First insights into the microbiome of Tunisian Hyalomma ticks gained through next-generation sequencing with a special focus on H. scupense.

Ticks are one of the most important vectors of several pathogens affecting humans and animals. In addition to pathogens, ticks carry diverse microbiota of symbiotic and commensal microorganisms. In this study, we have investigated the first Tunisian insight into the microbial composition of the most dominant Hyalomma species infesting Tunisian cattle and explored the relative contribution of tick sex, life stage, and species to the diversity, richness and bacterial species of tick microbiome. In this regard, next generation sequencing for the 16S rRNA (V3-V4 region) of tick bacterial microbiota and metagenomic analysis were established. The analysis of the bacterial diversity reveals that H. marginatum and H. excavatum have greater diversity than H. scupense. Furthermore, microbial diversity and composition vary according to the tick's life stage and sex in the specific case of H. scupense. The endosymbionts Francisella, Midichloria mitochondrii, and Rickettsia were shown to be the most prevalent in Hyalomma spp. Rickettsia, Francisella, Ehrlichia, and Erwinia are the most common zoonotic bacteria found in Hyalomma ticks. Accordingly, Hyalomma ticks could represent potential vectors for these zoonotic bacterial agents.

Introduction

Ticks are strict hematophagous ectoparasites of vertebrate animals and humans. Distributed all over the world, they are implicated in the transmission of several pathogens (viruses, bacteria, protozoa, and helminths) of medical and veterinary importance. Accordingly, ticks are considered to be the second world wild vectors of human diseases behind mosquitos, but they are the first vectors of pathogen diseases in domestic and wild animals [1, 2].

Livestock farming is one of the main agricultural sectors in North African countries and Tunisia [3]. Ticks are widespread in Tunisia over different geographical regions, Hyalomma spp are the most prevalent ticks infesting cattle [4, 5].

Tick infestation represents a major threat in cattle breeding due to their capacity to transmit three major tick-borne pathogens (TBPs) and to induce different diseases specifically anaplasmosis, babesiosis and theileriosis [4, 6, 7]. Tropical theileriosis, which is caused by the protozoan Theileria annulata and transmitted by Hyalomma scupense, is the major tick-borne disease affecting North African and Tunisian cattle [8-10].

Besides pathogens, ticks also harbor a large variety of symbiotic and commensal microorganisms [11]. Symbiotic bacteria play important roles in tick survival particularly via the synthesis of some essential vitamins and cofactors, especially vitamins of group B, which are lacking in the highly specialized hematophagous tick diet [12-14]. These bacteria are implicated in tick adaptation to environmental stress, they are also essential for tick’s reproductive fitness [11, 12]. The symbiotic bacteria can also influence the colonization, maintenance and transmission of pathogens [15, 16]. Ticks carry at least 10 different genera of maternally inherited endosymbiotic bacteria [12, 13]. Three of these endosymbionts namely Coxiella, Francisella and M. mitochondrii are specific to ticks. Coxiella is the most frequent endosymbiont which presents in two-thirds of tick species [12, 17]. M. mitochondrii which infect the mitochondria has been reported in some tick species, while Francisella has only been detected in a few tick species [18]. Indeed, Francisella, Coxiella and Rickettsia endosymbionts are obligate nutritional symbiotic bacteria that have conserved all the major genes encoding for vitamins B synthesis despite their highly small genome [19-21]. For instance, Coxiella endosymbiont carries the genes encoding for vitamins B7 (biotin), B2 (riboflavin), B9 (folic acid), and their cofactors [22, 23]. In the Rickettsia endosymbionts genome, Hunter’s team confirmed the presence of all genes encoding for the biosynthesis of folic acid [21]. Also, Francisella endosymbiont genome includes all the genetic pathways for the synthesis of folic acid, biotin, and riboflavin [16, 24].

The importance of B vitamins in tick survival and development has been established by Duron et al. in 2018 with Francisella in the soft tick Ornithodoros moubata [13]. An experimental elimination of the symbiont using antibiotic treatment was followed by a reduced tick survival and the appearance of some physical abnormalities, interestingly, these effects were fully restored with a supplement of vitamin B. Similar experiments with Coxiella in Amblyomma americanum, Haemaphysalis longicornis, and Rhipicephalus microplus resulted in lower reproductive fitness and prevented even the development into adults in R. microplus. While, being one of the maternally transmitted endosymbiotic, the role of M. mitochondrii in their host biology has not been well established. However, some studies have suggested their role in molting and tick blood meal metabolism following the increase of this symbiont after feeding [25, 26].

Taken altogether the above general data are highlighting the important role of obligate symbionts in tick biology and reproduction, opening a potential window of opportunities for developing prototypes of innovative and environmentally friendly control measures targeting these symbionts.

In North Africa and Tunisia, the majority of studies on livestock and zoonotic tick-borne pathogens have focused essentially on pathogens and diseases identification, and their epidemiology and control using conventional approaches. However, almost there is no data on microbiota and endosymbionts of the most dominant and important Tunisian tick species of the Hyalomma genus. In this context, our work intends to provide the first comprehensive study carried out on major Hyalomma species in Tunisia and more generally in North Africa, for describing, firstly, the microbial diversity and richness of tick microbiota in Hyalomma ticks infecting livestock in different bioclimatic and geographic regions in Tunisia, and establishing secondly, the prevalence of their endosymbiotic bacteria. We aim in the present work to focus more, and for the first time to our knowledge, on the symbionts associated with the different life stages of the monotropic H. scupense cattle tick, the vector of tropical theileriosis, and to carry out a comparative study with the adult stages of other dominant cattle Hyalomma tick species in Tunisia.

Material and methods

Study area and tick sampling

A total of 776 adult ticks were sampled during June, July and August 2020. Adult ticks were collected from cattle in 6 different bioclimatic stages and 9 Tunisian administrative governorates to explore the whole microbial diversity of Tunisian ticks and to investigate their endosymbionts. For this purpose, cattle barns were selected according to previous tropical theileriosis cases, sampling information’s and geographical coordinates were summarized in Table 1. Furthermore, engorged H. scupense nymphs were collected from walls of some cattle breeding barns between October and November 2020 from El Hissiene site (upper semi-arid stage, Ariana, Tunisia: N37°0’14,50469" E10°10’18,06892).

Table 1

Bioclimatic stage, governorate, location, delegation, farms visited, surveyed cattle and ticks collected.

