A longitudinal study of the pulmonary mycobiome in subjects with and without chronic obstructive pulmonary disease.

BACKGROUND: Few studies have examined the stability of the pulmonary mycobiome. We report longitudinal changes in the oral and pulmonary mycobiome of participants with and without COPD in a large-scale bronchoscopy study (MicroCOPD).
METHODS: Repeated sampling was performed in 30 participants with and 21 without COPD. We collected an oral wash (OW) and a bronchoalveolar lavage (BAL) sample from each participant at two time points. The internal transcribed spacer 1 region of the ribosomal RNA gene cluster was PCR amplified and sequenced on an Illumina HiSeq sequencer. Differences in taxonomy, alpha diversity, and beta diversity between the two time points were compared, and we examined the effect of intercurrent antibiotic use.
RESULTS: Sample pairs were dominated by Candida. We observed less stability in the pulmonary taxonomy compared to the oral taxonomy, additionally emphasised by a higher Yue-Clayton measure in BAL compared to OW (0.69 vs 0.22). No apparent effect was visually seen on taxonomy from intercurrent antibiotic use or participant category. We found no systematic variation in alpha diversity by time either in BAL (p-value 0.16) or in OW (p-value 0.97), and no obvious clusters on bronchoscopy number in PCoA plots. Pairwise distance analyses showed that OW samples from repeated sampling appeared more stable compared to BAL samples using the Bray-Curtis distance metric (p-value 0.0012), but not for Jaccard.
CONCLUSION: Results from the current study propose that the pulmonary mycobiome is less stable than the oral mycobiome, and neither COPD diagnosis nor intercurrent antibiotic use seemed to influence the stability.

Introduction

The fungal part of the pulmonary microbiome, the mycobiome, has gained more interest recent years [1]. An important part of investigating the potential presence of a pulmonary mycobiome, is to examine the temporal variability upon repeated examinations.

To our knowledge, no study has published data on the stability of the pulmonary mycobiome in subjects without lung disease. Further, we are only aware of four mycological studies where repeated measurements were performed in a chronic obstructive pulmonary disease (COPD) population [2-5]. The first study collected two sputum samples in stable COPD patients, and observed low repeatability of Aspergillus fumigatus cultures [2]. Culture-based techniques have low sensitivity [6], and often fail to identify the complete mycobiome [7]. It is thus hard to generalise results from the culture-based study [2]. The three other studies examined longitudinal changes in the lung mycobiome during exacerbations [3-5]. No significant changes were seen in airway mycobiome profiles, alpha diversity, or beta diversity, despite treatment with oral antibiotics and corticosteroids in the study by Tiew et al. [3]. No statistics were applied on the repeated samples in Liu et al.’s study [5], while Su et al. found an unstable mycobiome in included patients [4]. A few studies have performed longitudinal analysis of sputum samples in cystic fibrosis (CF) [8-10]. However, sputum samples are susceptible to contamination from the upper respiratory tract and oral cavity, and may not be representative of the pulmonary mycobiome. Oropharyngeal contamination can be minimised by protected bronchoscopic sampling [11], which in addition provides accurate assessment over the actual sample site.

The Bergen COPD Microbiome study (short name “MicroCOPD”) is a large single-centre study of the pulmonary microbiome conducted in Bergen, Norway [12]. Samples were collected from both the upper and the lower airways, the latter providing particular attention to contamination by using a sterile inner catheter in the working channel of a bronchoscope. We have previously published analyses on the oral and pulmonary mycobiome, in addition to comparisons between the healthy and the COPD oral and pulmonary mycobiomes using data from the MicroCOPD study [13]. In the current paper, we report on the stability of the oral and pulmonary mycobiomes in participants with and without COPD who underwent bronchoscopies at two different time points, and the potential effects on the mycobiomes from intercurrent antibiotic use.

Materials and methods

Study design and population

The design and data collection in the MicroCOPD study is previously published [12]. Briefly, the study was carried out at the outpatient clinic of the Department of Thoracic Medicine, Haukeland University Hospital. Participant enrolment started April 11th, 2013, and finished June 5th, 2015. A total of 93 COPD patients and 100 participants without lung disease (controls) provided samples for mycobiome analyses. Controls were mainly recruited among participants from a previous general population study [14], in a non-random manner. Participants were excluded if they were hypoxemic despite supplemental oxygen, hypercapnic, had an increased bleeding risk, or possessed certain cardiac risk factors like a mechanical valve. Ongoing COPD exacerbations and recent use of antibiotics or systemic corticosteroids were reasons for postponing participation in order to examine the stable mycobiome [12]. The study was conducted in accordance with the declaration of Helsinki and guidelines for good clinical practice. The regional committee of medical ethics Norway north division (REK-NORD) approved the project (project number 2011/1307), and all participants provided informed written consent.

