Literature DB >> 35500031

Preexisting Trichinella spiralis infection attenuates the severity of Pseudomonas aeruginosa-induced pneumonia.

Shao Rong Long1, Wen Xuan Shang1,2, Miao Jiang1, Jing Fei Li1, Ruo Dan Liu1, Zhong Quan Wang1, Hualei Sun3, Jing Cui1.   

Abstract

BACKGROUND: A range of helminth species involve the migration of developing larvae through the lung and establish chronic infections in the host that include potent immune regulatory effects. Trichinella spiralis is one of the most successful parasitic symbiotes. After released by intestinal female adult worms, newborn larvae of T. spiralis travel through the circulatory system to the lung and finally reach skeletal muscle cells. As unique inflammation modulator of intracellular parasitism, T. spiralis shows improved responses to autoimmune disease and viral pulmonary inflammation by exerting immunomodulatory effects on innate and adaptive immune cells. METHODOLOGY/PRINCIPAL
FINDINGS: C57BL/6 mice were divided into four groups: uninfected; helminth- T. spiralis infected; P. aeruginosa infected; and co-infected. Mice infected with T. spiralis were incubated for 6 weeks, followed by P. aeruginosa intranasal inoculation. Bronchial alveolar lavage fluid, blood and lung samples were analyzed. We found that T. spiralis induced Th2 response in the mouse lung tissue, increased lung CD4+ T cells, GATA3, IL-4, IL-5 and IL-13 expression. Pre-existing T. spiralis infection decreased lung neutrophil recruitment, inflammatory mediator IL-1β and IL-6 expression and chemokine CXCL1 and CXCL2 release during P. aeruginosa- pneumonia. Furthermore, T. spiralis co-infected mice exhibited significantly more eosinophils at 6 hours following P. aeruginosa infection, ameliorated pulmonary inflammation and improved survival in P. aeruginosa pneumonia.
CONCLUSIONS: These findings indicate that a prior infection with T. spiralis ameliorates experimental pulmonary inflammation and improves survival in P. aeruginosa pneumonia through a Th2-type response with eosinophils.

Entities:  

Mesh:

Substances:

Year:  2022        PMID: 35500031      PMCID: PMC9098000          DOI: 10.1371/journal.pntd.0010395

Source DB:  PubMed          Journal:  PLoS Negl Trop Dis        ISSN: 1935-2727


Introduction

Pneumonia is the leading cause of childhood mortality worldwide, accounting for more than 1.6 million deaths per year [1]. Pseudomonas aeruginosa is one of the most common gram-negative pathogens causing pneumonia in immunocompromised patients [2]. The mortality rate of ventilator associated pneumonia caused by P. aeruginosa is higher than that caused by other pathogens [2]. During acute infection, P. aeruginosa disrupts the integrity of the lipid membrane causing epithelial cell damage and lung injury [3]. More than 1 billion people worldwide are infected with helminths [4]. Complex interactions between helminths and their host result in systemic effects on immunity, with a skewing towards type 2 (Th2) responses and profound consequences on the host immune milieu [5]. Helminths are one of the most common infectious agents of humans in developing countries, with children harboring a greater parasitic worm burden than adolescent and adults [6,7]. While helminth-driven Th2 immunity can be effective at expelling parasites, numerous studies now highlight the effects this may have on human infectious, inflammatory and metabolic diseases [8-12]. Given chronic helminth infection and acute infectious pneumonia likely overlap among populations of the world and the complex influence that helminth infection can exert on host immunity, a helminth and bacterium coinfection was developed in our previous study. We found that a gut-restricted Heligmosomoides polygyrus infection in mice influenced the early innate immune response within the lung challenged with the respiratory pathogen P. aeruginosa, co-infected mice exhibited significantly more airspace neutrophil infiltration at 6 hours following P. aeruginosa infection and exhibited an improved rate of survival compared with bacterial infected alone [13]. H. polygyrus is a strictly murine enteric helminth, whose life cycle does not involve direct contact with the lung. It’s worth noting that the life cycles of a range of helminth species involve the migration of developing larvae through the lung of the infected host. Immune responses are heavily influenced by helminths passing through the lung or through releasing their immunomodulators [14]. In the case of the helminth Trichinella spiralis, the larvae of which travel through the circulatory system to the lung and finally reach skeletal muscle cells [15]. It is known as a zoonotic nematode of intracellular parasitism that infects a wide range of vertebrate hosts, including humans. Multiple studies have confirmed the anti-inflammatory effect of T. spiralis in animal models, such as allergies, autoimmune disease, rheumatoid arthritis and viral pulmonary inflammation [16,17]. Here, we investigated the role of T. spiralis infection in modulating respiratory pathogen-P. aeruginosa infection. This study sought to determine if a chronic infection by T. spiralis, the parasite with pulmonary migration in larval stage, could influence the severity of bacterial pneumonia in mice and its possible mechanism.