Bioclimatic stage	Governorate	Location	Delegation	Farms	Cattle	Ticks
Upper semi-arid	Bizerte	N37°4’5,606" E9°55’18,90833	Besbesia	3	68	79
Upper semi-arid	Ariana	N37°0’14,50469" E10°10’18,06892	Hessiènne	4	36	56
Subhumid	Bizerte	N37°11’27,79825" E 10°1’42,14406	El Alia	1	7	20
Subhumid	Bizerte	N 37°11’25,9242" E 10°5’1,70138"	Aousseja	1	16	33
Upper semi-arid	Seliana	N36°20’16,65114" E 9°7’49,99084"	El krib	5	40	45
Sub-humid	Bizerte	N 37°2’16,69924" E 9°24’29,45606"	Ghezala	7	36	151
Humid to sub-humid	Jendouba	N36°38’54,26635" E 8°37’49,56319"	Fernena	7	56	32
Humid to sub-humid	Beja	N 36°47’49,0709" E 9°8’47,70218"	Amdoun	4	25	27
Humid to sub-humid	Beja	N36°50’11,08694" E 9°5’14,64418"	Beja	3	10	7
Humid	Beja	N36°51’53,61602" E 9°9’46,29971"	Nefza	4	32	34
Upper Arid	Kairouan	N 35°35’35,488" E 9°30’9,82742"	El Ala	8	30	65
Upper Arid	Kasserine	N35°15’20,78406" E 9°4’54,57695"	Sebitla	7	35	53
Semi-arid	Zaghouan	N36°26’10,44344" E 9°50’1,46022"	Fahs	9	42	13
Lower semi-arid	Sousse	N35°55’51,19154" E 10°29’7,65161"	Kalaa Kbira	11	32	30
Humid	Jendouba	N36°56’44,03688" E 8°45’5,30809"	Tabarka	8	25	131

Ethical statement

The animals used in this study belonged to farmers who consented to their sampling. The animals were gently restrained by their owner to collect ticks, in the same way as for a routine clinical examination. Invasive sampling and tranquilizers were not used in our work. Furthermore, the sampling was supervised by veterinarians and veterinary technical staff of the National School of Veterinary Medicine, Sidi Thabet, Tunisia. For these reasons, the present study followed the guidelines for the care and use of animals of the National School of Veterinary Medicine, Sidi Thabet, Tunisia, and required no ethical approval.

Tick species identification

Tick species were first identified morphologically according to the key of Walker et al. [27]. Subsequently, molecular characterization was done using the mitochondrial 16S and 12S rRNA genes for all species and in particular on fully engorged females and nymphs. All sequences were compared with GenBank data using BLAST analysis. We have considered that ticks of the same species are sharing a similarity of ≥97% [28]. All DNA samples were stored at -20°C until their use.

Genomic DNA extraction and pooling

We have first sterilized the exoskeleton of ticks to eliminate surface contaminants using commercial bleach at 1% for 30 seconds followed by three washes with ultra-pure water according to the protocol of Binetruy et al. [29]. DNA was extracted from individual adult ticks using the DNeasy Blood &Tissue Kit (QIAGEN, Valencia, CA), while DNA extraction from H. scupense engorged nymphs and eggs was performed following the Wizard Genomics DNA kit (Promega, Madisson) protocol. The extracted DNA was stored at -20°C for future use.

To study the specific microbial population of ticks, DNA from individual samples was pooled together in equal concentrations for each species and stage. This approach was used in this first investigation to reduce the financial and technical burden of the NGS analysis.

A total of six pools were prepared for next-generation sequencing composed as follow: one pool composed of 60 nymphs of H. scupense, one pool of H. scupense eggs and 4 pools of adult ticks composed each one of 30 H. scupense females, 30 H. scupense males, 30 H. marginatum adults and 30 H. excavatum adults.

Library preparation for metagenomic sequencing

DNA was quantified using the Qubit dsDNA HS Assay kit (Invitrogen). Library preparation was carried out using NextEra cd index prep with Illumina Miseq. Briefly, 12.5 ng of DNA from each sample were amplified using a v3-v4 primer of 16s rDNA. Samples were dual indexed the pooled and quantified as the final library. An amount of 4 nM of the pooled library was normalized and denatured with NaOH, then samples were loaded on the Illumina Miseq instrument for sequencing.

Metagenomic analysis

Metagenomic analysis was carried out using qiime2 (Quantitative Insights Into Microbial Ecology) [30] (version 2020.6) from (https://qiime2.org/), raw reads were filtered and adapters were trimmed, reads were denoised using deblur and the table of features was generated, the subsampling of features for the alpha diversity analysis was carried out after the rarefaction of samples by 5624 features. BarPlots of relative abundance were created using the Phyloseq package and Vagans library on Rstudio and the Piecharts were created with Plotly after treatment with Biom algorithm.

Prevalence and transmission of symbionts

Independent Francisella and Rickettsia endosymbionts identification was performed using PCR by amplifying the rRNA 16S and glta gene with specific primers (Table 2). PCR conditions set with denaturation step at 94°C for 7 min followed by 40 cycles at 94°C for 45s, 62°C for 30s and 72°C for 45s with a final extension at 72°C for 7 min. The negative DNA template for symbiont was verified systemically by the amplification of ticks’ 18S rRNA gene using universal primers of eucaryotic. PCR products of glta and 16S were purified and sequenced from both directions. Sequences were verified using BLAST.

Table 2

Targeted genes, primers, and nucleotide sequences per tick species.

Species	Target gene	Primers	Nucleotide sequence (5′–3′)	Reference
Rickettsia endosymbiont	Citrate synthase (gltA)	gltA-F gltA-R	TCCTACATGCCGACCATGAG AAAGGGTTAGCTCCGGATGAG	[31]
Francisella endosymbiont	16S rRNA	Fran16S-F Fran16S-R	CAGGACTAGCTTATAGTTGCTG CATCTGCGACAGCCTAAAAGC	[19]

To compare the prevalence of symbionts between sex and life stage of H. scupense ticks, the test chi 2 was performed. Results were considered significant at 5% threshold.

Maternal transmission assay

A total of 9 fully engorged live females of H. scupense, H. excavatum and H. marginatum were collected from cattle. Engorged ticks were separately incubated at 27°C and 90% relative humidity until the end of oviposition. DNA was extracted from 300 eggs of each tick and stored at -20°C until further use.

