Literature DB >> 35472144

Multiple sclerosis patients have an altered gut mycobiome and increased fungal to bacterial richness.

Meeta Yadav1,2, Soham Ali3, Rachel L Shrode4, Shailesh K Shahi1, Samantha N Jensen1,5, Jemmie Hoang6, Samuel Cassidy7, Heena Olalde7, Natalya Guseva1, Mishelle Paullus7, Catherine Cherwin6, Kai Wang8, Tracey Cho7, John Kamholz7, Ashutosh K Mangalam1,4,5,9.   

Abstract

Trillions of microbes such as bacteria, fungi, and viruses exist in the healthy human gut microbiome. Although gut bacterial dysbiosis has been extensively studied in multiple sclerosis (MS), the significance of the fungal microbiome (mycobiome) is an understudied and neglected part of the intestinal microbiome in MS. The aim of this study was to characterize the gut mycobiome of patients with relapsing-remitting multiple sclerosis (RRMS), compare it to healthy controls, and examine its association with changes in the bacterial microbiome. We characterized and compared the mycobiome of 20 RRMS patients and 33 healthy controls (HC) using Internal Transcribed Spacer 2 (ITS2) and compared mycobiome interactions with the bacterial microbiome using 16S rRNA sequencing. Our results demonstrate an altered mycobiome in RRMS patients compared with HC. RRMS patients showed an increased abundance of Basidiomycota and decreased Ascomycota at the phylum level with an increased abundance of Candida and Epicoccum genera along with a decreased abundance of Saccharomyces compared to HC. We also observed an increased ITS2/16S ratio, altered fungal and bacterial associations, and altered fungal functional profiles in MS patients compared to HC. This study demonstrates that RRMS patients had a distinct mycobiome with associated changes in the bacterial microbiome compared to HC. There is an increased fungal to bacterial ratio as well as more diverse fungal-bacterial interactions in RRMS patients compared to HC. Our study is the first step towards future studies in delineating the mechanisms through which the fungal microbiome can influence MS disease.

Entities:  

Mesh:

Substances:

Year:  2022        PMID: 35472144      PMCID: PMC9041819          DOI: 10.1371/journal.pone.0264556

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.752


Introduction

Multiple Sclerosis (MS) is a neuroinflammatory autoimmune disease that affects ~2.5 million people worldwide. Though MS has different clinical subtypes, most of the patients (~85%) present with relapsing-remitting MS (RRMS). The precise etiopathogenesis of MS is unclear, but both genetic and environmental factors have been suggested to play an important role in susceptibility and the pathogenesis of MS. In recent years multiple groups, including ours, have highlighted the role of gut bacteria in the pathobiology of MS [1-8], and it has emerged as an important environmental factor. However, the gut microbiome consists of non-bacterial microbes such as fungi, viruses, and archaea [9,10], yet the role of the fungal microbiome (mycobiome) is not well studied in MS. Although fungi make up approximately 0.1% of the gastrointestinal tract [10,11], their impact on human health is significant due to their ability to regulate local and systemic host immune responses [12,13]. The importance of the fungal microbiome on the immune system was demonstrated in a study where mice that were rewilded had increased intestinal abundance of fungi along with an expansion of granulocytes compared to laboratory mouse controls [13]. While in human peripheral blood 50–70% cells are neutrophils, only 10–25% cells are neutrophils in mouse peripheral blood [14]. Additionally, an oral antifungal treatment of mice in a colitis model showed increased disease severity and exacerbated allergic airway disease with increased Aspergillus, Wallemia, and Epiccocum and decreased Candia spp [12]. Moreover, oral administration of a mixture of these three fungi (Aspergillus amstelodami, Epicoccum nigrum, and Wallemia sebi) was sufficient to recapitulate the exacerbating effects of antifungal drugs on allergic airway disease [12]. The importance of the mycobiome in human health and disease is validated by studies showing alterations in mycobiome composition in various autoimmune diseases such as inflammatory bowel disorders (IBD), ankylosing spondylitis (AS), and type 2 diabetes mellitus (DM) and in pwMS (people with MS) compared to healthy controls (HC) [15-18]. These studies have also shown correlations between bacterial and fungal microbiota that are altered in disease states. The relationship between gut bacteria and fungi has been demonstrated in the murine model where bacteria outnumbered fungi by greater than three times prior to antibiotic administration, but after antibiotic administration bacterial abundance dropped three-fold while fungal abundance increased around 40-fold [19]. Thus, all these observations suggest that the gut mycobiome might play an important role in the health and disease including MS. Based on the association of gut mycobiota in other autoimmune diseases and also in pwMS, which was recently showed by Shah et al [18], we hypothesized that the gut fungal microbiota might be altered in MS patients. Therefore, in this study we profiled the fungal microbiota and associated fungal functional characteristics in RRMS patients (MS) (n = 20) and compared them with those of HC (n = 33). We also analyzed the bacterial microbiome of the same patients to determine the correlation between the fungal and bacterial microbiome. We observed that the MS patients have a distinct fungal microbiome compared to HC, with differential abundances of multiple fungal genera and fungal functions as well as altered fungal-bacterial relationships. A distinct fungal microbiome in RRMS patients could have implications in the pathogenesis of MS, potentially through functional differences and altered interactions with the bacterial microbiome.

Methods

Standard protocol approvals, registrations, and patient consents

The study was done in accordance with the guidelines approved by the University of Iowa Institutional Review Board (IRB) (#201512717). A prior written informed consent was obtained from all the subjects to participate in the study.

Human subjects enrollment

Relapsing-Remitting Multiple Sclerosis (RRMS) patients (n = 22) who fulfill the McDonald diagnostic criteria for MS were recruited from the Neuroimmunology Clinic at the University of Iowa Hospital Clinics (UIHC) at the University of Iowa. Healthy controls (HC) (n = 34) were also recruited through the University of Iowa (Table 1). Individuals eligible for the study were those 18–63 years of age with a diagnosis of RRMS. All patients were either on MS treatment or not on treatment for at least three months prior to enrollment. Patients and healthy controls were asked to provide samples at least four weeks after their last dose of oral antibiotics or laxatives, and at least three months after their last colonoscopy. Those with active pregnancy or a history of bariatric surgery were excluded from the study.
Table 1

Biometric and MS patient treatment data.