Material and methods

Ethics statement

All experiment procedures involving animals were carried out on the basis of the protocol authorized by the Institutional Life Science Ethics Committee, Zhengzhou University, China (Permission No. SCXK 2017–0001).

Bacterial strain

All bacterial infections were carried out with P. aeruginosa strain PA14. Bacterial cultures were grown aerobically in Luria Bertani broth over nightat 37°C, 200 RPM. Prior to infection, 1 mL of overnight culture was pelleted (10,000 rpm, 15 minutes, 4°C), washed 2 times with 1 mL of phosphate buffered saline (PBS), and re-suspended in 2 mL of PBS. The optical density for the strain was obtained at 600 nm using the Spectrumlab 722SP (LengGuang 7ech, China). The stock solution was used to make the appropriate dilutions.

Mice

Pathogen-free, 8-week-old female C57BL/6 mice were purchased from the Experimental Animal Center of Henan Province. They were fed autoclaved food and water. The animal care and experiment were performed according to the guidelines for the Care and Use of Laboratory Animals of the Ministry of Science and Technology of P. R. China (2006).

Helminth infection

The helminth parasite T. spiralis (ISS534) was collected as previously described [18]. C57BL/6 mice were randomly separated into two groups; the helminth infection group was administered 100 muscle larvae orally by gavage with a 21-gauge feeding needle (BOLIVIAN DOVE, Shanghai). T. spiralis infection was incubated for 42 days prior to infection of the mice with P. aeruginosa.

Intranasal bacterial inoculation

After 42 days of helminth infection, mice were anesthetized by intraperitoneal administration of a freshly prepared mixture of tribromoethanol solution (25mg/ml, Sigma). Tribromoethanol was dissolved in 2-methyl-2-butanol (1g/mL, Sigma) and was subsequently diluted to working concentrations in nano-pure H2O. A random subset of mice from both the naïve group and T. spiralis- infected group were infected with P. aeruginosa through intranasal inoculation (30 μl, 5×105 CFU/mouse). The groups that were not infected with bacteria were inoculated intranasally with the same volume of sterile PBS as mice receiving PA14 infection. After intranasal inoculation, the mice were placed in the cage and monitored for 6 hours or 7 days, at which time the mice were euthanized and samples were obtained and processed.

Bronchial alveolar lavage fluid harvest

Bronchial alveolar lavage fluid (BALF) samples were obtained and processed as previously described [13]. Lungs were flushed with 2 mL of PBS supplemented with 0.3% FBS and 300 μM EDTA. Cell count and viability measurements using trypan blue stain were performed. Cells were blocked with anti-CD16/CD32 (BD Biosciences) for 20 min on ice and processed for flow cytometry.

Bacterial recovery from mouse lungs

Whole lung tissue, which BALF was not acquired from, was removed surgically and placed into 2 mL tubes which contained 3 3 mm metal beads with 1 mL of PBS and stored on ice. Tubes were placed in the KZ-III-F (Servicebio, 70 Hz, homogenization time: 70 sec). Lung homogenate were plated on Pseudomonas isolation agar plates and grown at 37°C overnight. Colonies were counted, and the total CFU/mL recovered from the homogenized tissue samples was calculated.

Lung histology and immunohistochemistry assay

At necropsy, left lung tissues were collected, formalin-fixed and embedded in paraffin. The processed tissues were sectioned into 5μm thick slices. For inflammation and injury assessment, hematoxylin and eosin (H&E) staining was performed. For eosinophils detection, EPX (Eosinophil peroxidase heavy chain, Bioss) immunohistochemistry staining according to manufacturer’s instruction was performed to distinguish eosinophils in lung parenchyma. The staining on slides was visualized using Olympus Bx43F orthotopic microscope. The inflammatory score was calculated as following features: lung interstitial edema, haemorrhage, and neutrophil infiltration [19] (Table A in . To quantify the infiltrating cells or eosinophils, the acquired images from the microscope were processed using the ImageJ software. The quantification was performed by counting at least 10 random fields of view with 40x objective and calculating the average and standard deviation.