Results

Due to the sampling design Hyalomma scupense was the main collected species, representing more than 40.0% of collected ticks (n = 776), Haemaphysalis punctata (18.81%), followed by Hyalomma marginatum (17.80%) then Hyalomma excavatum (17.36%), Rhipiciphalus spp. (6.94%), and finally Hyalomma impeltatum (0.14%). Morphologically identified specimens of H. scupense, H. marginatum and H. excavatum used in our study were later confirmed with molecular identification and sequencing using 16S and 12S rRNA genes.

Microbial diversity in ticks

We have essentially focused on the characterization of the microbial composition and microbiota diversity, richness, and their variation between male and female as well as between different life stages of H. scupense. We have also carried out a comparative study with H. marginatum and H. excavatum which adult stage commonly infest Tunisian cattle in Tunisia. In this regard, 16S rRNA (V3-V4 region) sequencing and metagenomic analysis were established. The relevant accession numbers used to access to our data are available on the following links https://www.ncbi.nlm.nih.gov/sra/PRJNA791601 (for all data).

Denoising reads with deblurring were generated 97081 features where the greatest number of reads was observed in female H. scupense and the lowest number of reads was detected in male H. scupense. The denoising allowed the selection of 124 representative sequences Operational Taxonomic Unit (OTU) with a mean length of 148 bp. The taxonomic assignment of OTUs was carried out using the Silva 16S database with a cutoff of 99%, the classifier was trained using the qiime feature-classifier algorithm for V3-V4 primers.

Bacteria profiling from different identified livestock species showed that proteobacteria were the dominant phylum with more than 97% of relative percent abundance (RPA) followed by Actinobacteria, Firmicutes, and Deinococcota. Overall, 16 bacterial families were detected among those Rickettsiacea, Francisellacea, Enterobacteriaceae, Bacillaceae, and Brevibacillacea were the most predominant families in the examined tick species (Fig 1). In the male of H. scupense, Enterobacteriaceae was the most prevalent bacterial family with 69.5% RPA followed by Rickettsiaceae 22.9% and Francisellacea 2.56%. However, Francisellacea was the dominant family in the female of H. scupense with 78.8% of RPA followed by Rickettsiaceae with 19.9% of RPA. In the two other Hyalomma species, Rickettsiaceae were the most abundant followed by Francisellacea.

Fig 1

Family level taxonomic composition of Hyalomma excavatum, H. marginatum and H. scupense adult ticks.

Three symbiotic bacterial genera were detected in the analyzed ticks, these were Francisella, Rickettsia and M. mitochondrii. Francisella and Rickettsia genera were detected in all three species of adult Hyalomma, they were also present in all the stages of H. scupense (Fig 2), however at different RPA. The highest RPA of Francisella was recorded in the females of H. scupense with an RPA of 78.8%, followed by H. marginatum sample with an RPA of 37.9%. However, the lowest rate was observed in the male of H. scupense. The Rickettsia genera make up the vast majority of H. excavatum with 70.8% RPA, it was also detected at a high abundance of 34.5% in H. marginatum. M. mitochondrii was highly present in H. marginatum and H. excavatum with an RPA of 34.5 and 17.3% respectively.

Fig 2

Relative abundance (%) of bacterial genera according to tick species and life stage of Hyalomma scupense.

Organisms listed in the legend appear from top to bottom in order of highest relative abundance.

We have also detected some genera of pathogen bacteria for instance; Ehrlichia, Erwinia, Dietzia, Escherichia, Shigella, Pseudomonas, as well as the two other symbiotic/pathogenic bacteria: Francisella and Rickettsia. To examine the possible difference in bacterial population structure between species, sexes, and life stages, alpha diversity parameters were calculated (Table 3 and Fig 3).

Table 3

Alpha diversity indexes.

Sample	Obs	Chao1	se.chao1	ACE	se.ACE	Shannon	Simp	InvSimp	Fisher
H. scupese female	12	12,00	0,24	12,46	1,73	0,96	0,47	1,87	1,61
H. scupense male	15	15,00	0,00	15,00	1,55	1,12	0,57	2,35	2,08
H. scupense nymph	23	23,25	0,73	23,67	2,29	1,23	0,55	2,25	3,43
H. excavatum	15	15,00	0,00	15,00	1,93	1,29	0,67	3,00	2,08
H. marginatum	15	15,00	0,00	15,00	1,93	1,65	0,76	4,16	2,08
H. scupense eggs	10	10,50	1,28	11,79	1,37	1,40	0,70	3,37	1,30

Fig 3

Alpha diversity and richness parameters of Hyalomma scupense microbiota.

a: Shannon alpha diversity between species; c: Chao alpha diversity between species; b: Chao alpha diversity between life stages.

Notably, there was a significant difference between adult species, H. excavatum and H. marginatum samples have a significantly more diverse microbiome than H. scupense as indicated by the Chao and Simpson indexes (Table 3 and Fig 3). H. scupense, female ticks have less microbial diversity than males, furthermore, there was a significant difference between the relative abundance of the bacterial genus and species detected in female versus male ticks (p<0.05), indeed, 40 species were detected in males while 35 species were recorded in females (Fig 4). Indeed, Francisella endosymbionts constituted by far a dominant percentage of the microbiome of female ticks comparatively to male ticks, 78.8% and 2.51% respectively. Although a significant difference between different stages was detected since adult ticks exhibit a greater extent of microbial diversity. We then examined the microbial richness using the Shannon diversity index (Table 3) and similar trends were observed with the Chao index because H. scupense samples have less rich diversity than the other two species. However, in the case of H. scupense, nymphs were by far the richest in diversity relative to the two other life stages.

Fig 4

Genus’s level taxonomic composition of male and female Hyalomma scupense ticks.

Maternal transmission

To test whether Francisella and Rickettsia endosymbionts have a maternal transmission. Samples of eggs of nine fully engorged females of H. scupense, H. excavatum and H. marginatum ticks were screened by PCR amplification. PCR product was sequenced and revealed that all the pools of eggs of each female were positive for the two symbionts with an overall transovarial transmission efficiency of 100%. Although using NGS, we have detected the presence of these two symbionts in H. scupense eggs at an RPA of 16% and 18.1% for Francisella and Rickettsia respectively. However, the most dominant endosymbiont detected in H. scupense eggs was M. mitochondrii with 65.5% RPA (Fig 2). This endosymbiont was not detected in H. scupense adult ticks, while as reported it was highly represented in adults of H. marginatum and to a lesser extent in those of H. excavatum.