HCMSp-value
Age: Mean ± SD 42 ± 1443 ± 7.7t-test: 0.61
Sex: Male/Female 5 / 285 / 15Fisher: 0.48
BMI: Mean ± SD 24 ± 3.730 ± 7.9t-test: 0.015
Treatment: Yes / No NA16 / 4NA
Treatment
Interferon beta3
Glatiramer acetate4
Ocrelizumab3
Dimethyl fumarate6
Not on treatment4

Human sample collection

Stool samples were collected by patients and HC in Commode Specimen Collection kits (Fisher PA, USA) provided to them by our laboratory along with the instruction sheet and shipped on frozen gel packs to our laboratory by overnight delivery. Once in the laboratory, the stool was aliquoted and stored at -80 degrees until DNA extraction. The same collection kits, instruction sheets, and processing methods were used for fecal samples from MS patients and HC.

DNA extraction and sequencing

Microbial DNA was extracted from each fecal sample using Qiagen DNeasy PowerLyser PowerSoil Kit (Qiagen, Germantown, MD) per the manufacturer’s instructions using a bead-beating step (PowerLyzer 24 Homogenizer, Omni International, USA). The fungal microbiome was analyzed using Two-step PCR as described previously for bacterial microbiome analysis [20] except instead of 16S rRNA, we targeted the internal transcribed spacer 2 (ITS2) region of fungal 18S rRNA using the following primers: forward primer 86 F(5′-3′) GTGAATCATCGAATCTTTGAA and reverse primer 4R (5′-3′) TCCTCCGCTTATTGATATGC [21]. We choose ITS-2 primer over others (ITS-1, 18s- etc.) as a previous study comparing different fungal primers showed that ITS-2 specific primer allowed detection of maximum number of fungal OTUs [21]. Fungal PCR conditions were as follows: 95°C for 5 min, 35 cycles of 95°C for 30s, 59°C for 30s, 72°C for 30s, and 72°C for 10 min. Bacterial 16S rRNA sequencing was performed as per protocol published by our lab [20].

Metagenomic profiling

The raw fungal ITS2 (internal transcribed spacer 2) sequence data was processed utilizing DADA2 [22]. In brief, the reads were trimmed to remove the primer sequences, then truncated based on a quality score of 25. Reads were then denoised to infer the exact sequence variants by resolving single-nucleotide errors. Paired forward and reverse reads were merged, and any resulting chimeras were removed to produce amplicon sequence variants (ASVs). These ASVs were then assigned fungal taxonomy at the genus level using a naive Bayesian classifier method and the UNITE database (Version 8.2) [23]. After the removal of three samples (2 MS and one HC) with less than 1000 reads, 20 MS samples and 33 HC samples were available for fungal profiling, with a median number of reads of 37,331. The raw sequence data of the V3-V4 region of bacterial 16S rRNA was processed utilizing DADA2. These sequences were processed as described above for ITS sequences, and the final ASVs were assigned bacterial taxonomy at the kingdom to species levels using the Silva database (version 138.1) [24] with a median number of reads of 49,976.

Functional profiling

The functional profile of the gut mycobiome was generated using FungalTraits database [25]. Of the 142 identified fungal genera in this study, 86 had functional entries in this database, and the functional profile of each sample was then inferred using its fungal composition and the functional data of each of these 86 fungal genera.

Statistical analysis

Analysis and figure generation of alpha diversity, beta diversity, and differential abundance of all features was performed entirely in R (Version 4.0.3) using the vegan [26] and ggpubr [27] packages with custom R scripts. Prior to statistical analysis, the fungal and bacterial datasets were each constant-sum scaled to one million reads and generalized log-transformed. The fungal and bacterial data were then filtered to remove low prevalence taxa. Alpha diversity and differential abundance analysis between the MS and HC groups were performed using the Wilcoxon test, and p-values were adjusted using the Benjamini-Hochberg algorithm. PERMANOVA was performed to analyze the statistical significance of beta-diversity clustering using the adonis2 function from the vegan package. Inter-kingdom correlation analysis was conducted between the bacteria and fungi at the genus level using Spearman’s rank correlation, and only correlations showing p-value less than 0.05 are reported. Bootstrapped random forest analysis was conducted using the Boruta package [28] at the suggested significance level of 0.01 with 500 trees for 100 iterations.

Results

Fungal microbiota of RRMS patients is different from healthy controls

To characterize the fungal microbiome diversity, we sequenced fecal samples of 20 RRMS patients and 33 healthy controls (HC) using ITS2 rRNA sequencing. A total of 136 fungal genera were identified, with 31 unique to the HC group, 73 unique to the MS group, and 32 present in both groups. Alpha diversity using the Chao1 index showed greater richness in MS than in HC (Fig 1A), though this was not statistically significant (p > 0.08). Principal coordinate analysis of beta diversity using Bray-Curtis dissimilarity (Fig 1B) demonstrated distinct clustering of the mycobiome of MS compared with HC (p = 0.011), while gender (p = 0.32) and Body Mass Index (BMI) status (p = 0.73) did not show a significant effect on mycobiome composition. Interestingly, beta-diversity analysis of the MS group did not demonstrate a significant effect of treatment with dimethyl fumarate (p = 0.872) on the mycobiome composition (S1A Fig). Including other disease modifying treatments (DMTs) with at least 3 samples, no significant effect was shown for treatment (p = 0.163; S1B Fig), gender (p = 0.197), or BMI status (p = 0.414).
Fig 1

Fungal microbiota of RRMS patients is different from healthy controls.

(A) Fungal ASV richness estimated by Chao1 index in MS and HC. (B) Principal coordinate analysis of Bray-Curtis dissimilarity of HC and MS shows that the mycobiome of HC and MS are distinct (PERMANOVA: p = 0.011). Ellipses correspond to a 95% confidence intervals around the centroids for each group. (C) Bar plot showing the relative abundances of fungal phyla. Basidiomycota was increased and Ascomycota was decreased in MS compared to HC. (D) Bar plot showing the top 10 fungal genera in HC and MS (determined by average relative abundance across all samples). The top 10 genera account for 85.5% of all identified fungal genera. (E) Basidiomycota/Ascomycota ratio is significantly increased in MS (p = 0.0053).

Fungal microbiota of RRMS patients is different from healthy controls.