Among the 193 participants, 30 participants with COPD and 21 controls were eligible for a repeated bronchoscopy 3–12 months after the first. Inclusion for a second bronchoscopy stopped when the main study ended. Information on treatment received outside of the study in the time between the two study visits was collected. Antibiotic use in this period was termed intercurrent antibiotic use and was not part of the exclusion criteria unless given recently before the bronchoscopy.

COPD was identified by a post-bronchodilator FEV1/FVC ratio < 0.7 and a corresponding symptom history, in accordance with the Global Initiative for Chronic Obstructive Lung Disease (GOLD) report [15]. The COPD diagnoses were carefully re-evaluated by experienced pulmonologists in late 2015 based on spirometry, radiologic imaging, respiratory symptoms, and disease history.

Data collection

At the day of bronchoscopy, peripheral venous blood was drawn, and post-bronchodilator spirometry was performed. Information on comorbidities, medication use, demographics, smoking habits, and respiratory symptoms was collected in structured interviews.

Participants provided an oral wash sample (OW) immediately prior to the bronchoscopy procedure by gargling 10 ml of fluid from a bottle of phosphate buffered saline (PBS) for 1 minute. PBS from the same bottle was used for all samples from each unique participant, including OW, a negative control sample (NCS), and bronchoalveolar lavage (BAL). The NCS was collected from the PBS bottle directly into a sterile container and was thereafter subject to the same laboratory protocol as the procedural samples. Bronchoscopy was performed with the study subject in supine position and via oral access. Participants were offered light sedation with alfentanil. Topical anaesthesia was delivered by 10 mg/dose oral lidocaine pre-procedurally, and during the procedure through a spray catheter. Two fractions of 50 ml protected BAL were collected using a wax-tip protected catheter (Plastimed Combicath, prod number 58229.19) from the right middle lobe. The second portion of the BAL was utilised for mycobiome analysis in the current study. At the repeated bronchoscopy, a detailed medical history including medication use and exacerbation history since the previous bronchoscopy was obtained.

DNA extraction and sequencing

A combination of enzymatic lysis with lysozyme, mutanolysin and lysostaphin, and mechanical lysis methods using the FastPrep-24 as described by the manufacturers of the FastDNA Spin Kit (MP Biomedicals, LLC, Solon, OH, USA) was used to extract DNA. Samples were prepared for sequencing of the internal transcribed spacer (ITS) 1 region using a modified version of the Illumina 16S Metagenomic Sequencing Library Preparation guide (Part no. 15044223 Rev. B). The PCR amplification included 28 cycles using primer set ITS1-30F/ITS1-217R, where the sequences are GTCCCTGCCCTTTGTACACA and TTTCGCTGCGTTCTTCATCG [16], followed by an index PCR with 9 cycles. DNA sequencing was performed using paired-end sequencing (2x250 cycles) on an Illumina HiSeq sequencer (Illumina Inc., San Diego, CA, USA). Samples were sequenced in two different sequencing runs, and OW, BAL, and NCS from a given participant were always included in the same sequencing run. Both sequencing runs included samples from controls and participants with COPD.