Flow cytometry preparation and analysis

The lung tissues were first cut into small pieces and incubated with 1 mg/mL collagenase D (Sigma) and 1 mg/mL DNAse I (Solarbio) at 37°C for 30 mins. Collagenase was inactivated with 1 mL sterile DMEM containing 10% FBS; the digested tissues were transferred to a 70-μM nylon cell strainer and disrupted using a syringe plunger to obtain single cell suspensions. Following lung tissue processing, the resulting single cell suspension, peripheral blood and BALF samples were processed in 1mL Red Blood Cell Lysing Bufer (Sigma). The cellular populations from different groups were identified through fluorescence conjugated antibodies. Stained samples were analyzed with BD FACSCanto. Fluorescence conjugated antibodies were listed as Table B in . The corresponding isotype control antibodies were purchased from Biolegend and used in the staining of flow cytometry analysis. Dead cells and debris were excluded from analysis via size exclusion.

RNA isolation and qRT-PCR

Total RNA was prepared from lung tissues using TRIzol reagent (Takara) and reverse transcribed into cDNA using PrimeScript RT reagent kit (TaKaRa) following the manufacturer’s recommendations. The cDNA samples were then tested for the expression of IL-1β, IL-5, IL-6, IL-17, IFN-γ, GATA3, IL-4, IL-13, ZO-1, claudin-5, VE-cadherin, CXCL1 and CXCL2 by real-time quantitative PCR using TB Green Premix Ex Taq (TaKaRa) on a 7500 Fast Real-Time PCR system (Applied Biosystems). GAPDH was used as the housekeeping control. The gene expression level was normalized by subtracting the expression level of GAPDH of the same group, and the different expression levels were calculated using the comparative Ct (2−ΔΔCt) method.

Statistical analysis

All results were expressed as the mean ± SD. For normally distributed data, one-way ANOVA test was used to compare three or more groups and Student’s t test to compare two groups. Bonferroni Correction was used to adjust multiple comparisons. A Kaplan-Meier analysis followed by a log rank (Mantel-Cox) test was used to compare the survival between the two groups. A P value of < 0.05 was considered statistically significant.

Results

T. spiralis coinfection ameliorates pulmonary inflammation and improves survival in P. aeruginosa pneumonia

A coinfection model was developed to evaluate whether T. spiralis infection can influence the response to infection with P. aeruginosa of mice. After 42 days of T. spiralis infection, a random subset of mice from both the naïve group and T. spiralis -infected group were infected with P. aeruginosa through intranasal inoculation; mice were placed in the cage for 6 hours or 7days and then sacrificed (. To assess the impact of T. spiralis infection on pulmonary inflammation, detailed lung histological examination was performed. After 6 h P. aeruginosa infection, marked differences in lung injury were observed between T. spiralis coinfection and P. aeruginosa infection alone mice. As shown in , perivascular exudates, haemorrhage, and cell infiltration were exhibited in P. aeruginosa infection mice, but were noticeably attenuated in T. spiralis coinfection mice. T. spiralis coinfection mice had less severe histological scores, based on hemorrhage, interstitial edema, and neutrophil infiltration (). To examine the inflammatory cell infiltration into the lung airspace during the process of initiation of P. aeruginosa pneumonia, BALF was collected. The total number of cells within BALF was significantly increased following 6 h P. aeruginosa infection (). Additionally, the total number of cells was decreased significantly further in BALF collected from mice co-infected with T. spiralis and P. aeruginosa, compared to that detected in mice infected with P. aeruginosa alone (). Despite the significant difference in cellular infiltration of the airspace between bacterial infected and co-infected mice, no significant diferences in bacterial burden were observed over a 6-hour bacterial infection period between P. aeruginosa infected alone and co-infected mice ().