(A) Fungal ASV richness estimated by Chao1 index in MS and HC. (B) Principal coordinate analysis of Bray-Curtis dissimilarity of HC and MS shows that the mycobiome of HC and MS are distinct (PERMANOVA: p = 0.011). Ellipses correspond to a 95% confidence intervals around the centroids for each group. (C) Bar plot showing the relative abundances of fungal phyla. Basidiomycota was increased and Ascomycota was decreased in MS compared to HC. (D) Bar plot showing the top 10 fungal genera in HC and MS (determined by average relative abundance across all samples). The top 10 genera account for 85.5% of all identified fungal genera. (E) Basidiomycota/Ascomycota ratio is significantly increased in MS (p = 0.0053). Overall, the two most prominent phyla by relative abundance were Ascomycota and Basidiomycota (Fig 1C), and the top five fungal genera were Saccharomyces, Candida, Malassezia, Penicillium, and Cladosporium (Fig 1D), comprising 75.5% of all the identified fungal genera in the samples. Examining the differential abundance between the MS and HC groups at the phylum level showed a lower abundance of Ascomycota (padj = 0.011) and higher abundance of Basidiomycota (padj = 0.011) in the MS group compared to HC (padj = 0.011 and 0.011, respectively). Previous studies in IBD and AS have shown that there is a strong negative correlation between Basidiomycota and Ascomycota characterized by a higher Basidiomycota/Ascomycota ratio in IBD [17] and AS [16]. In this study, we also observed that MS patients have an increased Basidiomycota/Ascomycota ratio (p = 0.0053) compared to HC (Fig 1E). Thus, our data demonstrates a phylum-level shift in MS towards Basidiomycota and away from Ascomycota. Interestingly, within the Ascomycota phylum, the genera Candida (padj = 0.021) and Epicoccum (padj = 0.021) were more abundant in the MS group (Fig 2A & 2B), while only Saccharomyces (padj = 0.021) was depleted in the MS group (Fig 2B) compared with HC. Species-level analysis showed Saccharomyces cerevisiae comprising 88% of the Saccharomyces genus and Candida albicans comprising 81% of the Candida genus across all samples. Thus, our study finds that MS patients have a distinct mycobiome compared to HC with enrichment or depletion of certain fungi.
Fig 2

Differentially abundant fungal genera in RRMS versus healthy controls.

(A) Bar plot showing relative abundances of differentially abundant taxa (p < 0.05) at the phylum, family, and genus level. (B) Differentially abundant fungal genera in MS and HC using Wilcoxon signed rank test and adjusted for multiple comparisons with the Benjamini-Hochberg method at a significance level of 0.05. Candida, Epicoccum, and Malassezia are increased in MS compared to HC. Saccharomyces is decreased in MS compared to HC. Penicillium was identified in random forest analysis as a significant feature and was decreased in MS, though the Wilcoxon test did not reach statistical significance after adjusting for multiple comparisons. Abundance values are sum-scaled to 1 million and generalized log-transformed. The * symbol indicates p-value <0.05. (C) Importance of features determined by random forest and tested for significance with the Boruta algorithm at a significance level of 0.01.

Differentially abundant fungal genera in RRMS versus healthy controls.

(A) Bar plot showing relative abundances of differentially abundant taxa (p < 0.05) at the phylum, family, and genus level. (B) Differentially abundant fungal genera in MS and HC using Wilcoxon signed rank test and adjusted for multiple comparisons with the Benjamini-Hochberg method at a significance level of 0.05. Candida, Epicoccum, and Malassezia are increased in MS compared to HC. Saccharomyces is decreased in MS compared to HC. Penicillium was identified in random forest analysis as a significant feature and was decreased in MS, though the Wilcoxon test did not reach statistical significance after adjusting for multiple comparisons. Abundance values are sum-scaled to 1 million and generalized log-transformed. The * symbol indicates p-value <0.05. (C) Importance of features determined by random forest and tested for significance with the Boruta algorithm at a significance level of 0.01. Random forest analysis to identify the potential discriminating fungi. We next assessed the ability of the gut mycobiota profile to predict disease phenotype in our samples. A bootstrapped random forest algorithm of 500 trees was used to generate a predictive model based on the gut mycobiota profiles of the samples. The Boruta algorithm was then utilized to identify the fungal genera that were most important in distinguishing between MS and HC samples at a significance level of 0.01. Interestingly, the four aforementioned genera, Candida, Saccharomyces, Epicoccum, and Malassezia, were again identified (Fig 2C). The Boruta algorithm additionally identified Penicillium which is decreased in MS, and Malassezia, which is increased in MS (Fig 2C), as a significantly important feature in distinguishing MS from HC. Thus, the random forest classification analysis suggests that these fungal taxa could be important discriminators between MS and HC.

Functional profile of gut mycobiome in MS patients

Analysis of the mycobiome functional profile determined from the FungalTraits database revealed several enzymes whose enrichment differed significantly between MS and HC samples. Levels of amino acid permease (padj = 0.029), cellobiohydrolase (padj = 0.011), endoglucanase (padj = 0.029), and invertase (padj = 0.0211) were lower in MS patients compared to HC (Fig 3), while amylase (padj = 0.011) was increased in these patients (Fig 3). These results suggest potential differences in fungal metabolism and functional phenotypes in the gut of MS patients.
Fig 3

Functional profile of gut mycobiome in MS patients.

Differentially enriched fungal functions using Wilcoxon signed rank test and adjusted for multiple comparisons with the Benjamini-Hochberg method at a significance level of 0.05. Amino acid permease, cellobiohydrolase, endoglucanase, and invertase are decreased in MS compared to HC. Amylase is increased in MS compared to HC. Abundance values are sum-scaled to 1 million and generalized log-transformed.

Functional profile of gut mycobiome in MS patients.

Differentially enriched fungal functions using Wilcoxon signed rank test and adjusted for multiple comparisons with the Benjamini-Hochberg method at a significance level of 0.05. Amino acid permease, cellobiohydrolase, endoglucanase, and invertase are decreased in MS compared to HC. Amylase is increased in MS compared to HC. Abundance values are sum-scaled to 1 million and generalized log-transformed. Gut bacterial microbiome of RRMS patients is different from healthy controls. We also characterized the bacterial microbiome of the same samples using 16S rRNA (V3-V4) sequencing. A total of 285 bacterial genera were identified, with 196 genera in the HC group and 185 genera in the MS group. Alpha diversity by Chao1 index demonstrated decreased bacterial richness in the MS group compared with the HC group (p = 0.020; Fig 4A), aligning with our previous study showing less bacterial diversity in the gut of MS patients [2]. Additionally, the MS and HC groups clustered separately on principal coordinate analysis of beta diversity using Bray-Curtis dissimilarity (p = 0.004; Fig 4B), indicating distinct microbiota profiles.
Fig 4

Gut bacterial microbiome of RRMS patients is different from healthy.