Prevalence of symbionts

To assess the prevalence of symbionts in H. scupense nymphs and adult tick stages, as well as the effect of gender, we first sequenced the PCR product for each symbiont to validate the sequences of the symbionts. Sixteen engorged nymphs were tested and the results show that 45% of them carry Francisella endosymbiont while 22.22% of them harbor Ricketessia endosymbiont. For adult tick, PCR amplification of 40 males H. scupense revealed that 35.13% harbor Francisella endosymbiont. Interestingly, 80% of half-engorged females were positive for Francisella endosymbiont while 66,66% of them were positive with Rickettsia endosymbiont. Interestingly for Francisella endosymbiont, we have detected a significant difference between adult and nymphal stages as well as between males and females (p<0.05).

Discussion

Previous surveys on ticks microbiota have shown carriage of multiple symbionts which are very important for their physiology, fecundity, and vector competence [32-34]. Currently, several studies were carried out on microbial populations in ticks such as Ixodes, Rhipiciphalus, Haemaphysalis, Amblyomma, Dermacentor [35-41]. However, little is known about the diverse microbiome of the tick genus Hyalomma associated with cattle. Moreover, there is no information regarding the microbial population structure of the most dominant Tunisian cattle tick H. scupense despite its veterinary and economic importance. It is of great interest to know crucial details on the microbial composition and their symbionts to improve our knowledge about tick bacterial communities. Therefore, this investigation may shed light on the vectorial competency of these vectors to transmit pathogens to vertebrate hosts. We present here the first characterization of the whole microbial communities of the monotropic cattle tick H. scupense according to the stages and sex and its comparison with the microbial diversity of adults H. scupense tick of two other dominant Hyalomma species which adult stages are infesting cattle, namely H. excavatum and H. marginatum.

Next generation sequencing of the hypervariable V3-V4 region of bacterial 16S rRNA gene was performed using Hyalomma specimens with Illumina Miseq. Similar to other studies, we found that the most dominant phylum was Proteobacteria. Additionally, the bacterial microbiota of Hyalomma was dominated by three principal genera; namely the two symbiotic/pathogenic bacteria Francisella and Rickettsia, and the endosymbiotic M. mitochondrii. Previous studies on other genera like Rhipicephalus have shown that they were mainly infected with Coxiella and Rickettsia with an association of Coxiella-like endosymbionts with females [37, 42]. A more recent study on the microbiome of Hyalomma species infesting livestock in Pakistan showed that Francisella, Rickettsia, and Coxiella were the most dominant tick bacterial identified species [43, 44]. Nevertheless, our results correlate with another survey on ticks in Turkey, where Coxiella was not detected in Hyalomma samples, while Francisella and Rickettsia predominate in the microbiome of H. excavatum and H. marginatum [28]. In our study, it was not entirely surprising that we detected the genus Francisella at high relative abundance associated with the absence of Coxiella endosymbiont, despite the higher rate of transovarial transmission and the abundance of Coxiella endosymbiont in several other tick genera. This endosymbiont was detected using NGS in a large variety of hard ticks, including Amblyomma americanum [45], Haemaphysalis longicornis [35], Ornithodoros amblus [46], Rhipicephalus microplus [47], and Rhipicephalus sanguineus [37]. Our findings are similar to those of Duron et al. (2015) who detected at low frequency Coxiella endosymbiont in approximately one-third of their targeted species [47]. Furthermore, Gehrart and his team suggested that Francisella has replaced Coxiella in the Gulf Coast tick, Amblyomma maculatum [48].

We suggest that the lack of detection of Coxiella infection in our samples and the abundance of another maternally inherited endosymbiont may be due to the replacement and competition of this ancient endosymbiont with other maternally inherited endosymbionts. In our case, we have revealed the presence of three other genera of maternally inherited bacteria: Francisella, M. mitochondrii and Rickettsia endosymbiont in all tick specimens. The high distribution of Francisella among all our tick species suggests that they may have independently replaced Coxiella endosymbiont as an alternative obligate symbiont. The importance of Francisella in Tunisian Hyalomma ticks is probably the result of the interaction and coevolution between the microbiome community and the tick’s ecological modification and restricted diet. Although it is important to emphasize that physiological and nutritional investigation on the symbiotic functions of Francisella are required to validate their role as alternative obligate symbionts. Moreover, Genome sequencing of these bacteria demonstrates that they evolved by developing adaptative mechanisms implicated in tick survival however, they have highly conserved the major genes responsible for the synthesis of vitamins B, cofactors, and some amino acids like Coxiella endosymbiont despite their restraint genome [19–21, 24, 48].

Interestingly, we report here, using high throughput sequencing, the first detection of the obligate intracellular mitochondrial tick endosymbiont M. mitochondrii in eggs of Hyalomma tick with a high abundance of more than 65%, however this density was considerably decreased in the other stages of H. scupense (nymphs and adults), along with the increase of other two endosymbionts. The distribution and the transovarial transmission of this intracellular endosymbiont in H. scupense suggested that this association might be obligate, and have a potential role in the physiological fitness of H. scupense tick. Furthermore, this bacterium is significantly abundant in H. marginatum and to a lesser extent in H. excavatum with RPA of 34.5 and 17.8% respectively. Recently, Selmi et al. reported that M. mitochondrii was prevalent at a rate of 8% in partially fed H. dromedarii and H. impeltatum ticks collected from dromedaries in Tunisia [49]. A recent study on the detection of pathogens and M. mitochodrii in Egyptian cattle ticks using the Reverse Line Blot hybridization (RLB) showed that 11.6% of pools of H. excavatum are infected with M. mitochondrii while only 2.9% of R. annulatus pools are infected by this bacteria [50]. Moreover, the detection of this endosymbiotic bacterium in other hard ticks is very variable [26, 51]. M. mitochondrii is well-described in I. ricinus [25] where it was detected in the mitochondria of ovaries. These bacteria which are included in the α-Proteobacteria entered the mitochondria of the oocyst cells. About 94–100% of adult females of I. ricinus are infected with this bacterium with a 100% transovarial transmission rate [25].

Additionally, we have studied various aspects of microbial diversity including species, sex, and life stage. The investigation of the microbial diversity with Haylomma species indicates that the adults of H. marginatum and H. excavatum exhibits more diverse and richer microbiota than H. scupense. Previous microbial diversity studies in three Hyalomma species collected in Turkey also indicated that H. excavatum and H. marginatum harbor more diverse microbiota than H. aegyptium [28]. This diversity is influenced by several determinants, mainly, environmental factors like habitat [52], geographical dispersion [53], bioclimatic conditions [54], sample location [55], soil and plant associated bacteria [56], and tick’s host [38, 57].