T. spiralis coinfection ameliorates pulmonary inflammation and injury in P. aeruginosa pneumonia.

(A) Schematic of the T. spiralis- P. aeruginosa coinfection experimental process. (B) Lung histological examination 6 h post P. aeruginosa infection, arrow: perivascular exudates, triangle: haemorrhage. (C) Histological scores were from 3 mice per group, 2 lobes examined per mouse. (D) The result of BALF cell count, results of 2 independent experiments were combined. (E) P. aeruginosa CFU in the whole lung tissue without BALF acquisition, results of 2 independent experiments were combined. (F) Coinfection with T. spiralis increased mouse survival, data shown was a compilation of 3 independent experiments, with a total of 14 mice cumulatively in each of the 2 groups. (G-H) mRNA expression of zonula occludens 1 (ZO-1) (G), claudin-5 (H) and vascular endothelial cadherin (VE-cadherin) (I) was evaluated in lung samples by RT-qPCR; values are the relative expression compared to the naïve mice, data showed are from one of three experiments performed showing similar results. Naïve: uninfected; TS: T. spiralis infected; PA: P. aeruginosa infected; TS-PA: T. spiralis and P. aeruginosa co-infected. Data are shown as mean±SD; *P< 0.05; **P< 0.01; ****P<0.0001; ns: no significant difference. Increased pulmonary permeability is a hallmark of acute lung injury. Basal endothelial cell barrier control is mediated by cell junctions containing adherens junction (AJ) and tight junction (TJ) protein complexes [20]. To investigate the effects of T. spiralis coinfection on pulmonary vascular permeability, at 6 hours post bacterial infection, the levels of expression of TJs (ZO-1, claudin-5) and AJ (VE-cadherin) mRNA were evaluated by RT-qPCR in lung tissue. The primers used for RT-qPCR are listed in . Significant reduction of ZO-1 mRNA expression occurred in P. aeruginosa- infected mice only (), when compared to the naïve mice. However, during P. aeruginosa infection of the lung, the decreased expression of ZO-1 and VE-cadherin was significantly reversed by pretreatment with T. spiralis (). The claudin-5 mRNA expression in lung was not affected by T. spiralis or P. aeruginosa infection (). To further investigate the impact of T. spiralis coinfection on the course of the bacterial infection, we examined animal survival at day 7 post bacterial infection. After 6 weeks of T. spiralis infection, the mice were infected with P. aeruginosa through intranasal inoculation, mice were placed in the cage and monitored for 7 days, Results showed that T. spiralis coinfection significantly improved survival compared to P. aeruginosa infection alone (). Taken together, these findings indicate T. spiralis coinfection ameliorate P. aeruginosa pneumonia.

T. spiralis coinfection results in decreased neutrophil recruitment in the lung airspace and parenchyma

The severe neutrophilic inflammation is fatal during acute lung injury. To evaluate the role of T. spiralis infection in the modulation of initial responses to bacterial infection, we exposed the airway of T. spiralis- infected and control mice to P. aeruginosa and examined neutrophil recruitment to the lung at 6 hours post infection. The neutrophil in the BALF were identified as CD45+CD11clowLy6G+CD11b+ (), infection of the lung with P. aeruginosa resulted in statistically significant increase in the percentage () and absolute quantities () of neutrophil infiltrating the airspace in both the absence and presence of T. spiralis infection when compared to their respective controls; naïve or T. spiralis infection alone. Meanwhile, there was a statistically significant decrease in the quantity of neutrophils that infiltrated the airspace of co-infected mice when compared to P. aeruginosa infection alone (). Our analysis of lung tissues with BALF acquisition revealed that the percentage of CD45+CD11b+CD11c-Ly6G+SiglecF- neutrophils () significantly decrease in T. spiralis co-infected hosts compared to P. aeruginosa-infected alone hosts (). The neutrophil in lung parenchyma increased in the hosts infected with P. aeruginosa when compared to naïve control mice, while there was no significant difference in the percentage of lung parenchyma neutrophil between co-infected and T. spiralis infected alone mice ().

Coinfection with T. spiralis decreases neutrophil recruitment in the P. aeruginosa infected airspace and parenchyma of the lung.

(A) Gating strategy of BALF neutrophils (CD45+CD11clowLy6G+CD11b+) in flow cytometry analysis (FACS). The percentage (B) and absolute number (C) of neutrophils in the BALF were compared between control and T. spiralis infected mice in the presence and absence of P. aeruginosa infection; results of 2 independent experiments were combined. (D) Gating strategy of lung parenchyma neutrophils (CD45+CD11b+CD11c-Ly6G+SiglecF-) and eosinophils (CD45+CD11b+CD11c-Ly6G-SiglecF+) in FACS. The percentage of neutrophils (E) and eosinophils (F) in the lung parenchyma was compared among groups; results were from one of three experiments performed showing similar results. Naïve: uninfected; TS: T. spiralis infected; PA: P. aeruginosa infected; TS-PA: T. spiralis and P. aeruginosa co-infected; Neut: neutrophils; Eos: eosinophils. Data are shown as mean±SD. *P< 0.05;**P< 0.01, ***P< 0.001; ****P< 0.0001.

