| Literature DB >> 35615477 |
Xiangke Yang1,2, Lili Zhao1, Qiling Chen1, Nan Wang1, Kan Shi1,3,4,5,6, Shuwen Liu1,3,4,5,6.
Abstract
Organic acid metabolism by lactic acid bacteria plays a significant role in improving wine quality. During this process, the uptake of extracellular organic acids by the transporters is the first rate-limiting step. However, up to now, there is very little published research on the functional verification of organic acid transporter genes in wine lactic acid bacteria. In this study, a predicted citrate transporter gene JKL54_04345 (citP) by protein homology analysis was knocked out using a CRISPR/Cas9-based gene-editing system, and then complemented using the modified pMG36e vectors in a major wine lactic acid bacterium, Lactiplantibacillus plantarum XJ25, to verify its function in citrate metabolism for the first time. The results showed that the gene knockout mutant XJ25-ΔcitP lost the ability to utilize citric acid, while the gene complement mutant XJ25-ΔcitP-pMG36ek11-citP fully recovered the ability of citric acid utilization. Meanwhile, citP knockout and complement barely affected the utilization of l-malic acid. These indicated that citP in L. plantarum functioned as a citrate transporter and was the only gene responsible for citrate transporter. In addition, two modified plasmid vectors used for gene supplement in L. plantarum showed distinct transcription efficiency. The transcription efficiency of citP in XJ25-ΔcitP-pMG36ek11-citP mutant was 4.01 times higher than that in XJ25-ΔcitP-pMG36ek-citP mutant, and the utilization rate of citric acid in the former was 3.95 times higher than that in the latter, indicating that pMG36ek11 can be used as a high-level expression vector in lactic acid bacteria.Entities:
Keywords: citrate transporter gene; functional verification; gene editing; lactic acid bacteria; lactiplantibacillus plantarum; organic acids
Year: 2022 PMID: 35615477 PMCID: PMC9124760 DOI: 10.3389/fbioe.2022.894870
Source DB: PubMed Journal: Front Bioeng Biotechnol ISSN: 2296-4185
Bacterial strains and plasmid vectors used in this study.
| Strain or plasmid | Genotype (description) | Source |
|---|---|---|
| Strains | ||
| | Commercial host for cloning | Laboratory |
| | Wild-type | This work |
| XJ25-Δ |
| This work |
| XJ25-Δ |
| This work |
| XJ25-Δ |
| This work |
| Plasmids | ||
| pLCNICK | Knockout vector |
|
| pLCNICK-Δ |
| This work |
| pMG36e | Shuttle vector with P32-promoter, |
|
| pMG36ek | Shuttle vector with P32-promoter, | This work |
| pMG36ek11 | Shuttle vector with P11-promoter, | This work |
| pMG36ek- | pMG36ek carrying | This work |
| pMG36ek11- | pMG36ek11 carrying | This work |
Primers used in this study.
| Primer | Sequence (5′–3′) |
|---|---|
| citP-up-1 | ctttttctaaactagggcccATGTGCAGCACACATTTTTGATG |
| citP-up-2 | ATCAGACTACATCTCAATTCCTCCTCATACTTACTC |
| citP-down-1 | ATTGAGATGTAGTCTGATTTTAAGCATAAAAACAGG |
| citP-down-2 | ccgagtcggtgctttttttGCACATGATTATTACTTATCC |
| sgRNA-1 | aaaaaaagcaccgactcgg |
| citP-sgRNA-2 | ggatgatatcacctctagaCCAGTGTTTCGATGAACGCAgttttagagctagaaatagc |
| citP-ha-1 | TGATGAGTAAGTATGAGGAGGAA |
| citP-ha-2 | TGACCGAATGGACATGCTAT |
| citP-in-1 | TGTTTGTGCGGCTGTTT |
| citP-in-2 | GCATTGGGCGTATCTTTA |
| pLCNICK-test-1 | aaaagggatagtaattcattcctgg |
| pLCNICK-test-2 | tgcgagttgaccgtggg |
| citP-express-1 | aggtaaaaaaatattcggaggaattttgaaATGACACTAAATAAGGTCAAGTATCGTGA |
| citP-express-2 | aaggttcaaaatattaaattttaccggtcaCTACCAAATACCAATCACTTTCATCCAGA |
| pLCNICK-KanR-1 | gctcgacatactgttcttccttagaaaaactcatcgagcatc |
| pLCNICK-KanR-2 | ttgtgaatcgggtcgatcggggaaagccacgttgtgtctc |
| pMG36e-KanR-1 | ccgatcgacccgattcacaa |
| pMG36e-KanR-2 | ggaagaacagtatgtcgagc |
| pMG36e-express-1 | tgaccggtaaaatttaatattttgaacctt |
| pMG36e-express-2 | ttcaaaattcctccgaatatttttttacct |
| P11-1 | tatgggtcgatcgaattcAGCGCTATAGTTGTTGACAGAATGGACATACT |
| P11-2 | ttcaaaattcctccgaatAGCAACATTATATCATAGTATGTCCATTCTGT |
| pMG36e-Promoter-1 | attcggaggaattttgaa |
| pMG36e-Promoter-2 | gaattcgatcgacccata |
| pMG36e-test-1 | gcacggtcgatcttctatat |
| pMG36e-test-2 | tcgcaacagaaccgtttcta |
| 16SrRNA-1 | GCAACGAGCGCAACCC |
| 16SrRNA-2 | GACGGGCGGTGTGTAC |
| L-ldh-1 | TGTGCCTCGTAAGCCTG |
| L-ldh-2 | GCCCCCTTCTGACTAAT |
| citR-1 | AGTAAGGCTTCGCTCTT |
| citR-2 | TGACCGAATGGACATGCTAT |
FIGURE 1Determination of citP, L-ldh, and citR gene expression levels in the wild-type XJ25 and the mutants. Data are expressed as mean ± standard deviation (n = 3). a-d means with different lower-case letters in the same row indicate significant differences (p < 0.05).
FIGURE 2Changes in metabolite concentration in the MRSg medium after 24 h culture with the wild-type and the mutants (A) citric acid, (B) acetic acid, (C) L-malic acid, (D) lactic acid, (E) diacetyl and (F) acetoin. Data are expressed as mean ± standard deviation and (n = 3). a-e means with different lower-case letters in the same row indicate significant differences (p < 0.05).
FIGURE 3Changes in metabolite concentration in the MRSc medium after 24 h culture with the wild-type and the mutants (A) citric acid, (B) acetic acid, (C) L-malic acid, (D) lactic acid, (E) diacetyl and (F) acetoin. Data are expressed as mean ± standard deviation (n = 3). a-e means with different lower-case letters in the same row indicate significant differences (p < 0.05).
FIGURE 4Changes in metabolite concentration in the MRSm medium after 24 h culture with the wild-type and the mutants (A) citric acid, (B) acetic acid, (C) L-malic acid, (D) lactic acid, (E) diacetyl and (F) acetoin. Data are expressed as mean ± standard deviation (n = 3). a-e means with different lower-case letters in the same row indicate significant differences (p < 0.05).