Combined Effects of Potassium Perchlorate and a Neonicotinoid on Zebrafish Larvae (Danio rerio).

Imidacloprid (IMI) is part of the neonicotinoids family, insecticides widely used by humans and also found in wastewater. This class of compounds, if present in the environment, can cause toxicity to different species such as bees and gammarids, although little is known about vertebrates such as fish. In addition, several substances have been reported in the environment that can cause damage to aquatic species, such as potassium perchlorate (KClO4), if exposed to high concentrations or for long periods. Often, the co-presence of different contaminants can cause a synergistic action in terms of toxicity to fish. In the present study, we first analyzed different concentrations of IMI (75, 100 and 150 mg/L) and KClO4 (1, 1.5 and 5 mM) to highlight the morphological effects at 96 hpf and, subsequently, chose two nontoxic concentrations to evaluate their co-exposure and the pathway involved in their co-toxicity. Morphological alteration, mucus production, messenger RNA (mRNA) expression related to intestinal function and oxidative stress were measured. These results suggest that co-exposure to IMI and KClO4 could affect zebrafish embryo development by increasing gut toxicity and the alteration of antioxidative defense mechanisms.

1. Introduction

Among the various families of pesticides, neonicotinoids are the most widely used because of their low molecular weight and high water solubility. Despite the European restrictions of 2013, they are produced in large quantities and used in agriculture in various ways [1,2,3]. Within the family of neonicotinoids, imidacloprid (IMI) is one of the most used and detected at the environmental level as a result of agricultural use in concentrations of >100 mg/L, while in water bodies, the percentages are lower by ng/L [4]. IMI concentrations reported in the environment are diverse; for example, in the Netherlands, about 320 mg/L IMI was detected in drainage ditches, while in other areas, such as in Canada, reported concentrations were 0.7 mg/L for surface waters, with a general background of about 0.04 and 0.05 mg/L [5,6]. IMI residues in water can be harmful to aquatic organisms. IMI concentrations of 1 μg/L have been seen to considerably reduce the abundance of aquatic insects, although it does not appear to seriously affect other species such as mollusks, algae, fish or amphibians [7,8]. Studies conducted in the zebrafish model showed IMI life-stage-dependent toxicity ranging from 26.39 (19.04–38.01) to 128.9 (68.47–173.6) mg/L [9].

Aquatic organisms in natural environments are commonly exposed to chemical mixtures rather than individual compounds [10,11]. Among the various chemicals in the environment, perchlorate pollution has been widely documented, especially in the United States. Potassium perchlorate (KClO4) can be used as a solid oxidant for rocket propulsion, and it was the original source of a fraction of the contamination.

Perchloric acid and its salts are strong oxidizers and used in pyrotechnics, explosives and jet or rocket fuels [12]. Naturally occurring perchlorate is formed in the atmosphere leading to trace levels in precipitation, which can concentrate geologically in some locations such as northern Chile [13] or West Texas [14], but the majority of environmental perchlorate is of anthropogenic origin. In fact, concentrations from 8 ng/mL to 3.7 mg/mL perchlorate have been reported in groundwater and surface water in several western states [15]. The perchlorate concentrations used in the present study cover the range reported by the studies to allow conclusions on environmental status.

However, direct sublethal effects on fish, especially during early developmental stages, have rarely been explored. The zebrafish has many advantages as a model organism, such as small size, ex utero development of the embryo, short reproductive cycle and transparent embryos [16]. In addition, the zebrafish shares a high degree of homology with the human genome [17]. Thus, the zebrafish is becoming a powerful model organism for studying genetics [18,19,20], development [21,22], environmental toxicology [23,24,25], pharmacology [19,20], DNA damage repair [26,27], cancer [16,28] and other diseases [29,30]. Zebrafish could be used for studies on eco-environmental monitoring and multitudinous pollutant evaluations, such as toxic heavy metals, endocrine disruptors and organic pollutants [31,32]. Reduced locomotion was reported in zebrafish larvae continuously exposed to IMI from fertilization to five days [33]. No impact was reported for zebrafish development when exposed to IMI from fertilization to 48 h [34] and 96 h [35] of development. Zebrafish (Danio rerio), small teleost (bony) fish, are easy to feed and breed, and their genes are highly like human genes. They have become the ideal model used in many areas of pharmacology and aquatic toxicology tests [36,37,38,39]. In the early stages of zebrafish, the intestine is among the organs most affected by the toxicity of substances, as it is the first area of contact with and route of absorption. In this regard, gut toxicity is often investigated during exposures to different contaminants to assess their effects both individually and in combination [40,41].