(A) Bacterial ASV richness estimated by Chao1 index showing decreased bacterial richness in MS (p = 0.020). (B) Principal coordinate analysis of Bray-Curtis dissimilarity of HC and MS showing that the microbiome of HC and MS are distinct (PERMANOVA: p = 0.004). Ellipses are visual and do not correspond to any statistical analysis. (C) Relative abundance of top 50 abundant bacteria at the genus level. (D) Differentially abundant bacteria between HC and MS using Wilcoxon signed rank test and adjusted for multiple comparisons with the Benjamini-Hochberg method at a significance level of 0.05. Abundance values are sum-scaled to 1 million and generalized log-transformed. The *,**, and *** symbol indicates p-values of <0.05, <0.01, <0.001, respectively.

Gut bacterial microbiome of RRMS patients is different from healthy.

(A) Bacterial ASV richness estimated by Chao1 index showing decreased bacterial richness in MS (p = 0.020). (B) Principal coordinate analysis of Bray-Curtis dissimilarity of HC and MS showing that the microbiome of HC and MS are distinct (PERMANOVA: p = 0.004). Ellipses are visual and do not correspond to any statistical analysis. (C) Relative abundance of top 50 abundant bacteria at the genus level. (D) Differentially abundant bacteria between HC and MS using Wilcoxon signed rank test and adjusted for multiple comparisons with the Benjamini-Hochberg method at a significance level of 0.05. Abundance values are sum-scaled to 1 million and generalized log-transformed. The *,**, and *** symbol indicates p-values of <0.05, <0.01, <0.001, respectively. The five most prominent bacterial phyla across all the samples were Actinobacteria, Bacteroidetes, Firmicutes, Proteobacteria, and Verrucomicrobiota, accounting for 98.8% of all identified bacteria (S2 Fig), and of these the top 50 genera account for 94.8% of all identified bacteria (Fig 4C) with Bacteroides, Alistipes, Agathobacter, Blautia, Faecalibacterium, and Akkermansia comprising around 50% of all genera. Within the Bacteroidetes phylum, the Barnesiellaceae (padj = 4.4e-3) family and one of its genera, Barnesiella (padj = 5.9e-3), as well as the genus Odoribacter (Odoribacteraceae family; padj = 0.045) were decreased in the MS group compared to HC (S3 Fig and Fig 4D). The other differentially abundant family, Eggerthellaceae (Actinobacteria phylum; padj = 6.3e-3) and one of its genera, Eggerthella (padj = 2.4e-4), were overabundant in MS compared to HC (S3 Fig and Fig 4E). Within the Firmicutes phylum, an uncultured genus of the Oscillospiraceae family (Oscillospiraceae UCG 003) was depleted in the MS group compared to HC (padj = 0.045) while Blautia (padj = 0.045) and Hungatella (padj = 0.045) were increased in MS (Fig 4E). We have previously also shown Prevotella to be significantly decreased in MS patients and beneficial in alleviating symptoms of EAE in mice through modulation of the gut microbiome [2,29]. In this study, the relative abundance of Prevotella was decreased in the MS group, though not significantly (padj = 0.70; Fig 4C). Similarly, Akkermansia was increased in MS but did not reach statistical significance (padj = 0.73; Fig 4C). Overall, the shift in the bacterial microbiome in MS patients in this study reveals a number of genera, several of which have already been described in MS microbiome literature.

Correlation between gut mycobiome and microbiome

Comparing mycobiome changes with alterations in the bacterial microbiome of the samples show that with decreased bacterial richness comes increased fungal richness. The ITS2/16S ratio is increased in the MS group compared to the HC group (p = 0.040; Fig 5A). Across all samples, bacterial and fungal richness were negatively correlated (R = -0.28, p = 0.042; Fig 5B).
Fig 5

Correlation between gut mycobiome and microbiome.

(A) Ratio of ITS2 to 16S compared between groups. (B) Linear regression of fungal and bacterial richness shows a negative correlation (Spearman’s R = -0.28, p = 0.042). (C) Correlation matrix between bacteria and fungi using Spearman correlation. Values range from -1 to 1 with positive values as orange and red and negative values as purple and blue (-1 ≤ R ≤ 1). Only statistically significant correlations (p <0.05) are shown.

Correlation between gut mycobiome and microbiome.

(A) Ratio of ITS2 to 16S compared between groups. (B) Linear regression of fungal and bacterial richness shows a negative correlation (Spearman’s R = -0.28, p = 0.042). (C) Correlation matrix between bacteria and fungi using Spearman correlation. Values range from -1 to 1 with positive values as orange and red and negative values as purple and blue (-1 ≤ R ≤ 1). Only statistically significant correlations (p <0.05) are shown. Spearman correlation analysis reveals distinct fungal and bacterial interactions in MS and HC (Fig 5C). The microbial interactions in the HC group are dominated by negative correlations between several bacteria and six fungi. Meanwhile, the MS group exhibited more diverse relationships between the two kingdoms, with numerous positive associations appearing between various fungi and bacteria. MS patients with increased Blautia and Lactococcus in their stool had decreased Saccharomyces and increased Candida. Candida was also positively associated with Alistipes and Akkermansia. Additionally, Epicoccum and Cladosporium are negatively correlated with Prevotella. Penicillium is negatively correlated with Parasutterella and Holdemania and positive correlated with Terrisporobacter and Turicibacter. Aspergillus shares only positive correlations with multiple bacteria: Paludicola, an uncultured genus of the Oscillospiraceae family, and an uncultured genus of the Butyricicoccaceae family. This demonstrates a shift towards potentially more complex bacterial-fungal relationships in MS patients compared to HC.