Bioinformatic processing

Bioinformatic processing and analyses were performed with QIIME 2 version 2019.1 and 2019.10 [17], and R version 4.0.3 [18]. Raw sequence data was quality controlled (via q2-demux) and trimmed using the q2-itsxpress plugin [19]. The Divisive Amplicon Denoising Algorithm version 2 (DADA2) (via q2-dada2) was used to identify and remove low-quality reads and chimeric sequences, resulting in the creation of exact amplicon sequence variants (ASVs) [20]. These ASVs were further curated using the LULU R package to remove artefactual ASVs [21]. Singletons, i.e. ASVs found in only one sample, and ASVs with a total abundance of less than 10 sequence reads across all samples, were excluded. The Decontam R package was used to identify ASVs likely to be contaminants using the prevalence-based method (user defined threshold  =  0.5) [22], and the contaminants were subsequently removed. Taxonomy was assigned to ASVs using the q2‐feature‐classifier [23] classify‐sklearn [24] with a UNITE database for fungi with clustering at 99% threshold level [25, 26]. Resulting ASVs assigned only as Fungi at kingdom level were manually investigated using the Nucleotide Basic Local Alignment Search Tool (BLASTN) program maintained by the National Center for Biotechnology Information (NCBI) in the Nucleotide database [27, 28]. ASVs with unambiguous BLASTN results were repeatedly assigned to new taxonomic assignments using UNITE databases with fungi or all eukaryotes with different threshold levels [25, 29–31] (via q2-feature-classifier [23] classify-sklearn [24] and classify-consensus-blast [32]). They were included for further analyses if the new assignments matched the BLASTN result. ASVs with ambiguous or non-fungal BLASTN results were discarded. Alpha diversity metrics (Shannon index) and beta diversity metrics (Bray-Curtis dissimilarity and Jaccard similarity coefficient) were estimated post rarefaction (subsampling without replacement) at sampling depth 2000 (via q2-diversity). The sampling depth was set as high as possible while excluding a minimum of samples.

Statistical analyses

Demographics were evaluated as means with standard deviations or percentages using Stata version 16 [33]. A flow chart showing the bioinformatic processing was created with the Flowchart Designer version 3 (http://flowchart.lofter.com). Taxonomy was presented as relative abundances per individual on genus level grouped by participant group and intercurrent antibiotic use. We calculated the Yue-Clayton measure of dissimilarity (1-θYC) between each sample pair from the first and the second bronchoscopy [34]. Medians of Shannon indexes from the first and second bronchoscopy were compared with Wilcoxon signed-rank test for paired analysis stratified by sample type. Differences in beta diversity were presented as principal coordinates analysis (PcoA) plots, and Procrustes analyses were performed including the three first axes from the PcoA result to check for differences in beta diversity between repeated bronchoscopies using the Vegan package in R [35]. Pairwise distances between the first and the second bronchoscopy were calculated using q2‐longitudinal [36] and separated on sample type compared with Kruskal-Wallis test, and on time between procedures.

Results

Flow chart

An overview of the data processing is shown in Fig 1.

Fig 1

Flow chart of fungal longitudinal analyses in the MicroCOPD study.

DADA2: Divisive Amplicon Denoising Algorithm version 2, seqs: sequences, ASV: amplicon sequence variant, OW: oral wash, BAL: bronchoalveolar lavage. Samples were sequenced in three different runs before trimming and denoising. Data from different sequencing runs were merged, and then processed to exclude contaminants and negative control samples prior to analyses.

Demographics of participants

Participants with COPD had a higher smoking exposure measured in pack years, more comorbidities, and a lower FEV1 compared to the controls (Table 1). These differences were not tested statistically as they were expected.

Table 1

Demographics of participants included in fungal longitudinal analyses in the MicroCOPD study.

Variable	Control, n = 21	COPD, n = 30	Comparison, p-value
Age (SD)	66.8 (5.5)	68.7 (6.2)	0.27
Male sex (%)	14 (66.7)	19 (63.3)	1.0
Intercurrent antibiotic use (%)	4 (19.1)	6 (20)	0.93
Number of medications (SD)	1.6 (2.0)	5.6 (3.5)	< 0.01
Use of inhaled steroids (%)	-	18 (60)	NA
Number of comorbidities (SD)	0.9 (1.3)	1.5 (1.4)	0.06
FEV 1 , % of predicted (SD)	104.3 (12.4)	59.7 (16.0)	< 0.01
FVC, % of predicted (SD)	116.0 (13.8)	100.0 (15.8)	< 0.01
FEV 1 /FVC-ratio (SD)	0.71 (0.05)	0.47 (0.11)	< 0.01
Pack years (SD)	22.1 (12.5)	32.1 (14.9)	0.02
Smoking status (%)			0.25
Daily	7 (33.3)	6 (20)
Ex	13 (61.9)	24 (80)
Never	1 (4.8)	-
mMRC Grade 2 and higher (%) *			NA
Grade 2 level ground	-	7 (24.1)
Grade 3 100 meters	-	5 (17.2)
Grade 4 resting dyspnoea	-	-
Time between procedures in days (SD)	156 (33.7)	151 (62.7)	0.22

FEV1: forced expiratory volume in 1 second, FVC: forced vital capacity, mMRC: modified medical research council dyspnoea scale. Data from first exam were used, except for sex, intercurrent antibiotic use, and time between procedures. Comparisons were done using t-test or Kruskal-Wallis depending on normality for continuous variables and chi-square test or Fisher’s exact test for categorical variables.