In the present study, we investigated the potential synergistic toxic effect of two common environmental contaminants, potassium perchlorate KClO4 and IMI and studied the potential consequences of combined exposure to both the gastrointestinal tract and antioxidant defenses during the early life stages of zebrafish (Danio rerio).

2. Materials and Methods

2.1. Zebrafish Maintenance and Embryo Collection

Wild-type (WT) mature zebrafish with an age of 6 months were used for the production of embryos. The University of Messina Center of Experimental Fish Pathology (Centro di Ittiopatologia Sperimentale della Sicilia, CISS, Messina, Italy) supplied zebrafish maintenance and fertilized egg collection. Mature females and males were mated in a 2:1 ratio for successful reproduction. The eggs were collected the next day in a chamber at 28 °C, bleached, and nonfertilized eggs were discarded. For the experiments, only embryos that had reached the blastula stage were employed. The fish embryo toxicity (FET) test was carried out in accordance with OECD guidelines [42] and ISO 15088.

2.2. Survival Rate, Hatching Rate and Morphology Score

To determine the most appropriate concentrations for following experiments with contaminant synergy, IMI at 75, 100 and 150 mg/L was applied to observe morphology and survival rate. Healthy embryos were implanted in 24-well culture plates at 4 h post-fertilization (hpf) (1 embryo in 2 mL solution/well). Zebrafish embryos were exposed to IMI and KClO4 (all treatment solutions were made in reconstituted water) for 24–96 hpf to measure the toxic effects over a continuing observation period. Firstly, preliminary experiments consisting of varying concentrations of IMI and KClO4 were conducted to determine the concentration–response curve and subsequently tested in association with nontoxic concentration of both substances. Fertilized eggs were transferred into 24-well plates with test solutions and incubated at 28 °C at a 14:10 h day/night light regime. Embryo medium was composed with 15 mM NaCl, 0.5 mM KCl, 1 mM CaCl2, 1 mM MgSO4, 0.15 mM KH2PO4, 0.05 mM Na2HPO4, 0.7 mM NaHCO3 and pH 7.3. Briefly, embryos were exposed to water only (blank control); KClO4 at nominal concentrations of 1, 1.5 and 5 mM; IMI 75,100 and 150 mg/L (4 replicates; 20 eggs in each replicate; 3 independent experiments). The IMI and KClO4 solutions were changed daily, and the entire survival rate and developmental abnormalities of embryos and larvae were monitored and photorecorded at 24, 48, 72 and 96 hpf [43]. During the period of exposure to the substances, the embryos/larvae were observed every 24 h for abnormalities in development, survival and hatching rate, as well as morphological changes [44]. Morphologic score evaluation occurs at 96 hpf using 9 endpoints as previously described [45]. Photographs of the embryos were obtained under a stereomicroscope (Leica M0205C, multifocal).

2.3. Alcian Blue PAS

The sections from each group were stained with Periodic acid Schiff stain (PAS) for quantification of mucins production and goblet cells. Alcian Blue (Sigma-Aldrich, St. Louis, MO, USA) binding assay was performed according to what has been seen previously [46]. Zebrafish larvae at 96 hpf were fixed in freshly prepared 10% formalin. After fixation, the larvae were dehydrated in ethanol, and all specimens were embedded in paraffin (Bio-Optica, Milan, Italy) and sectioned at a thickness of 5 mm with a microtome (Leica Microsystems, Wetzlar, Germany) Paraffined slide of larvae were stained following the Alcian Blue Bio-Optica protocol.

2.4. Gene Expression Analysis

Total RNA from zebrafish larvae was extracted, reverse-transcribed and amplified according to the manufacturer’s instructions of the kits used and as described previously [47]. Table 1 shows the detailed information on the primers as previously reported [48,49]. β-actin was used as an internal control for normalizing relative expression levels between samples [50,51,52]. Data analysis was performed using the 2−∆∆Ct method, and the results are expressed as fold changes.