Discussion

Our study characterizes the gut fungal microbiome (mycobiome) profile of RRMS patients compared with healthy individuals and identify connections between the mycobiome and bacterial microbiome. Overall, the results of this study demonstrate that the mycobiota of MS patients differs from that of healthy individuals with enrichment of Candida and Epicoccum, lower relative abundance of Saccharomyces, and increased ITS2/16S ratio in MS patients. Thus, our study highlights the important role of the understudied fungal microbiome in MS. The gut fungal microbiome (mycobiome) profile of individuals with RRMS is a very young field. While this manuscript was under review, Shah et al characterized the gut fungal microbiome (mycobiome) profile of pwMS patients using ITS1 amplicon sequencing and showed that pwMS exhibit gut fungal dysbiosis compared to healthy individuals [18]. They found that Saccharomyces and Aspergillus were relatively more abundant in patients with either RRMS, PPMS, SPMS, and CIS compared to healthy individuals [18]. Our study focuses on RRMS patients and adds to the analysis by Shah et al by demonstrating differences in the mycobiome of MS patients compared to healthy individuals using ITS2 amplicon sequencing. We also identified connections between the gut mycobiome and microbiome and examined possible differences in fungal functional profiles. We chose the ITS2 region for fungal profiling instead of ITS1 as a previous study comparing these two regions in fungal identification of the human gut microbiome demonstrated that ITS2 allowed for improved identification of taxa in the gut microbiome samples [30]. Indeed, while Shah et al identified 59 genera, another study in patients with colonic polyps identified 479 genera using the ITS2 region [31]. Additionally, the mycobiota of MS patients differs from that of healthy individuals with enrichment of Candida–one of the major fungal genus in the human gut [32]. However, the previous study by Shah et al reported very low levels (<1%) of Candida. We also observed that the Epicoccum genus was relatively increased in MS patients while Saccharomyces was relatively decreased. Additionally, an increased ITS2/16S ratio in MS patients pointed to an overall relative increase in fungal diversity compared to bacterial diversity in the disease state. We observed that Ascomycota and Basidiomycota were the main phyla present in MS and HC. Ascomycota and Basidiomycota were negatively correlated with each other which had been previously shown in other autoimmune diseases such as IBD [17] and AS [16]. MS patients had increased Basidiomycota compared to Ascomycota and an increase in the Basidiomycota/Ascomycota ratio, similar to a previously reported ratio in IBD [17]. Meanwhile in AS patients, Ascomycota abundance was increased and Basidiomycota abundance was decreased [17]. These related findings suggest that shifts in Ascomycota and Basidiomycota proportions might play a role in the pathogenesis of inflammatory diseases including MS. We detected two fungal genera, Candida and Epiccocum, with higher relative abundance, and one genus, Saccharomyces, with lower abundance in MS compared to HC. Although fungi belonging to the Candida species are considered commensal microbes, this genus has also been linked with pathogenicity, especially in individuals with compromised immunity due to antibiotic usage, immunodeficiency, or gut barrier breach [33]. Interestingly, Candida species overgrowth had been reported in other autoimmune diseases such as IBD [17,34]. Thus, it is possible that bacterial dysbiosis and inflammatory conditions in the gut create favorable environments for expansion of Candida species which can then exacerbate inflammatory diseases such as MS and IBD through induction of pro-inflammatory responses. In contrast to Candida, Saccharomyces—which is considered a beneficial fungus—has been shown to be decreased in IBD. Our findings showing a decreased abundance of Saccharomyces and increased abundance of Candida in MS is in concordance with previous findings in IBD [17]. Additionally, in colitis it has been observed that S. cerevisiae may exhibit regulatory effects on the host, notably by inducing higher IL-10 production from dendritic cells compared to Candida [17]. Moreover, colonic tissue of mice receiving S. cerevisiae [35] showed increased expression of IL-10, suggesting that either S. cerevisiae has anti-inflammatory potential or it is poorly adapted to an inflammatory environment [17]. As MS is an inflammatory disease, gut mucosal inflammation might explain the decrease in Saccharomyces and increase in Candida. Gut bacterial profiling in this study revealed an increased relative abundance of Hungatella, Eggerthella, and Blautia as well as decreased relative abundance of Odoribacter, Barnesiella, and an unidentified genus of Oscillospiraceae. These findings align with previous MS microbiome studies showing increased relative abundance of Blautia and Eggerthella in MS [2,3] and decreased relative abundance of Barnesiella [1]. Additionally, one study using a mouse model had shown increased Odoribacter in mice with relapsing-remitting EAE [36]. Previous studies have shown depletion of Prevotella and higher abundance of Akkermansia in MS patients [1,2,37], and while we also observed similar trends, these did not reach statistical significance. A number of factors could have contributed to differences in the microbiome profiles of our study, including different 16S rRNA variable region-specific primers, a recently developed analysis pipeline using ASV instead of OTU-based taxonomic mapping, as well as the geographical origin of the samples [38-40]. Our patients are on different DMT treatments which can also modulate gut microbiome and intestinal permeability, but our results did not demonstrate a significant impact of treatment with dimethyl fumarate on the fungal microbiome. Shah et al also did not find a different mycobiome between patients treated with DMTs (n = 11) compared to those who were not-treated (n = 9) at six months. They also compared the mycobiome changes in three pwMS on dimethyl fumarate (DMF) but found no consistent changes in genus abundances nor alpha diversity after treatment at the six-month point [18]. Additionally, our female to male ratio of 5:1 in this study is higher than 3:1 [1,2] and 2:1 [8] in previous studies, which could contribute to differences. Though our findings combined with those by Shah et al were unable to identify an effect of DMT on the mycobiome, future studies with larger sample sizes will be required to determine precise relationship between DMT and the human gut mycobiome. In a healthy state, there is a symbiosis between bacteria, fungi, viruses, and the host. Similar to bacteria, commensal fungi have been shown to play a significant role in maintaining immune homeostasis, and perturbation of the healthy mycobiome can influence the local and peripheral immune systems directly or indirectly through modulation of bacterial populations [41-43]. Fungi may directly interact with the immune system in the gut and influence innate and systemic immune response. Intestinal fungi and their metabolic products may also leak out of the enteric luminal surfaces and activate immune cells [12,44-46]. Besides the direct effect of fungi on the host, relationships between fungi and bacteria might play a critical role in host immunity. Fungi and bacteria can compete for nutrients and adhesion sites and modulate the environment [47,48]. Antibiotics have been linked to increasing growth of fungi in the human intestinal tract [49]. In the mouse model, increased fungal abundance was observed after antibiotic treatment which reduced after antibiotic cessation, pointing towards a balancing mechanism between microbiota and mycobiota in the gut [17,19]. Decreased bacterial diversity favors the growth of certain fungal species, and certain fungi can switch from commensal to pathogenic phenotypes [48]. In this study, we observed decreased bacterial alpha diversity and increased fungal to bacterial richness in MS compared to HC, as evident from the ITS2/16S ratio, suggesting that in MS the gut might favor fungi at the expense of bacteria. The microbial interactions in the HC group are dominated by negative correlations between several bacteria and fungi. However, our MS group exhibited more diverse relationships between the bacteria and fungi. Specifically, MS patients with increased Candida also had increased Alistipes, Akkermansia, and Lachnospiraceae GCA, and those with increased Saccharomyces also had increased Lactococcus, Blautia, and Romboutsia. It has been shown that in healthy mucosa, yeast (e.g., Candida albicans) is kept at low levels or excluded by the indigenous bacterial microbiota by the mechanism of colonization resistance which is not yet defined [50]. In fact, a previous study showed that germ-free mice are highly susceptible to Candida infection and antibiotic treatment leads to an expansion of the fungal population [19,51]. Additionally, studies in IBD and ankylosing spondylitis have shown correlations between the relative abundance of Saccharomyces and numerous bacterial genera that have been associated with these diseases. Thus, our study along with previous studies highlight a role of fungal-bacterial interactions in MS as well as other autoimmune diseases. Functional profiling of the fungal communities in this study suggests modulation of fungal carbohydrate and amino acid pathways. More specifically, while the functional profile of the MS group mycobiome suggested decreased cellulose metabolism by the gut mycobiome (decreased cellobiohydrolase and endoglucanase), starch metabolism by amylase was suggested to be increased. Invertase, which was decreased in MS, can be produced by fungi, mainly Saccharomyces cerevisiae [52]. It hydrolyzes sucrose into glucose and fructose and also has antibacterial and antioxidant properties [53]. Sucrose provides a primary substrate for the generation of starch and cellulose [54]. Both cellulose and starch are carbohydrates that can be metabolized into short-chain fatty acids (SCFAs) in the human gut [55]. However, while the metabolism of starches has been shown to increase fecal butyrate levels [56], metabolism of cellulose-related structures [57] leads to increased gut propionate levels [58]. Currently, there are limited tools for functional analysis of the mycobiome, and this study utilized a still growing database of fungal functional profiles. These profiles have been curated by compiling the results of numerous observational and experimental studies spanning over 10,000 fungal genera as of December 2020 [25]. Furthermore, studies examining the functional traits of fungi have shown that many of these traits are conserved at the genus and species levels, thus identification at these levels allows for reasonable functional inferences [59]. However, functional profiling of fungi is difficult due to the difficulty of culturing fungi and their highly varied, environmentally dependent trophic modes [25]. The quality of these profiles derived from ITS1/2 sequencing data will continue to improve as the field progresses and fungal databases grow. Alternatively, while more cost and time-intensive, whole genome sequencing of the mycobiome would provide detailed data for more reliable functional analysis of the mycobiome. We acknowledge that our small sample size is a limitation of the study. We didn’t observe any effect of different drug treatments including dimethyl fumarate on fungal composition. However due to small sample size, we cannot rule out the impact of treatment on the mycobiome and gut barrier integrity. Another limitation of this study was the different BMI distributions in the HC and MS groups with latter showing higher BMI. Interestingly, BMI was not significantly correlated to most of the differentially abundant bacteria or fungi except for Eggerthella. Nonetheless, future studies would benefit from larger sample sizes in order to better isolate the microbiota differences related to MS from those related to BMI and different treatment groups.