* One participant with COPD missed information on mMRC.

Taxonomy

Taxonomy of OW sample pairs is plotted in Fig 2A and S1 Fig. The nine most abundant taxa were visualised individually, while taxa with low abundances were merged and visualised as Others. More details are given in S2A Fig, showing all taxa, as well as Yue-Clayton measures. The Yue-Clayton measure is 0 with perfect similarity and 1 with perfect dissimilarity. Taxonomies from the majority of OW sample pairs seemed unchanged between the bronchoscopies, but it appeared that sample pairs without Candida dominance showed more instability (i.e. participant 16, 24, 35, 39, and 50 in S2A Fig). The average Yue-Clayton measure from OW sample pairs was 0.22.

Fig 2

Most abundant fungal taxonomic assignments in (A) oral wash (51 participants) and (B) bronchoalveolar lavage (45 participants). AB: Intercurrent antibiotic use, First: first bronchoscopy, Second: second bronchoscopy. Taxa are sorted on Candida in the first bronchoscopy. Each column represents a sample, and columns from the first bronchoscopy and the second bronchoscopy correspond to each other. That means, a first bronchoscopy column above and the corresponding second bronchoscopy column below show samples from the same participant. Not all sequences could be assigned taxonomy at the genus level and are therefore displayed as o__Malasseziales, o__Tremellales, or p__Ascomycota.

Taxonomy of 45 BAL sample pairs is similarly plotted in Fig 2B and S2B Fig. Only sample pairs with BAL samples from both bronchoscopies were included, which explains the lower number of sample pairs compared to OW. Candida is still the most dominant taxon, but less than for OW samples. The average Yue-Clayton measure from BAL sample pairs was 0.69. Few differences were visually seen between participant categories in both sample types.

Diversity

A considerable number of our BAL samples were omitted from diversity analyses due to subsampling (rarefaction). There was no significant difference in alpha diversity measured by Shannon index between the first and the second bronchoscopy in OW or BAL (Fig 3). Changes in Shannon index seemed unpredictable, with some being stable, some increasing, and some decreasing. The one participant with intercurrent antibiotic use and BAL available for diversity analyses showed a distinct increase in Shannon index. Similar observations were not seen in the OW group, where samples from participants with intercurrent antibiotic use both increased and decreased in alpha diversity.

Fig 3

Analysis of alpha diversity differences between first and second bronchoscopy.

BAL: bronchoalveolar lavage, OW: oral wash. A line was drawn between samples from the same participant, divided in BAL (12 samples) and OW (62 samples). Differences in Shannon were statistically tested with Wilcoxon signed-rank test with a significance level of 0.05.

PCoA plots were created to visualise differences in beta diversity (S3–S8 Figs). There were no obvious clusters on bronchoscopy number plotted with OW and BAL combined (S3 Fig) or for each sample type separately (S5 and S7 Figs). The M2 from Procrustes transformations were above 0.3 for all transformations (S6 and S8 Figs), which is often interpreted as dissimilar. The M2 statistic is a measure of fit, which increases with less concordance. However, results were only significant for OW samples (S6 Fig. Bray-Curtis: M2 = 0.314, p = 0.001, Jaccard: M2 = 0.7987, p = 0.002). The pairwise distance between each subject pair differed between OW and BAL using Bray-Curtis (Kruskal-Wallis chi-squared = 10.466, p-value = 0.001216), but not for Jaccard (Fig 4A). No specific trends were seen with increasing time between the bronchoscopies (Fig 4B).

Fig 4

Analysis of pairwise distances between first and second bronchoscopy grouped on (A) sample type and (B) time. BAL: bronchoalveolar lavage, OW: oral wash. Differences in pairwise distances from the first and the second bronchoscopy were statistically tested with Kruskal-Wallis test with a significance level of 0.05. Time was measured in days between the two bronchoscopy procedures.

Discussion

We have reported the oral and pulmonary mycobiome in controls and participants with COPD sampled at two time points. The oral mycobiome showed a higher degree of stability compared to the pulmonary mycobiome. Neither intercurrent antibiotic use nor time between bronchoscopies seemed to influence the mycobiomes.