Table 1

Primers for real-time PCR.

Gene	Primer Orientation	Nucleotide Sequence
b-actin	forward	5′- CCATCGGCAATGAGCGTTTC -3′
	reverse	5′- CAAGATTCCATACCCAGGAAGGA -3′
Muc2.1	forward	5′- CAACATCGATGGCTGCTTCTG -3′
	reverse	5′- CTGACAGTAACATTCTTCCTCGC -3′
Muc.2.2	forward	5′- ACACGCTCAAGTAATCGCACAGTC -3′
	reverse	5′- TCAGCGAGTGTTTGGCTCACTT -3′
Ocln	forward	5′- CAAAATCAGGCAAAGGCTTC -3′
	reverse	5′- AACAATAGTGGCGATGAGCA -3′
Caln	forward	5′- GTACCCTCCGCAAAGTCGTA -3′
	reverse	5′- CTTTCAAGGAAAGACTGACAGC -3′
sod1	forward	5′- GGCCAACCGATAGTGTTAGA -3′
	reverse	5′- CCAGCGTTGCCAGTTTTTAG -3′
cat	forward	5′- AGGGCAACTGGGATCTTACA -3′
	reverse	5′- TTTATGGGACCAGACCTTGG -3′
gstp2	forward	5′- CACAGACCTCGCTTTTCACAC -3′
	reverse	5′- GAGAGAAGCCTCACAGTCGT -3′

2.5. Lipid Peroxidation

Assessment of lipid peroxidation was performed as described previously [53]. Briefly, each sample included 30 larvae pooled in an Eppendorf tube and immediately frozen at 80 °C until use for analysis. For measurement, the pooled larvae were homogenized using extraction buffer (with 87.575 g sucrose, 200 mL glycerol, 700 mL 100 mM phosphate buffer and 0.5 μL phenylmethanesulphonylfluoride). The homogenate was centrifuged at 25,525× g for 15 min, and then the supernatant was used for measurement. MDA levels were measured as thiobarbituric acid-reactive substances, which are products of lipid peroxidation.

2.6. Statistical Evaluation

For multiple comparisons, a two-way/one-way ANOVA was used, followed by a Bonferroni post-hoc test. The data were reported as mean standard deviation (SD) (alpha value of 0.05). GraphPad Prism 8 was used for statistical analysis.

3. Results

3.1. Morphology and Survival Rate

As presented in Figure 1, only IMI at 150 mg/L induced malformation during zebrafish embryo development. At the same time, IMI 75 and 100 mg/L exposure compared to the CTRL group had no effect on zebrafish morphology until 96 hpf. Phenotypic defections at time points up to 96 hpf were noted only in the IMI 150 mg/L group that showed malformation such as pericardial edema (PE) at 96 hpf (Figure 1). Moreover, the different exposures to IMI led to a lowering of the survival rate of larvae especially at 96 hpf by as much as 50% for the highest dose of 150 mg/L, while the groups at 75 and 100 mg/L did not show mortality until 96 hpf (Table 2).

Figure 1

Morphological defections in zebrafish caused by different concentrations of IMI. PE—pericardial edema. Images were taken from the lateral view under a dissecting microscope (magnification 25×). Scale bar, 500 mm.

Table 2

IMI and KClO4 effects on survival rate.

	Survival
	24 h	48 h	72 h	96 h
CTRL	100 ± 0	100 ± 0	100 ± 0	100 ± 0
IMI 75 mg/L	100 ± 0.57	100 ± 0.57	100 ± 0.57	100 ± 0.57
IMI 100 mg/L	100 ± 0.57	100 ± 0.57	100 ± 0.57	100 ± 0.57
IMI 150 mg/L	99.67 ± 0.33	95.00 ± 2.08	82.33 ± 1.20	51.67 ± 1.76
KClO4 1 mM	100 ± 0.57	100 ± 0.57	100 ± 0.57	98 ± 2
KClO4 1.5 mM	99.67 ± 0.33	97.00 ± 1.15 *	83.67 ± 2.02 ***	48.00 ± 2.08 ***
KClO4 5 mM	0	0	0	0

* p < 0.05 versus CTRL; *** p < 0.001 versus CTRL.