Conclusion

We observed that RRMS patients exhibit an altered gut mycobiome along with an altered gut microbiome. RRMS patients also showed variations in bacterial and fungal relationships with increased ratios of fungal/bacterial abundance and richness. Shifts in fungal functional profiles were also observed in RRMS patients compared to HC. Thus, our data suggest that the mycobiome may play an important role in the pathobiology of MS. Whether changes in the mycobiome play a role in initiating MS pathophysiology or modulating its presentation, or whether the pathology of MS leads to changes in the fungal mycobiome remains an important question for future studies.

Effect of treatment on gut fungal composition.

Principal coordinate analysis of beta diversity of the untreated and treated MS groups using Bray-Curtis dissimilarity. (A) No significant effect of treatment on fungal gut composition was demonstrated when comparing MS without treatment to MS treated with dimethyl fumarate (p = 0.872). (B) No significant effect of treatment on fungal gut composition was demonstrated when comparing untreated MS to MS with either dimethyl fumarate, ocrelizumab, or glatiramer acetate (p = 0.163). (TIF) Click here for additional data file.

Proportional abundance of bacteria at the phylum level.

Stacked bar plots representing the proportional abundance of the top 5 bacterial phyla in MS and HC groups. (TIF) Click here for additional data file.

Relative abundance of differentially abundant families and Genera in HC and MS.

Bar plot showing relative abundances of differentially abundant taxa (p < 0.05) at the family and genus level. (TIF) Click here for additional data file.

Metadata for bacterial and fungal sequences uploaded to PRJNA732670.

(DOCX) Click here for additional data file. 13 Sep 2021
PONE-D-21-26282
Multiple Sclerosis Patients have an Altered Gut Mycobiome and Increased Fungal to Bacterial Richness
PLOS ONE Dear Dr. Mangalam, Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process. Please submit your revised manuscript by Oct 28 2021 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.
 
