Denae M Golden; Emily Aston; Heidi Whitby; Shashirekha Shetty; Michael R Rossi; M Katharine Rudd; Sarah T South; Arthur R Brothman; Warren G Sanger; Ramaswamy K Iyer; John A Crolla; Erik C Thorland; Swaroop Aradhya; David H Ledbetter; Christa L Martin Journal: Genet Med Date: 2011-09 Impact factor: 8.822
Authors: Ilka Reichardt; François Bonnay; Victoria Steinmann; Inga Loedige; Thomas R Burkard; Gunter Meister; Juergen A Knoblich Journal: EMBO Rep Date: 2017-11-30 Impact factor: 8.807