In addition, we assessed different concentrations of KClO4 exposure (1, 1.5 and 5 mM) to evaluate the toxic effect on morphology and survival rate (Figure 2). Negative effects on both morphology and survival rate, with abnormalities such as body curvature, yolk (YE) and pericardial edema (PE), were observed at 96 hpf for the concentration of 1.5 mM. The highest concentration (5 mM) resulted in 100% of death in embryos at 24 hpf, while toxic effects were seen for 1.5 mM of KClO4 at 96 hpf around 48%. No toxic effects were seen for the low concentration of 1 mM of KClO4 (Table 2).

Figure 2

Morphological defections in zebrafish caused by KClO4 exposure to different concentrations at 94 hpf. SC—scoliosis; PE—pericardial edema. Images were taken from the lateral view under a dissecting microscope (magnification 25×). Scale bar, 500 mm.

3.2. Toxic Effect of Combined Exposure to IMI and KClO4 on Malformation, Survival and Hatching

After identifying the no observed effect concentration (NOEC) for both IMI and KClO4, we analyzed the effects on morphology, survival and hatching of co-exposure to the two substances. Toxic effects of IMI 100 mg/L combined with KClO4 1 mM were seen on zebrafish development until 96 hpf. The morphology score of the single exposure to IMI and KClO4 group showed no significant change compared to CTRL (Figure 3A–C). Moreover, when embryos were co-exposed with both IMI and KclO4, developmental defects were seen (Figure 3D). Abnormalities, such as pericardial edema and slight scoliosis, were found in the co-exposure to IMI and KClO4 group at 96 hpf (Figure 3D). Moreover, the co-exposures to IMI and KClO4 led to a lowering of the survival rate at 96 hpf, which was about 50% (Figure 3F). In addition, the hatching rate of embryos from 24 up to 96 hpf, and any delays were analyzed. The CTRL group showed total hatching between 48 and 72 hpf, as did the groups with single exposures to IMI and KClO4 (Figure 3F). Co-exposure caused a delay in normal embryo hatching at 72 and 96 hpf significantly compared with the control group. In addition, no differences were found in the single-exposure group of IMI and KClO4 compared to CTRL in terms of malformations, survival and hatching rate (Figure 3G).

Figure 3

Effects of KClO4 and Cd single and co-exposure on morphological changes in zebrafish larvae at 96 hpf. CTRL (A). KClO4 (B). Cd (C). KClO4+Cd (D). Morphology score (E). Survival rate and (F) hatching rate (G) of zebrafish larvae treated. PE—pericardial edema. *** p < 0.001 versus CTRL.

3.3. Intestinal Effect of Co-Exposure to IMI and KClO4

Alcian Blue staining is specific for mucopolysaccharides and measures epithelial mucus production, an alteration often associated with intestinal damage, while goblet cells are mainly responsible for secreting mucus that is arranged in disorder (pink staining). Alcian Blue staining revealed that the amount of mucus produced was normal (blue staining), with no alterations in the number of goblet cells (pink staining) in the CTRL group, as well as in the single-exposure group of IMI and KClO4. Co-exposure with IMI and KClO4 resulted in increased mucus production, with an increase in blue staining, and normal expression of goblet cells (pink). In fact, the quantification of the mucus coverage ratio further confirmed the increases in mucus secretion (Figure 4). In addition, mRNA expression of Muc-1 was much higher than the CTRL group after co-exposure with IMI and KClO4 (Figure 4). Contrary, the co-exposure with IMI and KClO4 downregulated the expression levels of mucus-secretion-related genes Muc-2 and tight-junction-related genes occludin (Ocln) and Claudin-1 (Caln), except for increasing the expression of Muc-1. No effect on mucus secretion and tight-junction-related gene expression was seen in the single-exposure IMI and KClO4 group.

Figure 4

IMI and KClO4 effect in single and co-exposure on mucopolysaccharides production. Whole-mount control, IMI and KClO4 in single and co-exposure larvae stained with Alcian Blue. CTRL (A), KClO4 (B), IMI (C); IMI+ KClO4 (D). Increased mucus production (blue staining) (E). Effects of IMI and KClO4 single and co-exposure on the mRNA levels of intestinal-function-related genes (muc2, caln, ocln and muc1) (F) in larval zebrafish. Values = means ± SEM of three independent experiment data; *** at p < 0.001 against CTRL.

