| Literature DB >> 35527016 |
Rasha Elkenany1, Rasha Eltaysh2, Mona Elsayed3, Mohamed Abdel-Daim4,5, Radwa Shata6.
Abstract
This study was organized to investigate the prevalence, antibiotic and disinfectant resistance phenotypes and genotypes as well as plasmid profiles of Shigella species isolated from raw cow milk and milk products in Egypt. Genotypic analysis was performed to determine the presence of β-lactamase encoding genes (blaTEM, blaCTX-M, blaOXA-1 and blaSHV), tet(A) and qacE∆. Forty-two (7%) Shigella isolates (S. dysenteriae, S. flexneri, and S. sonnei) were recovered, with S. dysenteriae as the predominant type. Antibiotic sensitivity tests showed that 71.4% of Shigella isolates were resistant to three or more antibiotic classes (multidrug-resistant). High resistance rates were observed against tetracyclines (100%), ampicillin, amoxicillin-clavulanate (90.5%, each) and cefaclor (66.7%), while no resistance was detected against imipenem, sulfamethoxazole/trimethoprim, and azithromycin. Disinfectant susceptibility test of Shigella isolates revealed resistance to phenolic compound (vanillic acid), while 85.7% of the Shigella isolates were resistant to benzalkonium chloride. Uniplex PCR analysis declared the existence of β-lactamase encoding genes (blaTEM in all isolates and blaCTX-M in 28.6% of isolates) and, tet(A) in all isolates and 85.7% of the isolates were positive for qacE∆1, while all isolates were negative for blaOXA-1 and blaSHV. All Shigella extended spectrum β-lactamases (ESBL) producers (12, 100%) were positive for the blaTEM, blaCTX-M, and qacE∆1 genes. Furthermore, plasmid profiling revealed seven distinct plasmid patterns (P1-P7), ranging from 1.26 to 33.61 kb, among all the Shigella strains; S. dysenteriae exhibited the greatest variance. The co-transfer of β-lactamase genes (blaTEM and blaCTX-M) and qacE∆1 genes was observed by conjugation from all ESBL producers to a recipient strain. These findings indicate the emergence of Shigella species in Egypt that exhibited multi-resistance to either antibiotics (particularly ESBL producer strains) or disinfectants. Thus, the resistance of Shigella species should regularly be monitored and appropriate measures should be taken to manage this problem.Entities:
Keywords: Shigella species; antibiotic resistance; dairy product; qacE∆1 gene; β-lactamase encoding gene
Mesh:
Substances:
Year: 2022 PMID: 35527016 PMCID: PMC9353095 DOI: 10.1292/jvms.22-0018
Source DB: PubMed Journal: J Vet Med Sci ISSN: 0916-7250 Impact factor: 1.105
PCR conditions employed for the detection of resistance associated genes of Shigella
| Target gene | Primers sequences | Amplified segment (bp) | Primary denaturation | Amplification (35 cycles) | Final extension | Reference | ||
|---|---|---|---|---|---|---|---|---|
| Secondary denaturation | Annealing | Extension | ||||||
| ATCAGCAATAAACCAGC | 516 | 94°C | 94°C | 54°C | 72°C | 72°C | [ | |
| CCCCGAAGAACGTTTTC | ||||||||
| ATATCTCTACTGTTGCATCTCC | 619 | 94°C | 94°C | 54°C | 72°C | 72°C | ||
| AAACCCTTCAAACCATCC | ||||||||
| AGGATTGACTGCCTTTTTG | 392 | 94°C | 94°C | 54°C | 72°C | 72°C | ||
| ATTTGCTGATTTCGCTCG | ||||||||
| ATGTGCAGYACCAGT | 593 | 94°C | 94°C | 60°C | 72°C | 72°C | [ | |
| AARGTKATGGC | ||||||||
| TGGGTRAARTARGTS | ||||||||
| ACCAGAAYCAGCGG | ||||||||
| GGTTCACTCGAACGACGTCA | 576 | 94°C | 94°C | 50°C | 72°C | 72°C | [ | |
| CTGTCCGACAAGTTGCATGA | ||||||||
| TAAGCCCTACAC | 362 | 94°C | 94°C | 58°C | 72°C | 72°C | [ | |