H. marginatum and H. excavatum are probably exposed to more complex environmental conditions as they pass through different hosts during their development particularly at juvenile stages [58]. Moreover, it is well known that blood meals have a strong impact on tick microbial diversity, composition, and species richness as mentioned by Swei and Kwan [38]. Indeed, ticks acquire more microorganisms, including pathogens, from hosts during their blood meals. More diverse hosts and larger numbers of vertebrate hosts hypothetically drive to more diverse microbiota [59]. This is probably the case for the outdoor H. marginatum and H. excavatum ticks, indeed, these tick juveniles feed, according to their tropism, on a variety of small terrestrial mammals and birds, whilst their adults can engorge on a variety of large herbivores such as goats, sheep, cattle, horses, camels [60, 61]. In contrast, H. scupense, exhibits a domestic behavior, and cattle are by far the almost exclusive host for adults and juveniles in Tunisia [5, 62]. Other studies found that the use of different tick species feeding on the same host don’t even have the same microbiomes, suggesting, therefore, that the tick microbiome is, to a certain degree, governed by species specific determinants [63]. Microbial composition was also affected by sex. Females H. scupense microbiota was less diverse and rich as compared to males, but inherited a high relative abundance of endosymbionts than males especially their OTUs number. We also found a higher prevalence of Francisella in females, especially in engorged females (100%). Similar results were reported in other studies that typically [42, 64, 65] In the same way, Van Treuren and his team found that females show less diverse microbiota than males [53]. The increased RPA of Rickettsia and Francisella endosymbiont that we recorded in females relative to males could be an adaptation to reproductive requirements and transovarial transmission. In addition, we demonstrated efficient maternal transmission of these two endosymbionts.

According to our metagenomic analysis, we found a significant loss of bacterial species richness in adults when compared to nymphs. Francisella and Rickettsia become dominant at older life stages correlated with the loss of microbiome richness. Our results are similar to another study on the microbiome of Ixodes pacificus [38]. This change is obviously due to the variation on tick activity and their metabolic function between their different life stages and sex. Indeed, tick’s obligatory endosymbiont have a crucial role in its development, nutrition, reproductive fitness, and tick adaptation to new environmental conditions in the tick life cycle [11, 59]. Furthermore, it is also important to consider the potential role of the environmental conditions and the difference of the ecological niches between species during their life cycle in the acquisition and the expression of microbiota like for instance the case of the domestic H. scupense with the outdoor ticks H. marginatum and H. excavatum.

Our results on symbionts of Hyalomma ticks may contribute to improve our knowledge on the interaction between tick bacterial communities and their hosts opening the way to develop subsequently applied research targeting the development of new control options against ticks and tick-borne pathogens. Bacterial endosymbionts may affect tick’s physiology and their reproductive fitness, they may also influence tick’s vectorial capacity for transmitted pathogens, and finally, they may interact with the tick hosts with potential veterinary and zoonotic outcomes in particular for Francisella and Rickettsia bacteria.

Conclusion

Overall, the analysis of the bacterial diversity within three Hyalomma species reveals that H. marginatum and H. excavatum have greater diversity than H. scupense. Furthermore, microbial diversity and composition vary according to the tick’s life stage and sex in the specific case of H. scupense. The endosymbionts Francisella, M. mitochondrii and Rickettsia were shown to be the most prevalent in Hyalomma. According to our findings, all studied Hyalomma tick species possess zoonotic bacteria genera and could potentially operate as vectors for various zoonoses. Rickettsia and Francisella are the most common zoonotic bacteria found in Hyalomma ticks.

This study provides general information about microbial communities in Hyalomma ticks and their endosymbionts. This information provides critical clues for future studies aimed at the prevention and control of neglected tick and tick-borne diseases in the area using innovative approaches.

26 Oct 2021

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Shawky M. Aboelhadid, PhD

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. In your Methods section, please provide additional location information, including geographic coordinates of your field collection site if available.

3. We note that you are reporting an analysis of a microarray, next-generation sequencing, or deep sequencing data set. PLOS requires that authors comply with field-specific standards for preparation, recording, and deposition of data in repositories appropriate to their field. Please upload these data to a stable, public repository (such as ArrayExpress, Gene Expression Omnibus (GEO), DNA Data Bank of Japan (DDBJ), NCBI GenBank, NCBI Sequence Read Archive, or EMBL Nucleotide Sequence Database (ENA)). In your revised cover letter, please provide the relevant accession numbers that may be used to access these data. For a full list of recommended repositories, see http://journals.plos.org/plosone/s/data-availability#loc-omics or http://journals.plos.org/plosone/s/data-availability#loc-sequencing.

4. We note that the grant information you provided in the ‘Funding Information’ and ‘Financial Disclosure’ sections do not match.

When you resubmit, please ensure that you provide the correct grant numbers for the awards you received for your study in the ‘Funding Information’ section.

5. Thank you for stating the following financial disclosure:

“HB

CGIAR Research Program on Livestock (CRP Livestock)

Laboratory of epidemiology of enzootic infections in herbivores in Tunisia: application to control (LR16AGR01), Ministry of Higher Education and Scientific Research, Tunisia

PromEssE - ANPR MOBIDOC, Ministry of Higher Education and Scientific Research, Tunisia”

Please state what role the funders took in the study.  If the funders had no role, please state: "The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript."

If this statement is not correct you must amend it as needed.

Please include this amended Role of Funder statement in your cover letter; we will change the online submission form on your behalf.

6. Thank you for stating the following in the Acknowledgments Section of your manuscript:

“This study was financially supported by the ICARDA - CGIAR Research Program on Livestock (CRP Livestock), and the "Laboratory of epidemiology of enzootic infections in herbivores in Tunisia: application to control" (LR16AGR01) funded by the Ministry of Higher Education and Scientific Research, Tunisia. This study is also carried out under the MOBIDOC scheme, funded by The Ministry of Higher Education and Scientific Research through the PromEssE project and managed by the ANPR”

We note that you have provided additional information within the Acknowledgements Section that is not currently declared in your Funding Statement. Please note that funding information should not appear in the Acknowledgments section or other areas of your manuscript. We will only publish funding information present in the Funding Statement section of the online submission form.