Two CF studies have explored the stability of the pulmonary mycobiome using targeted amplicon sequencing. In the first paper, relative abundances of fungal taxa appeared to change by time, but were not statistically analysed [8]. The other CF study observed high relative abundances of Candida species which did not change during antibiotic treatment [10]. Low sample sizes, lack of controls, and frequent use of antibiotics and steroids, make comparisons of findings from the CF studies to our results difficult. Krause et al. observed a stable mycobiome in repeated BAL performed only 4–7 days after baseline [37]. However, results were based on 4 intubated and mechanically ventilated patients with pneumonia. A longitudinal study of filamentous fungi in the airways of participants with COPD and controls was performed by Bafadhel et al. by collecting sputum samples at baseline and three months later [2]. They found a poor repeatability of Aspergillus fumigatus in the participants with COPD, but the study focused exclusively on A. fumigatus and included cultures only. Su et al. reported an unstable mycobiome during exacerbations [4]. The results were based on sputum samples from six patients with COPD, and sampling was only performed during the hospital stay. Liu et al. examined the pulmonary mycobiome during an acute exacerbation in four participants with COPD, but with emphasis on the difference between sputum and oropharyngeal swabs [5]. No statistics were applied to the results from consecutive collected samples in the papers by Su and Liu et al. [4, 5], thus limiting interpretation. Tiew et al. collected sputum samples from 34 participants with COPD before an exacerbation, within 24 hours of an acute exacerbation, and again two weeks post exacerbation following treatment [3]. No significant changes were seen in airway mycobiome profiles, alpha diversity, or beta diversity, suggesting that treatment for an acute exacerbation did not influence the lung mycobiome. However, the sampling interval was short, and taxonomy was presented at group level, which could have masked intraindividual changes. The discrepancy to the taxonomic instability observed in our BAL samples, could perhaps be attributed to the use of sputum samples in the study by Tiew et al. [3]. Sputum samples are more prone to oral contamination, and we indeed observed a higher stability in our oral samples compared to BAL. Bronchoscopy and BAL have been associated with a potential immune response manifested by post-procedural fever and flu-like symptoms [38, 39]. We speculate that the participants experiencing an immune response could acquire immunisation against their own respiratory microorganisms during bronchoscopy, thereby eliminating these microorganisms and creating a taxonomic shift. The oral cavity is less triggered by the bronchoscopy, and is more accustomed to exposures, which could explain higher stability in OW samples. Influence on the lung mycobiome from bronchoscopy due to immunisation could be an important finding, but needs to be examined with multiple sampling time points in larger populations to be confirmed and to reveal any potential clinical implications.

In the current analyses, most sample pairs had a taxonomy dominated by Candida, particularly for OW samples. No apparent effect was visually seen on the mycobiomes from intercurrent antibiotic use or participant category. The lower average Yue-Clayton observed in OW sample pairs compared to BAL (0.22 vs 0.69) suggests a higher degree of stability in OW samples. Visually, it seemed as most OW pairs with a Candida dominance in the first sampling had Candida dominance in the second sampling, whereas BAL bronchoscopy pairs with a Candida dominance in the first bronchoscopy more often lacked Candida in the second bronchoscopy. By looking at the taxonomy, one gets the impression that samples without Candida experience higher fluctuations, suggesting Candida is involved in maintaining stability. In congruence with our results, the Candida rich oral mycobiome has previously been shown to have high stability [40]. In contrast to the stability in the oral mycobiome, analyses of the gut mycobiome of the Human Microbiome Project found high intraindividual variability, but Saccharomyces, Malassezia, and Candida were commonly identified longitudinally within individuals [41].