T. spiralis coinfection changes the expression of inflammatory mediators during P. aeruginosa pneumonia

The presence of T. spiralis infection during P. aeruginosa airway infection resulted in reduced neutrophil migration to the infected lung (). Inflammatory cytokines and chemokines play an important role in the neutrophil recruitment. Expression of CXCL1, CXCL2, IL-6, and IL-1β were evaluated by RT-qPCR in lung tissue. The primers used for RT-qPCR are listed in . During P. aeruginosa infection of the lung, while expression levels of CXCL1, CXCL2 and IL-1β were increased in the presence or absence of a concomitant helminth T. spiralis infection, T. spiralis coinfection had a less expression when compared to P. aeruginosa infection alone ). Besides, T. spiralis infection reduced the CXCL2 lung expression in the absence of P. aeruginosa infection (). IL-6 lung expression was also increased in the P. aeruginosa infection when compared to the naïve mice, however, IL-6 expression level was significantly suppressed in the presence of T. spiralis coinfection when compared to P. aeruginosa- infected alone mice (.

Prior T. spiralis infection has impact on inflammatory mediators.

(A–D) Lung tissues were collected from naïve, T. spiralis-infected, P. aeruginosa-infected, and T. spiralis -co-infected mice. Total RNA was isolated from the lung tissues. CXCL1, CXCL2, IL-6 and IL1-β expression was determined using RT-qPCR. Values are the relative expression compared to the naïve mice. The data shown are means±SD from one of three experiments performed showing similar results. Naïve: uninfected; TS: T. spiralis infected; PA: P. aeruginosa infected; TS-PA: T. spiralis and P. aeruginosa co-infected. *P< 0.05; **P< 0.01.

T. spiralis coinfection results in increasing eosinophil recruitment into the lung during P. aeruginosa pneumonia

Increase in eosinophils is a classical feature of helminth infections, to assess the possible function of eosinophils in the process of P. aeruginosa pneumonia; we examined eosinophils in the mice with/without infection. Eosinophils in the BALF were identified as CD45+CD11clowSiglecF+CD11b+ (Figs ). Infection of the lung with P. aeruginosa increased the percentage () and absolute quantities () of eosinophils in the airspace in both the absence and presence of T. spiralis infection when compared to their respective controls; naïve or T. spiralis infection alone. And there was a statistically significant increased eosinophils in the airspace of T. spiralis co-infected mice when compared to P. aeruginosa infection alone mice (). A similar trend was observed regarding the percent of CD45+CD11b+CD11c-Ly6G-SiglecF+ eosinophils derived from lung parenchyma (, T. spiralis infection increased the frequency of eosinophils within the lung parenchyma in both the absence and presence of P. aeruginosa infection when compared to their respective controls, naïve or P. aeruginosa infection alone (). Similarly, immunohistochemistry staining ( suggested that the number of eosinophils in the lung parenchyma was significantly increased in the T. spiralis infection mice when compared to their respective controls, naïve or P. aeruginosa infection alone mice ( In addition, T. spiralis infection increased the frequency of eosinophil within the peripheral blood in both the absence and presence of P. aeruginosa infection when compared to their respective controls (.

Coinfection with T. spiralis increases the lung eosinophils during P. aeruginosa pneumonia.

(A) Gating strategy of BALF eosinophils (CD45+CD11clowSiglecF+CD11b+) in flow cytometry analysis. The percentage (B) and absolute number (C) of eosinophil in the BALF were compared between control and T. spiralis infected mice in the presence and absence of P. aeruginosa infection. Rresults of 2 independent experiments were combined. (D) Representative images and (E) semi-quantification of EPX immunohistochemistry staining (circle) in mouse lung tissue. In semi-quantification, each point was the average score of 10 random fields of each mouse. Data are shown as mean±SD. Naïve: uninfected; TS: T. spiralis infected; PA: P. aeruginosa infected; TS-PA: T. spiralis and P. aeruginosa co-infected; Eos: eosinophils. *P< 0.05;**P< 0.01; ***P< 0.001.

T. spiralis infection induces Th2-type polarization in the lung

CD4+T cells were identified as CD45+CD11b-CD11c-CD4+CD19- (Figs ). The data showed that T. spiralis infection elicited higher quantities of CD4+ T-cells in the lung tissues when compared to naïve mice irrespective of bacterial infection ( To determine the type of the CD4+T cells, at 6 hours post bacterial infection, gene expression levels of Th1 cytokine IFN-γ, Th2 cytokines IL-4, IL-5, IL-13 and Th17 cytokine IL-17 in the lung was examined. The primers used for RT-qPCR are listed in . During P. aeruginosa infection of the lung, expression levels of IL-4 and IL-13 were decreased in the absence of a concomitant helminth T. spiralis infection ( T. spiralis infection were associated with a significant upregulation of IL-4, IL-5 and IL-13 expression in lung tissues in both the absence and presence of P. aeruginosa infection when compared to their respective controls, naïve or P. aeruginosa infection alone (). In addition, T. spiralis infection reduced the lung IL-17 expression when compared to the naïve mice (). The lung IFN-γ expression did not appear alter in any context (). Besides, T. spiralis infection were also associated with a significant upregulation of GATA3 transcription factor expression in lung tissues in both the absence and presence of P. aeruginosa infection when compared to their respective controls, naïve or P. aeruginosa infection alone (); P. aeruginosa infection down-regulated the expression level of GATA3 in the presence or absence of a concomitant T. spiralis infection. These results demonstrate that T. spiralis infection promotes the development of Th2 immune response in lung.