Please remove any funding-related text from the manuscript and let us know how you would like to update your Funding Statement. Currently, your Funding Statement reads as follows:

“HB

CGIAR Research Program on Livestock (CRP Livestock)

Laboratory of epidemiology of enzootic infections in herbivores in Tunisia: application to control (LR16AGR01), Ministry of Higher Education and Scientific Research, Tunisia

PromEssE - ANPR MOBIDOC, Ministry of Higher Education and Scientific Research, Tunisia”

Please include your amended statements within your cover letter; we will change the online submission form on your behalf.

7. In your Data Availability statement, you have not specified where the minimal data set underlying the results described in your manuscript can be found. PLOS defines a study's minimal data set as the underlying data used to reach the conclusions drawn in the manuscript and any additional data required to replicate the reported study findings in their entirety. All PLOS journals require that the minimal data set be made fully available. For more information about our data policy, please see http://journals.plos.org/plosone/s/data-availability.

Upon re-submitting your revised manuscript, please upload your study’s minimal underlying data set as either Supporting Information files or to a stable, public repository and include the relevant URLs, DOIs, or accession numbers within your revised cover letter. For a list of acceptable repositories, please see http://journals.plos.org/plosone/s/data-availability#loc-recommended-repositories. Any potentially identifying patient information must be fully anonymized.

Important: If there are ethical or legal restrictions to sharing your data publicly, please explain these restrictions in detail. Please see our guidelines for more information on what we consider unacceptable restrictions to publicly sharing data: http://journals.plos.org/plosone/s/data-availability#loc-unacceptable-data-access-restrictions. Note that it is not acceptable for the authors to be the sole named individuals responsible for ensuring data access.

We will update your Data Availability statement to reflect the information you provide in your cover letter.

8. We note that you have stated that you will provide repository information for your data at acceptance. Should your manuscript be accepted for publication, we will hold it until you provide the relevant accession numbers or DOIs necessary to access your data. If you wish to make changes to your Data Availability statement, please describe these changes in your cover letter and we will update your Data Availability statement to reflect the information you provide.

9. PLOS requires an ORCID iD for the corresponding author in Editorial Manager on papers submitted after December 6th, 2016. Please ensure that you have an ORCID iD and that it is validated in Editorial Manager. To do this, go to ‘Update my Information’ (in the upper left-hand corner of the main menu), and click on the Fetch/Validate link next to the ORCID field. This will take you to the ORCID site and allow you to create a new iD or authenticate a pre-existing iD in Editorial Manager. Please see the following video for instructions on linking an ORCID iD to your Editorial Manager account: https://www.youtube.com/watch?v=_xcclfuvtxQ

10. We note that Figure 1 in your submission contain map images which may be copyrighted. All PLOS content is published under the Creative Commons Attribution License (CC BY 4.0), which means that the manuscript, images, and Supporting Information files will be freely available online, and any third party is permitted to access, download, copy, distribute, and use these materials in any way, even commercially, with proper attribution. For these reasons, we cannot publish previously copyrighted maps or satellite images created using proprietary data, such as Google software (Google Maps, Street View, and Earth). For more information, see our copyright guidelines: http://journals.plos.org/plosone/s/licenses-and-copyright.

We require you to either (1) present written permission from the copyright holder to publish these figures specifically under the CC BY 4.0 license, or (2) remove the figures from your submission:

a. You may seek permission from the original copyright holder of Figure 1 to publish the content specifically under the CC BY 4.0 license.

We recommend that you contact the original copyright holder with the Content Permission Form (http://journals.plos.org/plosone/s/file?id=7c09/content-permission-form.pdf) and the following text:

“I request permission for the open-access journal PLOS ONE to publish XXX under the Creative Commons Attribution License (CCAL) CC BY 4.0 (http://creativecommons.org/licenses/by/4.0/). Please be aware that this license allows unrestricted use and distribution, even commercially, by third parties. Please reply and provide explicit written permission to publish XXX under a CC BY license and complete the attached form.”

Please upload the completed Content Permission Form or other proof of granted permissions as an "Other" file with your submission.

In the figure caption of the copyrighted figure, please include the following text: “Reprinted from [ref] under a CC BY license, with permission from [name of publisher], original copyright [original copyright year].”

b. If you are unable to obtain permission from the original copyright holder to publish these figures under the CC BY 4.0 license or if the copyright holder’s requirements are incompatible with the CC BY 4.0 license, please either i) remove the figure or ii) supply a replacement figure that complies with the CC BY 4.0 license. Please check copyright information on all replacement figures and update the figure caption with source information. If applicable, please specify in the figure caption text when a figure is similar but not identical to the original image and is therefore for illustrative purposes only.

The following resources for replacing copyrighted map figures may be helpful:

USGS National Map Viewer (public domain): http://viewer.nationalmap.gov/viewer/

The Gateway to Astronaut Photography of Earth (public domain): http://eol.jsc.nasa.gov/sseop/clickmap/

Maps at the CIA (public domain): https://www.cia.gov/library/publications/the-world-factbook/index.html and https://www.cia.gov/library/publications/cia-maps-publications/index.html

NASA Earth Observatory (public domain): http://earthobservatory.nasa.gov/

Landsat: http://landsat.visibleearth.nasa.gov/

USGS EROS (Earth Resources Observatory and Science (EROS) Center) (public domain): http://eros.usgs.gov/#

Natural Earth (public domain): http://www.naturalearthdata.com/

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Yes

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: No

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: No

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: For the authors:

Thank you for this research, which deals with very interesting subject with little data on ticks and its symbiotic and commensal/pathogenic bacteria.

I have some comments/remarks to the respected authors. As follow:

I- Generally:

• Please add abbreviation list for all abbreviations you used e.g. rRNA, 16S, 25S, V3-V4, OUT, RPA, NGS.

• 'Candidatus Midichloria mitochondrii' please review this bacterium species scientific name and then after unify witting name and style of this bacterium throughout the manuscript.

II- Other comments: many typo errors, please revise the manuscript well

Abstract:

• P7: next generation

The analysis…

….for 16S RNA of?????

Hyalomma spp. or use H. scupense

Common bacterial genera founf in Hyalomma ticks

Introduction

• P8 : Hyalomma spp. is the most prevalent ticks infesting cattle

Materials and methods

• P10: 'adult' not italic

Cattle breeding barns

16S and 25S rRNA genes (repeat in P13)

'bleach' please specify the material you used

• P11: 'tick's egg' replace by Hyalomma spp. egg

• P11 and P13: in table 2 mentioned that you used a specific primer to amplify Cytochrome b mtDNA gene of Theileria annulata from the collected ticks. Interestingly, I did not any results or discussion on the usage of this primer, why??!!, although in the introduction section and study design, you emphasized cattle theileriosis and ticks role in it also, mentioned that ticks were collected from sites with pervious history of theileriosis.