Please include the following items when submitting your revised manuscript:
A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'. If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter. If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols. We look forward to receiving your revised manuscript. Kind regards, Christopher Staley, Ph.D. Academic Editor PLOS ONE Journal Requirements: When submitting your revision, we need you to address these additional requirements. 1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf 2. Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice. 3. We note that the grant information you provided in the ‘Funding Information’ and ‘Financial Disclosure’ sections do not match. When you resubmit, please ensure that you provide the correct grant numbers for the awards you received for your study in the ‘Funding Information’ section. 4.  Thank you for stating the following in the Competing Interests section: "AM is one of the inventors of a technology claiming the use of Prevotella histicola to treat autoimmune diseases. AM received royalties from Mayo Clinic (paid by Evelo Biosciences). MY, SA, RS, SS, SJ, JH, SC, HO, NG, MP, CC, KW, TC, JK declare no commercial or financial relationships that could be a potential conflict of interest." We note that you received funding from a commercial source: Mayo Clinic Please provide an amended Competing Interests Statement that explicitly states this commercial funder, along with any other relevant declarations relating to employment, consultancy, patents, products in development, marketed products, etc. Within this Competing Interests Statement, please confirm that this does not alter your adherence to all PLOS ONE policies on sharing data and materials by including the following statement: "This does not alter our adherence to PLOS ONE policies on sharing data and materials.” (as detailed online in our guide for authors http://journals.plos.org/plosone/s/competing-interests).  If there are restrictions on sharing of data and/or materials, please state these. Please note that we cannot proceed with consideration of your article until this information has been declared. Please include your amended Competing Interests Statement within your cover letter. We will change the online submission form on your behalf. Additional Editor Comments: This study was of interest as the mycobiome is rarely explored relative to bacterial communities. The reviewers note the small sample size and recommend additional clarifications and analyses to improve the study. [Note: HTML markup is below. Please do not edit.] Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Yes Reviewer #2: Yes ********** 2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: Yes Reviewer #2: Yes ********** 3. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes Reviewer #2: Yes ********** 4. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes Reviewer #2: Yes ********** 5. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: This original article is good, in a general typical trend-again, athors are looking for differences in the microbiota in the feces of patients with MS compared to healthy donors. This time, the focus on mushrooms is a special attention to "mycobiota". A number of differences are found (for example, an increase in Candida, Epicoccum, and a decrease in Saccharomyces in MS), but it is unclear what these differences affect and what they are caused by. Of interest-the microbiota of patients on different therapies is compared (a total of 22 patients with RRRS and 33 healthy donors). Including 6 patients on dimethyl fumarate. The authors write that because of COVID, they have a small group, and therefore there is no comparison between different therapies. But I would ask them to add a comparison specifically of patients on dimethyl fumarate with other patients, as well as with healthy donors. Dimethylfumart is just known for its fungicidal activity, so it is interesting to see if there is any influence here. For statistical significance, this is not much and must be presented in details Reviewer #2: The study by Yadav et al., presents data on the gut mycobiome and its relation to bacteria in relapsing MS patients. This manuscript is important, because mycobiota roles in autoimmune mediated diseases like MS are largely unknown. This manuscript is not the first to probe the relationship of fungi and MS, however it does add data points to a still incredibly young field. Enthusiasm for the manuscript is tapered by the small sample size which likely contributes to numerous confounds such as BMI differences, a larger than normal female:male ratio, and 4 DMT populations. Analyses of the mycobiome are scientifically sound, however, there is always inherent risk of garnering misleading data when using 16S or ITS2 data sets to infer species level or functional significance. That said, I recommend for publication barring changes listed below. Major comments: 1. This is not the first paper to investigate mycobiome in MS patient’s vs HCs as stated in lines 301-303. Shah et al., 2021, ebiomedicine needs to be cited and discussed in this manuscript. 2. Line 334-335 in discussion should be further fleshed out to include points about DMT influence on gut microbiome and gut barrier integrity. 3. Significant difference in BMI in HC vs MS population needs to be discussed as a limitation of this manuscript. 4. Authors should measure the overall effect of disease status, DMT, BMI and other factors such as ethnicity on the mycobiome and can use the ADONIS test to accomplish this. 5. Discussion about correlative/presumptive nature of inferring species and function of fungi from this data set needs to be included. Line 404-406 starts to do this, however, is not exhaustive enough to provide perspective for the data present in this manuscript. 6. Supplemental figure 2 should be included in the paper and analyzed, as the phyla level abundance 16S analyses are not very exciting compared to previous data in the literature. Minor comments: 1. The IRB # should be included. 2. This study identified more than double the fungal genera compared to other studies available, authors should elaborate on this in discussion. 3. Paragraph on 387 needs to be more thoroughly cited. 4. Discussion paragraph beginning on line 369 is not focused and does not add much new to the discussion. 5. Final paragraph of discussion does not need to include discussions of COVID impacting patient recruitment. 6. Line 365/366 uses two different fonts. ********** 6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #2: Yes: Howard Weiner [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.
27 Oct 2021 We have addressed all the criticisms raised by the reviewers (as detailed in response to reviewer file) and editors and changes are marked by track change in red color with deleted portion strike-out and additions underlined. Editor's comments We have moved funding information to separate section. We have also clarified that no funding was received from Mayo Clinic for the study and royalties paid by Mayo Clinic is to an individual (AM) directly for the patent. Rebuttal letter and point by point reply to reviewers' comment Point by Point Reply to Reviewers’ comment Reviewer #1: This original article is good, in a general typical trend-again, authors are looking for differences in the microbiota in the feces of patients with MS compared to healthy donors. This time, the focus on mushrooms is a special attention to "mycobiota". A number of differences are found (for example, an increase in Candida, Epicoccum, and a decrease in Saccharomyces in MS), but it is unclear what these differences affect and what they are caused by. Of interest-the microbiota of patients on different therapies is compared (a total of 22 patients with RRRS and 33 healthy donors). Including 6 patients on dimethyl fumarate. The authors write that because of COVID, they have a small group, and therefore there is no comparison between different therapies. #1 But I would ask them to add a comparison specifically of patients on dimethyl fumarate with other patients, as well as with healthy donors. Dimethylfumart is just known for its fungicidal activity, so it is interesting to see if there is any influence here. For statistical significance, this is not much and must be presented in details. We agree with reviewer