T. spiralis infection increases Th2 cells population in the lung tissues.

(A) FACS analysis to isolate the CD4+ T-cell population in the lung tissue. Gating strategy of lung tissue CD4+-T cells (CD45+CD11b-CD11c-CD4+CD19-) in flow cytometry analysis. (B) The percentage of CD4+ T cells in the lung tissue was compared between control and T. spiralis infected mice in the presence and absence of P. aeruginosa infection. (C-H) Lung tissues were collected from naïve, T. spiralis-infected, P. aeruginosa-infected, and T. spiralis -co-infected mice. Total RNA was isolated from lung tissues. IL-4 (C), IL-5 (D), IL-13 (E), IL-17 (F), IFN-γ (G) and GATA3 (H) expression were determined using RT-qPCR. Values are the relative expression compared to the naïve mice. Naïve: uninfected; TS: T. spiralis infected; PA: P. aeruginosa infected; TS-PA: T. spiralis and P. aeruginosa co-infected; Eos: eosinophils. The data shown are means±SD from one of three experiments performed showing similar results. *P<0.05; **P<0.01; ****P<0.0001; ns: no significant difference.

Discussion

Helminth infections are known to be powerful modulators of the human immune response, and numerous studies now highlight that it may have effects on human infectious, inflammatory, and metabolic diseases [21]. The helminth Trichinella spiralis is the causative agent of trichinosis. Humans contract T. spiralis by consuming uncooked meat that carries encysted T. spiralis larvae in muscle tissue; then larvae are released by gastric fluids, molt and mature into adult worm. The female adult worms release newborn larvae after copulation, which travel through the circulatory system to reach skeletal muscle cells [16]. T. spiralis is one of the most successful parasitic symbiotes, ensuring its survival and immune dialogue with the host. Multiple studies have confirmed the anti-inflammatory effect of T. spiralis in animal models. Mice with a persistent T. spiralis-mediated type 2 immunity redirects the mucosal immune system from a Th1 to a protective Th2 response with a reduction in the severity of IBD [22]. Chronic infection with T. spiralis can mediate protection against allergic asthma by eliciting a regulatory T cell population and increasing IL-10 levels [23]. Evidence also indicates that T. spiralis infection has attenuated influenza or respiratory syncytial virus -associated pathologies in mice [17,24]. Yet, not a single study has reported the effect of T. spiralis infection in regulating bacterial infection- induced pneumonia. Here, we addressed this question by co-infecting mice with T. spiralis and respiratory pathogen–P. aeruginosa. Findings demonstrated that a prior infection with T. spiralis could ameliorate experimental pulmonary inflammation and improved survival in P. aeruginosa pneumonia through a Th2-type response with eosinophils. An in vivo coinfection model system involving infection with T. spiralis, followed by airway administration of a lung bacterial pathogen (P. aeruginosa), was developedand characterized to analyze the effects of helminth parasites with pulmonary migration infection on the bacterial infection of the airway. Consistent with our previous report [13], mice infection with helminth had an enhanced Th2 response in the lung tissue; the GATA3 transcription factor, type2 cytokines-IL-4, IL-5, IL-13 and CD4+ T cells increased in the mice infection with T. spiralis. In the previous study, we observed that concurrent intestinal helminth- H. polygyrus infections increased the airspace neutrophil recruitment at the early stages of bacterial lung infection [13]. However, FACS analysis results of present study showed that T. spiralis coinfection resulted in depressed neutrophil transepithelial migration into the airspace and lung tissue. Chen and colleagues had demonstrated that Nippostrongylus brasiliensis, a helminth with an obligatory lung migratory phase, suppressed the neutrophil infiltration into the lungs upon infection through Th2 cytokine receptor signaling [25]. The diverse outcomes of neutrophil infiltration into the lung during P. aeruginosa infection may be due to differences in the life cycle of the two parasites: H. polygyrus is a strictly gut-restricted helminth, while T. spiralis with a lung migratory phase. Neutrophils released from the bone marrow are regulated by the signaling of CXC chemokine receptors (CXCR) 2 and 4 [26]. CXCR2 can bind to human CXCL8 and mouse CXCL1 and CXCL2, which can promote the mobilization of neutrophils and their entry into the bloodstream. [27,28]. In the present study, the observation of depressed neutrophil transepithelial migration was further supported by the decreased level of chemokines-CXCL1 and CXCL2 in the lung tissue of T. spiralis co-infected mice. And also T. spiralis coinfection reduced the inflammation cytokines of IL-1β and IL-6 in the mouse lung tissue. Eosinophils are circulating and tissue-resident leukocytes that have potent proinflammatory effects in a number of diseases, such as asthma, eosinophilic granulomatosis with polyangiitis and eosinophilic chronic rhinosinusitis [29]. In addition to their proinflammatory effects, growing evidence has demonstrated eosinophils have regulatory effects on various immune responses [30]. Researchers find eosinophils exert a protective effect in experimental colitis via production of anti-inflammatory lipid mediators or modulation of harmful type 1 responses [31,32], protecting the host against virus via production of oxidant agents, extracellular traps, and release of antiviral type I cytokines [33]. Eosinophils are also known as the terminal effector cells during helminth infection [30]; the most potent activator of which is the type 2 cell-produced cytokine- IL-5 [29]. In our study, helminth T. spiralis infection upregulated IL-5 expression in lung tissues. Our data also revealed that eosinophil in the lung parenchyma and peripheral blood increased in T. spiralis infected mice; moreover, T. spiralis coinfection increased eosinophils transepithelial migration into the lung airspace during P. aeruginosa infection. Clinical investigations showed that the acute lung injury survivors exhibited an increased number of eosinophils in the lung [34] and peripheral blood [35] compared to the non-survivors. Consistent with these reports, our results showed that T. spiralis coinfection improved lung endothelial cell permeability and survival during P. aeruginosa pneumonia, and eosinophils in T. spiralis co-infected mice was increased; suggesting a protective role of eosinophils in acute lung bacterial infection. Whether eosinophil is responsible for ameliorating pulmonary inflammation of co-infected mice is an important question that remains to be determined. Parasites are in some ways harmful to the host; treatment with live worms is not a very attractive notion, the excretion–secretion products released by Trichinella or parasite-derived proteins may be used as alternatives in the future study. In conclusion, our data indicate that a prior infection with T. spiralis limits the development of P. aeruginosa pneumonia by decreasing neutrophil recruitment and inducing a Th2-type response with eosinophils. These findings suggest a pre-existing chronic helminth with a lung migration phase infection promotes the survival of bacterial airway co-infected host.