• P12: 9 instead of nine

Results

• P13: spp. not italic

• P14: However, Francisellacea was the dominant family in the female of H. scupense with 78.8% of…..

'adult' not italic

Fig.2: adult ticks

• P15: Fig 4. Hyalomma scupense

• P16: ' suggesting the potential reproductive role of those symbionts and their correlation with the tick stage. ' please omit or rephrase or remove to discussion section as no suggestions in the results. Results are based on facts not suggestions.

Discussion

• P18: Selmi et al. reported

• P19: 'RA'??!! you mean RPA or another meaning?

Dear respected authors, thank you again.

Regards.

Reviewer #2: Dear Authros, The article is written well but there are some shortcomings that can be incorporated to improve it

1. There are formatting errors (pdf file is attached)

2. There need statistical analysis like regression to find prevalence and correlation with relation to area, tick stage and gender of the tick

3. There is a recent published article related to your article which should be incorporated in discussion

Al-Hosary A, Răileanu C, Tauchmann O, Fischer S, Nijhof AM, Silaghi C. Tick species identification and molecular detection of tick-borne pathogens in blood and ticks collected from cattle in Egypt. Ticks Tick Borne Dis. 2021 May;12(3):101676. doi: 10.1016/j.ttbdis.2021.101676. Epub 2021 Jan 26. PMID: 33540276.

4. There is need to change the figure 3 and it is suggested to keep the colours referring to each organism must be same in the whole figure.

Regards

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: Yes: Khaled Sultan

Reviewer #2: Yes: Prof Muhammad Imran Rashid

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

Submitted filename: PONE-D-21-29206.docx

Click here for additional data file.

Submitted filename: Comments annotated_complete.pdf

Click here for additional data file.

16 Feb 2022

Reviewer #1:

I- General comments:

• Please add abbreviation list for all abbreviations you used e.g. rRNA, 16S, 25S, V3-V4, OUT, RPA, NGS.

The following abbreviation list was added, please refer to lines 361-369

Abbreviation list:

rRNA: Ribosomal ribonucleic acid

16S: Gene coding for the small ribosomal 16 RNA gene

12S: gene coding for the small ribosomal 12 RNA gene

V3-V4: the hypervariable regions of the 16S rRNA gene

OUT: Operational Taxonomic Unit

RPA: Relative Percent Abundance

NGS: Next Generation Sequencing

M. mitochondrii: Midichloria mitochondrii

• 'Candidatus Midichloria mitochondrii' please review this bacterium species scientific name and then after unify witting name and style of this bacterium throughout the manuscript.

Verified and standardized as Midichloria mitochondrii from NCBI Taxonomy Browser, all over the MS

II- Other comments: many typo errors, please revise the manuscript well

The manuscript was revised and typo errors were corrected

III- Specific comments

Abstract:

• Point 7 (P7): next generation

Corrected as required, please refer to page 2 line 3

The analysis…

corrected (T in capital), Page 2 Line 4

….for 16S RNA of?????

Corrected as follows: for the 16S rRNA (V3-V4 region) of tick bacterial microbiota and…, please refer to page 2 lines 3 and 4

Hyalomma spp. or use H. scupense

corrected as follows: Hyalomma spp, please refer to Page 2 line 8

Common bacterial genera found in Hyalomma ticks

corrected as follows: Accordingly, Hyalomma ticks could represent potential vectors for these zoonotic bacterial agents…, please refer to Page 2 lines 9-10

Introduction

• P8 : Hyalomma spp. are the most prevalent ticks infesting cattle

corrected as required, please refer to page 2 line 21

Materials and methods

• P10: 'adult' not italic

Corrected as required, all over the MS

Cattle breeding barns

Corrected, please refer to Page 3 line 16

16S and 25S rRNA genes (repeat in P13)

Corrected as follows: 16S and 12S rRNA genes, please refer to page 3 line 23 and all over the MS

'bleach' please specify the material you used

The used material was specified as required: commercial bleach, please refer to P4 line 3

• P11: 'tick's egg' replace by Hyalomma spp. Egg

The sentence was changed as follows: one pool of H. scupense eggs and…, please refer to p4 line 12

• P11 and P13: in table 2 mentioned that you used a specific primer to amplify Cytochrome b mtDNA gene of Theileria annulata from the collected ticks. Interestingly, I did not any results or discussion on the usage of this primer, why??!!, although in the introduction section and study design, you emphasized cattle theileriosis and ticks role in it also, mentioned that ticks were collected from sites with pervious history of theileriosis.

The authors agree with reviewer comment, the primers were removed from the table, it was a careless mistake, please refer to table 2

• P12: 9 instead of nine

Done, please refer to p6 line 15.

Results

• P13: spp. not italic

Corrected, please refer to p7 line 8

• P14: However, Francisellacea was the dominant family in the female of H. scupense with 78.8% of…..

Corrected, please refer to p8 line 20

'adult' not italic

Fig.2: adult ticks

Corrected

Please refer to p8 line 24

• P15: Fig 4. Hyalomma scupense.

corrected in italic, p9 line 18

• P16: ' suggesting the potential reproductive role of those symbionts and their correlation with the tick stage. ' please omit or rephrase or remove to discussion section as no suggestions in the results. Results are based on facts not suggestions.

The text was removed

Discussion

• P18: Selmi et al. reported

Corrected as required, please refer to p12 line 29

• P19: 'RA'??!! you mean RPA or another meaning?

Corrected: RPA, please refer to p14 line 3

Reviewer #2: Dear Authros, the article is written well but there are some shortcomings that can be incorporated to improve it

1. There are formatting errors (pdf file is attached)

All suggestions made by Reviewer #2 were considered. The changes in the MS were put in blue color.

For the Reviewer #2 questions hand written in the pdf version:

Q1: Rephrase, no sense (p4, Study area and tick sampling)

The text was modified as follows:

For this purpose, cattle barns were selected according to previous tropical theileriosis cases

Please refer to lines 14 and 15

Q2 Why not 18S rRNA, ticks are eukaryote?

We agree the Reviewer comment, ticks are eukaryotes of course, however, we targeted the mitochondrial 12S and 16S ribosomal RNA (rRNA) genes.