3.4. Effect of IMI and KClO4 on Antioxidant Pathway and Lipid Peroxidation

Figure 5 shows the changes in the expression of antioxidant-related genes in zebrafish larvae after exposure to IMI and KClO4 alone and in combination. The co-exposure to IMI and KClO4 group significantly upregulated the expression levels of cat, sod1 and gstp2 compared to the CTRL group. However, there was no significant change in the expression level of the antioxidant gene in the IMI- and KClO4-alone exposure group (Figure 5). In addition, lipid peroxidation was assessed by malondialdehyde (MDA) analysis. Single exposures with IMI (6.07 ± 0.15) and KClO4 (5.93 ± 0.15) showed no increase in MDA compared with the CTRL group (5.83 ± 0.15), whereas co-exposure with IMI and KClO4 caused a significant increase in MDA (6.90 ± 0.15), as seen for the expression of genes involved in the antioxidant mechanism.

Figure 5

Effects of IMI and KClO4 single and co-exposure on the mRNA levels of stress oxidative pathway (cat, sod and gstp2) (A) in larval zebrafish. MDA (B). Values = means ± SEM of three independent experiment data; ** at p < 0.01 against CTRL. *** at p < 0.001 against CTRL.

4. Discussion

Heavy metals, polycyclic aromatic hydrocarbons, pesticides, mycotoxins and other xenobiotics can contaminate food. The term interaction is defined as a situation in which some or all individual components of a mixture influence each other’s toxicity, and where the combined effects of these components differ from the predicted additive effects [54]. This exposure has detrimental effects on human and animal health and could contribute to an increased risk of long-term diseases, such as cancer, reproductive disorders, neurodegenerative diseases, neurotoxicity and immunotoxicological effects [55,56,57,58]. Previous studies have demonstrated the adverse effects of IMI on aquatic organisms; in fact, lethal and sublethal effects have been reported on several aquatic species with developmental body structural alterations [5,6]. Fish are the primary target in the aquatic environment of human-caused contaminants and pollutants, such as pesticides [59,60]. Pesticides, which pollute natural waters through agricultural runoff and various other means, can cause fish to die or decrease their numbers, causing an ecological imbalance [61,62,63]. However, in the aquatic environment, more contaminants of anthropogenic nature, such as potassium perchlorate (KClO4), can be found, which, in nontoxic concentrations, can interact with others and create a synergistic toxic mechanism for several aquatic species [64]. A strong synergistic effect was exerted by mixtures of IMI and KClO4 on the acute toxicity of zebrafish embryos in a time-dependent manner, indicating the higher toxicity of mixtures compared with individual pesticides and other contaminants [65]. Several studies have shown that the co-presence of different pesticides and contaminants can result in increased toxicity in zebrafish larvae [10,66]. Therefore, we should consider the toxic effects of individual pesticides and contaminants, as well as their mixtures in the risk management of pesticides.

The current study demonstrated that co-exposure to IMI and KClO4 in the early life stages of zebrafish could increase the toxicity of the individual contaminants. The first objective of the study was to identify an appropriate nontoxic concentration within an IMI range to then co-expose to KClO4 for evaluation of the potential synergistic effect. We demonstrated IMI developmental toxicity in zebrafish embryos and morphological abnormalities. The concentration of IMI that showed almost 50% mortality of larvae at 96 hpf was 150 mg/L, while 75 and 100 (NOEC) mg/L did not show any effect on development and mortality at 96 hpf. In addition, exposure to 150 mg/L IMI induced embryonic teratogenesis, which was characterized by PE in 96 hpf.

The zebrafish model, especially in the early stages of life, is widely used for ecotoxicology studies, with a specific interest in effects on organs such as the brain and stomach [36,67,68]. The morphology and important enzyme activity alterations of zebrafish gut could serve as important indicators to assess the impact of environmental pollutants. In humans, as well as in many animal species, the intestinal epithelium has the largest surface area of any organ and is therefore the most exposed to environmental substances [69]. Meanwhile, as an important detoxification organ, the epithelial barrier of the intestine absorbs and metabolizes xenobiotics, including pesticides such as IMI [70,71,72]. AB-PAS staining indicated the increased secretion of mucus after IMI exposure. In addition to the structural changes of the intestine, the expression of genes related to intestinal mucus secretion and tight junctions were also inhibited by co-exposure to IMI and KClO4.