Table A in S1 Text.

Assessment of histopathological scores. Table B in S1 Text. Fluorescent antibodies used in the Flow cytometry. (DOC) Click here for additional data file. (A) Gating strategy of peripheral blood eosinophils (CD45+SiglecF+CD11b+) in flow cytometry analysis. (B) The percentage of eosinophils in the peripheral blood was compared among groups. Naïve: uninfected; TS: T. spiralis infected; PA: P. aeruginosa infected; TS-PA: T. spiralis and P. aeruginosa coinfected; Eos: eosinophils. The data shown are means±SD from one of three experiments performed showing similar results. *P<0.05; **P<0.01; ***P<0.001. (TIF) Click here for additional data file.
Table 1

Primers used for qPCR analysis.

GenesPrimerSequence (5′→3′)
IL-1βForwardAGCTCTCCACCTCAATGGAC
ReverseAGGCCACAGGTATTTTGTCG
IL-5ForwardTGACAAGCAATGAGACGATGAGG
ReverseACCCCCACGGACAGTTTGATTC
IL-6ForwardTAGTCCTTCCTACCCCAATTTCC
ReverseTTGGTCCTTAGCCACTCCTTC
IL-17ForwardCCACGTCACCCTGGACTCTC
ReverseCTCCGCATTGACACAGCG
IFN-γForwardGGAACTGGCAAAAGGATGGTGAC
ReverseGCTGGACCTGTGGGTTGTTGAC
CXCL1ForwardGACTCCAGCCACACTCCAAC
ReverseTGACAGCGCAGCTCATTG
CXCL2ForwardGAAGTCATAGCCACTCTCAAGG
ReverseCCTCCTTTCCAGGTCAGTTAGC
ZO-1ForwardTGAACGCTCTCATAAGCTTCGTAA
ReverseACCGTACCAACCATCATTCATTG
claudin-5ForwardTCTGCTGGTTCGCCAACAT
ReverseCGGCACCGTCGGATCA
VE-cadherinForwardGCGCAGCATCGGGTACTC
ReverseGCTTGGTTATTCGGAAGAATTGG
IL-4ForwardGGTCTCAACCCCCAGCTAGT
ReverseGCCGATGATCTCTCTCAAGTGAT
IL-13ForwardCCTGGCTCTTGCTTGCCT
ReverseGGTCTTGTGTGATGTTGCTCA
GATA3ForwardCTCGGCCATTCGTACATGGAA
ReverseGGATACCTCTGCACCGTAGC
GAPDHForwardGGTTGTCTCCTGCGACTTCA
ReverseTGGTCCAGGGTTTCTTACTCC
  35 in total