In fact, rRNA 16S and 12S rRNA are the most commonly used markers to study tick’s phylogeny and they have been demonstrated to be able to differentiate the species of some ticks (Anderson et al., 2004; Vial et al., 2006; Chen et al., 2012). Furthermore, the number of annotated sequences of rRNA 16S genes in GenBank was increasing recently providing a strong database for tick’s species.

The text was modified as follows:

…was done using the mitochondrial 16S and 12S rRNA genes…

Please refer to p4 line 23

Q2 : How 6 groups?

Four groups for adults, one for nymphs and one for eggs

In the MS, the sentence war modified as follows:

A total of six pools were prepared for next-generation sequencing composed as follows: one pool composed by 60 nymphs of H. scupense, one pool of H. scupense eggs and 4 pools of adult ticks composed each one of 30 H. scupense females, 30 H. scupense males, 30 H. marginatum adults and 30 H. excavatum adults. Please refer to p5 lines 11-13

Comment 2. There need statistical analysis like regression to find prevalence and correlation with relation to area, tick stage and gender of the tick

We added statistical analysis using chi 2 test to check the significance of the correlation between of symbiont prevalence and sex, and life stage of H. scupense.

We have studied the prevalence of symbiont only for H. scupense samples. In this study we targeted the symbionts of H. scupence ticks. Moreover, the parameter “Area” was not taken into consideration in the current study

The following text was added

To compare the prevalence of symbionts between sexe and life stage of H. scupense ticks, the test chi 2 was performed. Results were considered significant at 5% threshold.

Please refer to p6 lines 11 and 12

The “Result section” was also modified, and the test result was added. Please refer to p10 line 3 and p11 Line 4.

3. There is a recent published article related to your article which should be incorporated in discussion

Al-Hosary A, Răileanu C, Tauchmann O, Fischer S, Nijhof AM, Silaghi C. Tick species identification and molecular detection of tick-borne pathogens in blood and ticks collected from cattle in Egypt. Ticks Tick Borne Dis. 2021 May;12(3):101676. doi: 10.1016/j.ttbdis.2021.101676. Epub 2021 Jan 26. PMID: 33540276.

We included this article to the discussion section. The following text was added:

Recent study on the detection of pathogens and M. mitochodrii in Egyptian cattle ticks using the Reverse Line Blot hybridization (RLB) showed that 11.6% of pools of H. excavatum are infected with M. mitochondrii while only 2.9% of R. annulatus pools were infected by this bacteria [50]. Please refer to p12 lines 1-4

The citation was added to the reference list at the end of the MS

4. There is need to change the figure 3 and it is suggested to keep the colours referring to each organism must be same in the whole figure.

The fig 3 was changed as required

Rephrase, omit the redundancy,

discuss more about the probable understanding factors that shape the microbial using more references

The discussion was partially rephrased and the following text was added:

This diversity is influenced by several determinants, mainly environmental factors like, habitat [52], geographical dispersion [53], bioclimatic conditions [54], sample location [55], soil and plant associated bacteria [56], and also the tick hosts [57,58].

H. marginatum and H. excavatum are probably exposed to more complex environmental conditions as they pass through different hosts during their development particularly at juvenile stages [59]. Moreover, it is well known that blood meals have a strong impact on tick microbial diversity, composition, and species richness as mentioned by Swei and Kwan [38]. Indeed, ticks acquire more microorganisms, including pathogens, from hosts during their blood meals. More diverse hosts and larger numbers of vertebrates hosts hypothetically drive to more diverse microbiota [60]. This is probably the case for the outdoor H. marginatum and H. excavatum ticks, indeed, these tick juveniles feed, according to their tropism, on a variety of small terrestrial mammals and birds, whilst their adults can engorge on a variety of large herbivores such as goats, sheep, cattle, horses, camels [61,62]. In contrast, H. scupense, exhibits a domestic behavior, and cattle are by far the almost exclusive host for adults and juveniles in Tunisia [5,63]. Other studies found that the use of different tick species feeding on the same host don’t even have the same microbiomes, suggesting therefore, that tick microbiome is, to a certain degree, governed by species specific determinants [64]. Please refer to p13 lines 13 – 27.

P8: Mention influence on tick physiology functional role of this endosymbiont for further insights, better to rewrite

The following text was added as suggested:

Our results on symbionts of Hyalomma ticks may contribute to improve our knowledge on the interaction between tick bacterial communities and their hosts opening the way to develop subsequently applied research targeting the development of new control options against ticks and tick-borne pathogens. Bacterial endosymbionts may affect tick’s physiology and their reproductive fitness, they may also influence tick’s vectorial capacity for transmitted pathogens, and finally they may interact with the tick hosts with potential veterinary and zoonotic outcomes in particular for Francisella and Rickettsia bacteria. Please refer to p14 lines 16 – 21.

Submitted filename: RESPONSE TO REVIEWERS.docx

Click here for additional data file.

14 Mar 2022

5 Apr 2022

We would like to thank the reviewers for their thoughtful comments and efforts towards improving our manuscript. In the following, we addressed comments to reviewer requirements below. In our response letter, the reviewers’ comments are numbered and colored in grey if no changes are needed and in black color if changes are required. The corresponding responses (prefaced by “Author response”) follow below, in blue color. Corresponding changes are red colored in the manuscript text on the revised file (Revised Manuscript with track changes).

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #2: All comments have been addressed

2. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #2: Yes

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #2: Yes

4. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #2: No

Author response:

Done, the following text was added:

"The relevant accession numbers used to access to our data are available on the following links https://www.ncbi.nlm.nih.gov/sra/PRJNA791601 (for all data)."

Please refer to page 8 lines 13 and 14

Submitted filename: Response to Reviewers.docx

Click here for additional data file.

25 Apr 2022

First insights into the microbiome of Tunisian Hyalomma ticks gained through next-generation sequencing with a special focus on H. scupense

PONE-D-21-29206R2

Dear Dr. Mohamed Aziz ,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Shawky M Aboelhadid, PhD

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #2: All comments have been addressed

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #2: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #2: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #2: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #2: Yes

**********

6. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #2: The study was interesting and i congratulate all authors for their efforts. They have incorporated all changes.

Goodluck

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #2: Yes: Muhammad Imran Rashid

29 Apr 2022

PONE-D-21-29206R2

First insights into the microbiome of Tunisian Hyalomma ticks gained through next-generation sequencing with a special focus on H. scupense

Dear Dr. Darghouth:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Professor Shawky M Aboelhadid

Academic Editor

PLOS ONE