Generally, intestinal mucosal integrity is the basis of the intestinal barrier function, while tight Junction (TJ) proteins are key components of the gut mucosal barrier. The transmembrane proteins occludin and claudins are the most important TJ proteins and are often considered indicators for evaluating the permeability and integrity of the intestinal mucosal barrier [73]. Mucus is present at the interface between intestine epithelial surfaces and its internal environment and, principally, the immune responses of intestine mucosal to the potential pathogen challenge [74]. Mucus is the major organic component of the intestine mucus layer that contributes to the mucosal barrier against enteric pathogens.

It was demonstrated that the secretion of mucus increased with an increase in Muc1 mRNA expression, while the relative mRNA levels of Muc2, an important gene related to mucus secretion, as well as ocln and caln, were suppressed significantly in larvae at 96 hpf after co-exposure, but not after the single exposure. The increase in mucus production and decrease in tight junctions shown following co-exposure are in line with what has been previously reported in mouse models, where IMI exposure caused damage to the intestinal barrier, altering the absorption status of the animal [75].

Increased oxidative stress in aquatic species can be considered a biomarker of toxicity and assess the impact of environmental pollutants [76,77]. In fact, it has been reported that exposure to pesticides, including IMI, may result in increased reactive oxygen species (ROS) production in fish and, consequently, DNA damage in zebrafish [78]. Similar results were observed in different tissues (including liver, gill, kidney, brain, muscle) of the neotropical fish Prochilodus lineatus after exposure to four IMI concentrations for 120 h [79]. Acute IMI exposure also induced severe histopathological damage, inflammation and oxidative stress in common carp (Cyprinus carpio L.) [80]. SOD and CAT are important enzymes establishing the first line of antioxidant defense systems [65]. A member of the GST Pi family, gstp2, also participates in the process of ROS removal by interaction with glutathione [81]. The increase in sod mRNA expression was likely a compensatory effect in response to the increased oxidative damage induced by IMI and KClO4 co-exposure, and the expression of cat was significantly increased. Moreover, the upregulation of genes encoding the antioxidant protein suggested a compensatory effect to produce more enzymes to eliminate the superoxide radicals induced by co-exposure [82]. Our data suggested how the co-presence of IMI and KClO4 increased the alteration of the antioxidant balance. Similar results were also observed in zebrafish, where there was an alteration of the antioxidant defenses in several organs, such as the intestine and liver, following exposure to pollutants for 7 days [83]. Moreover, increased lipid peroxidation following IMI and KClO4 co-exposure may be attributed to the induction of ROS, which enhances the oxidation of polyunsaturated fatty acids and leads to lipid peroxidation [84]. IMI and KClO4, in a synergistic manner, induced oxidative stress and led to oxidative damage with an increase in lipid peroxidation. Our results showed that IMI exposure to other potential contaminants, such as KClO4, could have the risk of inducing oxidative damage to tissues of various aquatic organisms. Because the natural aquatic environment has a complexity of pesticides and other substances anthropogenic in nature, it is necessary to evaluate the joint effects. Based on the above results, the alteration of enzyme activities could impair the pathological development of fish through significant changes in the expression of corresponding genes, providing a more comprehensive view of the joint toxic effects at the molecular level. In addition, the results may provide an important indication of the safety application of IMI to farmers.

5. Conclusions

Our data demonstrated how co-exposure to sublethal concentrations of IMI and KClO4 can induce toxicity in zebrafish in the early life stages. Although our concentrations are higher than those reported in the environment, especially for IMI, we showed significant intestinal barrier injury and enzymatic biomarker alterations associated with oxidative stress and inflammatory response after acute co-exposure. Moreover, since there is much scientific evidence on the potential crosslink between these two contaminants, further research efforts should be conducted to understand the mechanisms of their interactions and consequently the risks of the release of these substances into the water.