In the current paper, we observed that fungal alpha diversity (i.e. within-sample diversity) measured by Shannon index varied within individuals by time, but it was stable at group level for both OW and BAL samples. No consistent effect on each participant’s temporal change in alpha diversity was visually seen from intercurrent antibiotic use, but numbers were too small to analyse statistically. Subsampling by rarefaction was done to account for different sampling depth among samples. Rarefaction is included in QIIME 2’s diversity metric plugin, and it resulted in a considerable omission of BAL samples. Diversity analyses were thus performed on controls and participants with COPD together but stratified on sample type. This was considered appropriate due to small observed differences in taxonomies from the participant categories. Additionally, in a previous paper, we reported few differences between the healthy and COPD mycobiomes in the MicroCOPD study [13]. Distance matrices used in beta diversity (i.e. between-sample diversity) analyses are multidimensional. PCoA ordination is frequently used to display matrices at a low dimensional space, and to examine dissimilarities in composition. By applying a Procrustes transformation, one can examine how similar different coordinate matrices with corresponding points are. PCoA plots in the current paper showed no clusters on repeated procedures nor on antibiotic use, but the Procrustes transformation indicated a dissimilarity between first and second bronchoscopies in OW samples. In contrast, pairwise distances from repeated bronchoscopies drawn from beta diversity distance matrices were significantly higher for OW samples compared to BAL samples, again suggesting higher stability in OW samples. Significant difference was only observed in Bray-Curtis, and not for Jaccard. High relative abundances of Candida in OW samples could impact the abundance-based Bray-Curtis metric more than the absence/presence based Jaccard metric, and thus yield low pairwise distances in OW. Lack of any specific trend with increasing time between the bronchoscopies suggests that the mycobiomes are equally similar or dissimilar by time. Previous studies on temporal diversity changes in the pulmonary mycobiome have been conflicting, with some reporting stability [3, 8, 10] and some reporting fluctuations [4, 9]. Comparisons to our study are difficult due to inclusion of sputum from CF patients [8-10] or COPD exacerbations [3, 4].

The current study is, to our knowledge, the first to analyse the stability of the pulmonary mycobiome of participants with COPD and healthy controls by use of targeted amplicon sequencing. Nevertheless, some limitations should be mentioned. First, participants underwent bronchoscopy with different time intervals. Lack of a defined time interval might introduce biases, but pairwise distances drawn from Bray-Curtis and Jaccard distance matrices did not change much by time. Furthermore, when we sorted samples in the taxonomic barplots on time between bronchoscopies, no specific pattern was observed (S1 Fig). Second, possible batch effects occur when multiple sequencing runs are included. Batch effects have been considered on the whole MicroCOPD mycobiome data set, suggesting some effect on beta diversity and Sarocladium abundance [13]. Third, despite being a large study, some analyses suffer from low statistical power. Fourth, including only the second part of the BAL could impact the results. Another paper by our research group has shown high similarity between the first and the second fraction of BAL, suggesting little impact from choice of fraction [11]. Finally, it has been suggested that OW and BAL samples suffer from low reproducibility when repeatedly extracted and sequenced, but reproducibility improved when contamination was accounted for [42]. We used protected sampling methods and contamination removal through the validated R package Decontam, thus potentially reducing reproducibility issues.

Frequent use of cross-sectional study designs in mycobiome studies prevent conclusions on the mycobiome’s stability. Results from the current study propose that the pulmonary mycobiome is less stable than the oral mycobiome, and neither COPD diagnosis nor intercurrent antibiotic use seemed to influence the stability. Longitudinal studies with well-defined time intervals are needed to assess whether the pulmonary mycobiome is defined by large fluctuations or core taxa.

Most abundant fungal taxonomic assignments in (A) oral wash and (B) bronchoalveolar lavage. AB: Intercurrent antibiotic use, First: first bronchoscopy, Second: second bronchoscopy. Samples are sorted on time between bronchoscopies. Each column represents a sample, and columns from the first bronchoscopy and the second bronchoscopy correspond to each other. That means, a first bronchoscopy column above and the corresponding second bronchoscopy column below show samples from the same participant. Not all sequences could be assigned taxonomy at the genus level and are therefore displayed as o__Malasseziales, o__Tremellales, or p__Ascomycota.

(PDF)

Click here for additional data file.

Yue-Clayton plots of (A) oral wash and (B) bronchoalveolar lavage sample pairs from participants examined twice in the MicroCOPD study. YC: Yue-Clayton measure, First: first bronchoscopy, Second: Second bronchoscopy. A Yue-Clayton measure of 0 means identical sample pairs, while a Yue-Clayton measure of 1 means unidentical sample pairs.

(PDF)

Click here for additional data file.

Principal coordinates analysis plot using (A) Bray-Curtis and (B) Jaccard coloured by bronchoscopy number and sample type. First BAL: bronchoalveolar lavage samples from first bronchoscopy, First OW: oral wash samples from first bronchoscopy, Second BAL: bronchoalveolar lavage samples from second bronchoscopy, Second OW: oral wash samples from second bronchoscopy.

(PDF)

Click here for additional data file.