1.  Homeostatic and early-recruited CD101- eosinophils suppress endotoxin-induced acute lung injury.

Authors:  Chen Zhu; Qing-Yu Weng; Ling-Ren Zhou; Chao Cao; Fei Li; Yin-Fang Wu; Yan-Ping Wu; Miao Li; Yue Hu; Jia-Xin Shen; Xue-Fang Xiong; Fen Lan; Li-Xia Xia; Bin Zhang; Hao Zhang; Man Huang; Song-Min Ying; Hua-Hao Shen; Zhi-Hua Chen; Wen Li
Journal:  Eur Respir J       Date:  2020-11-05       Impact factor: 16.671

Review 2.  Tight junctions/adherens junctions: basic structure and function.

Authors:  Carien M Niessen
Journal:  J Invest Dermatol       Date:  2007-11       Impact factor: 8.551

Review 3.  Helminth Modulation of Lung Inflammation.

Authors:  Christian Schwartz; Emily Hams; Padraic G Fallon
Journal:  Trends Parasitol       Date:  2018-01-12

4.  Trichinella spiralis muscle larvae excretory-secretory products induce changes in cytoskeletal and myogenic transcription factors in primary myoblast cultures.

Authors:  Lizbeth Hernández-Ancheyta; María Del Rosario Salinas-Tobón; Juan Carlos Cifuentes-Goches; Javier Hernández-Sánchez
Journal:  Int J Parasitol       Date:  2017-12-16       Impact factor: 3.981

5.  Immunoprotective inference of experimental chronic Trichinella spiralis infection on house dust mites induced allergic airway remodeling.

Authors:  Dalia A Elmehy; Dina I Abdelhai; Rasha A Elkholy; Maram M Elkelany; Dina M Tahoon; Reem A Elkholy; Nema A Soliman; Marwa A Hasby Saad; Ahmad A El-Ebiary; Ghada A Gamea
Journal:  Acta Trop       Date:  2021-04-23       Impact factor: 3.112

Review 6.  Nutritional impact of intestinal helminthiasis during the human life cycle.

Authors:  D W T Crompton; M C Nesheim
Journal:  Annu Rev Nutr       Date:  2002-01-04       Impact factor: 11.848

Review 7.  Eosinophil Response Against Classical and Emerging Respiratory Viruses: COVID-19.

Authors:  J M Rodrigo-Muñoz; B Sastre; J A Cañas; M Gil-Martínez; N Redondo; V Del Pozo
Journal:  J Investig Allergol Clin Immunol       Date:  2020-06-16       Impact factor: 4.333

Review 8.  Helminths in the gastrointestinal tract as modulators of immunity and pathology.

Authors:  Fumi Varyani; John O Fleming; Rick M Maizels
Journal:  Am J Physiol Gastrointest Liver Physiol       Date:  2017-03-16       Impact factor: 4.052

9.  Enteric helminth-induced type I interferon signaling protects against pulmonary virus infection through interaction with the microbiota.

Authors:  Amanda J McFarlane; Henry J McSorley; Donald J Davidson; Paul M Fitch; Claire Errington; Karen J Mackenzie; Eva S Gollwitzer; Chris J C Johnston; Andrew S MacDonald; Michael R Edwards; Nicola L Harris; Benjamin J Marsland; Rick M Maizels; Jürgen Schwarze
Journal:  J Allergy Clin Immunol       Date:  2017-02-11       Impact factor: 10.793

10.  Helminth infection protects against high fat diet-induced obesity via induction of alternatively activated macrophages.

Authors:  Chien Wen Su; Chih-Yu Chen; Yali Li; Shao Rong Long; William Massey; Deepak Vijaya Kumar; W Allan Walker; Hai Ning Shi
Journal:  Sci Rep       Date:  2018-03-15       Impact factor: 4.379

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.