| AAATTGGGAGATAT | ||||||||
| GCCTCCGCAGCGACT TCCACG | ||||||||
Occurrence of Shigella species in dairy products (n=42/600)
| Isolated bacteria | No of positive samples (%) | Total (n=600) | ||
|---|---|---|---|---|
| At the dairy farms | At the market | |||
| Raw cow milk | Kareish cheese | Yoghurt | ||
| 10 | 14 | 0 | 24/42 (57.1%) | |
| 4 | 8 | 0 | 12/42 (28.6%) | |
| 2 | 4 | 0 | 6/42 (14.3%) | |
| Total | 16 | 26 | 0 | 42/600 (7%) |
Antibiotic and disinfectant susceptibility profiles of Shigella species (n=42)
| Antimicrobial class | Antimicrobial | Total (n=42) (%)* | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| R | I | S | R | I | S | R | I | S | R | I | S | ||
| Tetracyclines | TE | 24 | 0 | 0 | 12 | 0 | 0 | 6 | 0 | 0 | 42 (100) | 0 | 0 |
| β-Lactams | AM | 22 | 2 | 0 | 10 | 2 | 0 | 6 | 0 | 0 | 38 (90.5) | 4 (9.5) | 0 |
| AMC | 24 | 0 | 0 | 8 | 2 | 2 | 6 | 0 | 0 | 38 (90.5) | 2 (4.8) | 2 (4.8) | |
| Cephalosporines | CEC | 16 | 4 | 4 | 8 | 2 | 2 | 4 | 2 | 0 | 28 (66.7) | 8 (19) | 6 (14.3) |
| CTX | 0 | 4 | 20 | 6 | 0 | 6 | 6 | 0 | 0 | 12 (28.6) | 4 (9.5) | 26 (61.9) | |
| CAZ | 0 | 2 | 22 | 6 | 0 | 6 | 6 | 0 | 0 | 12 (28.6) | 2 (4.8) | 28 (66.7) | |
| FEP | 0 | 4 | 20 | 0 | 0 | 12 | 0 | 0 | 6 | 0 | 4 (9.5) | 38 (90.5) | |
| Fluoroquinolones | CIP | 2 | 4 | 18 | 2 | 0 | 10 | 0 | 0 | 6 | 4 (9.5) | 4 (9.5) | 34 (80.9) |
| Phenicols | C | 2 | 2 | 20 | 2 | 0 | 10 | 0 | 0 | 6 | 4 (9.5) | 2 (4.8) | 36 (85.7) |
| Aminoglycosides | S | 2 | 0 | 22 | 0 | 2 | 10 | 0 | 0 | 6 | 2 (4.8) | 2 (4.8) | 38 (90.5) |
| Macrolides | AZM | 0 | 0 | 24 | 0 | 0 | 12 | 0 | 0 | 6 | 0 | 0 | 42 (100) |
| Sulfonamides | SXT | 0 | 0 | 24 | 0 | 0 | 12 | 0 | 0 | 6 | 0 | 0 | 42 (100) |
| Carbapenems | IPM | 0 | 0 | 24 | 0 | 0 | 12 | 0 | 0 | 6 | 0 | 0 | 42 (100) |
| QACs | BKC | 18 | - | 6 | 12 | - | 0 | 6 | - | 0 | 36 (85.7) | - | 6 (14.3) |
| Phenolic compounds | V | 24 | - | 0 | 12 | - | 0 | 6 | - | 0 | 42 (100) | - | 0 |
Resistant (R), intermediate (I), sensitive (S), number (n), tetracycline (TE), ampicillin (AM), amoxacillin-clavulanate (AMC), cefaclor (CEC), cefotaxime (CTX), ceftazidime (CAZ), cefepime (FEP), ciprofloxacin (CIP), chloramphenicol (C), streptomycin (S), azithromycin (AZM), sulfamethoxazole/trimethoprim (SXT), imipenem (IPM), quaternary ammonium compound (QAC), benzalkonium chloride (BKC), vanillin (V). *The percentages were calculated across rows.
Antimicrobial resistance phenotypes of isolated Shigella strains (n=42)
| Pattern | Resistance phenotypes | No. of isolates | No. of resistant antibiotics | Ratio (%) | MAR index* |
|---|---|---|---|---|---|
| A | TE, AM, AMC, CEC, CIP, C | 4 | 6 | 9.5 | 0.5 |
| B | TE, AM, AMC, CEC, CTX, CAZ | 6 | 6 | 14.3 | 0.5 |
| C | TE, AM, AMC, CEC, S | 2 | 5 | 4.8 | 0.4 |
| D | TE, AM, CEC, CTX, CAZ | 4 | 5 | 9.5 | 0.4 |
| E | TE, AM, AMC, CTX, CAZ | 2 | 5 | 4.8 | 0.4 |
| F | TE, AM, AMC, CEC | 12 | 4 | 28.6 | 0.3 |
| G | TE, AM, AMC | 8 | 3 | 19 | 0.2 |
| H | TE, AMC | 4 | 2 | 9.5 | 0.2 |
Tetracycline (TE), ampicillin (AM), amoxacillin-clavulanate (AMC), cefaclor (CEC), cefotaxime (CTX), ceftazidime (CAZ), cefepime (FEP), ciprofloxacin (CIP), chloramphenicol (C), streptomycin (S), azithromycin (AZM), sulfamethoxazole/trimethoprim (SXT), imipenem (IPM). *Multiple-antibiotic resistance (MAR) index values were calculated using the formula a/b, where ‘a’ represents the number of antibiotics to which a particular isolate was resistant, and ‘b’ represents the total number of antibiotics tested.