Principal coordinates analysis plot using (A and B) Bray-Curtis and (C and D) Jaccard coloured by intercurrent antibiotic use and sample type. BAL: bronchoalveolar, OW: oral wash.

(PDF)

Click here for additional data file.

Principal coordinates analysis plot of OW samples using (A and C) Bray-Curtis and (B and D) Jaccard coloured by bronchoscopy number and intercurrent antibiotic use with and without lines. First: first bronchoscopy, Second: Second bronchoscopy. A line was drawn between samples from the same participant. Red lines refer to participants receiving intercurrent antibiotics, while green lines refer to participants not receiving intercurrent antibiotics.

(PDF)

Click here for additional data file.

Principal coordinates analysis plot with Procrustes transformation of OW samples using (A and C) Bray-Curtis and (B and D) Jaccard coloured by bronchoscopy number and intercurrent antibiotic use with and without lines. M^2: The summed squares of deviations, First: first bronchoscopy, Second: Second bronchoscopy. A line was drawn between samples from the same participant. Red lines refer to participants receiving intercurrent antibiotics, while green lines refer to participants not receiving intercurrent antibiotics.

(PDF)

Click here for additional data file.

Principal coordinates analysis plot of BAL samples using (A and C) Bray-Curtis and (B and D) Jaccard coloured by bronchoscopy number and intercurrent antibiotic use with and without lines. First: first bronchoscopy, Second: Second bronchoscopy. A line was drawn between samples from the same participant. Red lines refer to participants receiving intercurrent antibiotics, while green lines refer to participants not receiving intercurrent antibiotics.

(PDF)

Click here for additional data file.

Principal coordinates analysis plot with Procrustes transformation of BAL samples using (A and C) Bray-Curtis and (B and D) Jaccard coloured by bronchoscopy number and intercurrent antibiotic use with and without lines. M^2: The summed squares of deviations, First: first bronchoscopy, Second: Second bronchoscopy. A line was drawn between samples from the same participant. Red lines refer to participants receiving intercurrent antibiotics, while green lines refer to participants not receiving intercurrent antibiotics.

(PDF)

Click here for additional data file.

13 Oct 2021

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Christine M. Freeman

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf.

2. Please provide additional details regarding participant consent. In the ethics statement in the Methods and online submission information, please ensure that you have specified whether consent was informed."

3. Thank you for stating the following in the Competing Interests/Financial Disclosure* (delete as necessary) section:

“Einar M. H. Martinsen, Elise O. Leiten, Gunnar Husebø, and Solveig Tangedal declare no conflict of interest. Walter Sanseverino and Andreu Paytuví-Gallart are employed at Sequentia Biotech SL. Tomas M. L. Eagan reports lecture fees from Boehringer and AstraZeneca, and grants from GlaxoSmithKline outside the submitted work. Harald G. Wiker reports being head of the educational programme for medicine at the University of Bergen. Kristel S. Knudsen reports lecture fees from Boehringer Ingelheim and Roche. Rune Nielsen reports grants from Boehringer Ingelheim, GlaxoSmithKline, AstraZeneca, and the Timber Merchant Delphins Endowment, in addition to lecture fees from GlaxoSmithKline and AstraZeneca. Rune Nielsen also reports being unpaid member of The Norwegian Respiratory Society, unpaid GOLD national delegate, unpaid ERS national delegate, and paid member of the Reference group for new Norwegian guidelines for COPD (The Norwegian Directorate of Health). This does not alter our adherence to PLOS ONE policies on sharing data and materials.”

We note that one or more of the authors are employed by a commercial company: GlaxoSmithKline,Boehringer and AstraZeneca,

a. Please provide an amended Funding Statement declaring this commercial affiliation, as well as a statement regarding the Role of Funders in your study. If the funding organization did not play a role in the study design, data collection and analysis, decision to publish, or preparation of the manuscript and only provided financial support in the form of authors' salaries and/or research materials, please review your statements relating to the author contributions, and ensure you have specifically and accurately indicated the role(s) that these authors had in your study. You can update author roles in the Author Contributions section of the online submission form.

Please also include the following statement within your amended Funding Statement.

“The funder provided support in the form of salaries for authors [insert relevant initials], but did not have any additional role in the study design, data collection and analysis, decision to publish, or preparation of the manuscript. The specific roles of these authors are articulated in the ‘author contributions’ section.”

If your commercial affiliation did play a role in your study, please state and explain this role within your updated Funding Statement.

b. Please also provide an updated Competing Interests Statement declaring this commercial affiliation along with any other relevant declarations relating to employment, consultancy, patents, products in development, or marketed products, etc.

Within your Competing Interests Statement, please confirm that this commercial affiliation does not alter your adherence to all PLOS ONE policies on sharing data and materials by including the following statement: "This does not alter our adherence to  PLOS ONE policies on sharing data and materials.” (as detailed online in our guide for authors http://journals.plos.org/plosone/s/competing-interests) . If this adherence statement is not accurate and  there are restrictions on sharing of data and/or materials, please state these. Please note that we cannot proceed with consideration of your article until this information has been declared.

Please include both an updated Funding Statement and Competing Interests Statement in your cover letter. We will change the online submission form on your behalf.

4. We noted in your submission details that a portion of your manuscript may have been presented or published elsewhere. Please clarify whether this [conference proceeding or publication] was peer-reviewed and formally published. If this work was previously peer-reviewed and published, in the cover letter please provide the reason that this work does not constitute dual publication and should be included in the current manuscript.

5. We note that you are reporting an analysis of a microarray, next-generation sequencing, or deep sequencing data set. PLOS requires that authors comply with field-specific standards for preparation, recording, and deposition of data in repositories appropriate to their field. Please upload these data to a stable, public repository (such as ArrayExpress, Gene Expression Omnibus (GEO), DNA Data Bank of Japan (DDBJ), NCBI GenBank, NCBI Sequence Read Archive, or EMBL Nucleotide Sequence Database (ENA)). In your revised cover letter, please provide the relevant accession numbers that may be used to access these data. For a full list of recommended repositories, see http://journals.plos.org/plosone/s/data-availability#loc-omics or http://journals.plos.org/plosone/s/data-availability#loc-sequencing.

6. Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice.

Additional Editor Comments (if provided):

Please address all comments from the Reviewers.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Yes

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: This is a very well written manuscript that reports valuable information relative to the temporal stability of the human lung mycobiome.

I have only a few suggestions for improvement:

Lines 213 and 495. Change “corresponds” to “correspond”

Legends for figures 3 and 4A. I suggest adding to the legend information regarding the significance of the statistical values that are shown on the brackets on the figures.

I suggest an expanded explanation of intercurrent antibiotic use in Materials and Methods. This section currently states that recent antibiotic use was a reason for postponing participation in the study. But the fact that some participants then had antibiotic treatment becomes a variable in the study with no real discussion of the antibiotics involved or the timeline of their use.

Line 318. Change “was” to “were”

Line 320. Perhaps change “paper” to “study”

Line 321. Perhaps change “but were” to “but it was”

There is a recent paper by Rubio-Portillo et al. that compares the lung mycobiome to the fungal community found in the home environment. The authors might want to see if this study is relevant to the work presented in the current manuscript. [Rubio-Portillo et al. Microorganisms 8, 1717 (2020)].

Reviewer #2: The goal of this study is to analyze the stability of the mycobiome in BAL and oral wash over time in both healthy participants and participants without COPD. Repeat bronchoscopies were performed between 3 and 12 months. Mycobiome data from the oral wash and broncholaveolar lavage have been published, but this study is focusing on the stability of the mycobiome and therefore has a different scientific question and purpose.

The statistical analysis is appropriate and the data support the conclusions. The manuscript is clearly written.

Comments:

1. Based on the title and the abstract which states that "no apparent effect was seen on taxonomy from intercurrent antibiotic use or participant category", I expected to see analyses pertaining to the COPD status of the participant. I see that Figure 2 is separated into participant category, but where are the statistics that support the finding that there are no differences. I did not see this in the results.

2.Page 5, Line 116 states that "the second portion of the BAL was utilised for mycobiome analysis". Is there any reason to think that this could impact the results? Would the signal from the first portion have been more robust?

3. Table 1. Please include statistics for all demographics. This information is useful in evaluating the data.

4. Page 15, line 324. This information should be included in the results section prior to Figure 3. Please explain why there are almost 50 samples in Figure 2 and then only a handful of samples in Figure 3. All figure legends should include the number of participants or samples.

5. Did you consider evaluating inhaled corticosteroid usage or current vs former smoking status to see whether these variables had any influence on the mycobiome stability?

6. Page 12, line 258 -259: Please indicated that you are discussing S6B

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: Yes. Christine M. Freeman

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.