and analyzed effect of DMTs including dimethyl fumarate on mycobiome and data is presented in Supplemental figure 1. We also added the same in results and discussed in discussion as highlighted below- Results-Line 170-174 “Interestingly, beta-diversity analysis of the MS group did not demonstrate a significant effect of treatment with dimethyl fumarate (p = 0.872) on the mycobiome composition (Supp 1A). Including other disease modifying treatments (DMTs) with at least 3 samples, no significant effect was shown for treatment (p = 0.163; Supp 1B), gender (p = 0.197), or BMI status (p = 0.414).” Discussion -Line 384-396 “Our patients are on different DMT treatments which can also modulate gut microbiome and intestinal permeability, but our results did not demonstrate a significant impact of treatment with dimethyl fumarate on the fungal microbiome. Shah et al also did not find a different mycobiome between patients treated with DMTs (n=11) compared to those who were not-treated (n=9) at six months. They also compared the mycobiome changes in three pwMS on dimethyl fumarate (DMF) but found no consistent changes in genus abundances nor alpha diversity after treatment at the six-month point [18]. Additionally, our female to male ratio of 5:1 in this study is higher than 3:1 [1, 2] and 2:1 [8] in previous studies, which could contribute to differences. Though our findings combined with those by Shah et al were unable to identify an effect of DMT on the mycobiome, future studies with larger sample size will be required to determine precise relationship between DMT and the human gut mycobiome.” Reviewer #2: The study by Yadav et al., presents data on the gut mycobiome and its relation to bacteria in relapsing MS patients. This manuscript is important, because mycobiota roles in autoimmune mediated diseases like MS are largely unknown. This manuscript is not the first to probe the relationship of fungi and MS, however it does add data points to a still incredibly young field. Enthusiasm for the manuscript is tapered by the small sample size which likely contributes to numerous confounds such as BMI differences, a larger than normal female:male ratio, and 4 DMT populations. Analyses of the mycobiome are scientifically sound, however, there is always inherent risk of garnering misleading data when using 16S or ITS2 data sets to infer species level or functional significance. That said, I recommend for publication barring changes listed below. Major comments: 1. This is not the first paper to investigate mycobiome in MS patient’s vs HCs as stated in lines 301-303. Shah et al., 2021, ebiomedicine needs to be cited and discussed in this manuscript. Thanks for bringing it to our attention. We have removed that sentence saying our is the first study. We have cited and discussed paper by Shah et al on fungal microbiome published in EBiomedicine. Starting discussion paragraphs now reads- “Our study characterizes the gut fungal microbiome (mycobiome) profile of RRMS patients compared with healthy individuals and identify connections between the mycobiome and bacterial microbiome. Overall, the results of this study demonstrate that the mycobiota of MS patients differs from that of healthy individuals with enrichment of Candida, and Epicoccum, with lower relative abundance of Saccharomyces, and increased ITS2/16S ratio in MS patients. Thus, our study highlights the important role of the understudied fungal microbiome in MS. The gut fungal microbiome (mycobiome) profile of individuals with RRMS is a very young field. While this manuscript was under review, Shah et al characterized the gut fungal microbiome (mycobiome) profile of pwMS patients using ITS1 amplicon sequencing and showed that pwMS have fungal dysbiosis compared to healthy individuals [18]. They found that Saccharomyces and Aspergillus were relatively less abundant in group of patients with either RRMS, PPMS, SPMS, and CIS compared to healthy individuals [18]. Our study focuses on RRMS patients and adds to the analysis by Shah et al by demonstrating differences in the mycobiome of MS patients compared to healthy individuals using ITS2 amplicon sequencing. We also identified connections between the gut mycobiome and microbiome and examined possible differences in fungal functional profiles.” 2. Line 334-335 in discussion should be further fleshed out to include points about DMT influence on gut microbiome and gut barrier integrity. We have further addressed how DMTs may influence the gut microbiome and gut barrier integrity. Now the discussion (lines 384-396). “Our patients are on different DMT treatments which can also modulate gut microbiome and intestinal permeability, but our results did not demonstrate a significant impact of treatment with dimethyl fumarate on the fungal microbiome. Shah et al also did not find a different mycobiome between patients treated with DMTs (n=11) compared to those who were not-treated (n=9) at six months. They also compared the mycobiome changes in three pwMS on dimethyl fumarate (DMF) but found no consistent changes in genus abundances nor alpha diversity after treatment at the six-month point [18] Additionally, our female to male ratio of 5:1 in this study is higher than 3:1 [1, 2] and 2:1 [8] in previous studies, which could contribute to differences. Thus, our findings combined with Shah et al suggests that DMT don’t affect the mycobiome, however future studies with larger sample size will be required to determine precise effect of DMT on mycobiome.” 3. Significant difference in BMI in HC vs MS population needs to be discussed as a limitation of this manuscript. We have added how BMI can be a limitation to this study on lines 459-461 “Another limitation of this study was the different Body Mass Index (BMI) distributions in the HC and MS groups with latter showing higher BMI. Interestingly, BMI was not significantly correlated to most of the differentially abundant bacteria or fungi except for Eggerthella.” 4. Authors should measure the overall effect of disease status, DMT, BMI and other factors such as ethnicity on the mycobiome and can use the ADONIS test to accomplish this. As per your suggestion we have added supplemental figure showing these analysis as mentioned in #2 and #3. Since no patients in the HC group were taking any DMTs, treatment and disease are codependent variables, so we performed the PERMANOVA analysis with adonis2 on just the MS group to measure the overall effects of treatment, gender, and BMI status. We separately analyzed the overall effects of disease status, gender, and BMI status on both the HC and MS groups and have revised the results section on lines 171-176 to reflect all these results. “Principal coordinate analysis of beta diversity using Bray-Curtis dissimilarity (Fig 1B) demonstrated distinct clustering of the mycobiome of MS compared with HC (p = 0.011), while gender (p = 0.32) and BMI status (p = 0.73) did not show a significant effect on mycobiome composition. Interestingly, beta-diversity analysis of the MS group did not demonstrate a significant effect of treatment with dimethyl fumarate (p = 0.872) on the mycobiome composition (Supp 1A). Including other disease modifying treatments (DMTs) with at least 3 samples, no significant effect was shown for treatment (p = 0.163; Supp 1B), gender (p = 0.197), or BMI status (p = 0.414).” 5. Discussion about correlative/presumptive nature of inferring species and function of fungi from this data set needs to be included. Line 404-406 starts to do this, however, is not exhaustive enough to provide perspective for the data present in this manuscript. We have further discussed the presumptive nature of inferring fungi species and function from our data set on lines 444-453: “Currently, there are limited tools for functional analysis of the mycobiome, and this study utilized a still growing database of fungal functional profiles. These profiles have been curated by compiling the results of numerous observational and experimental studies spanning over 10000 fungal genera as of December 2020 (FungalTraits paper). Furthermore, studies examining the functional traits of fungi have shown that many of these traits are conserved at the genus and species levels, thus identification at these levels allows for reasonable functional inferences (31763752). However, functional profiling of fungi is difficult due to the difficulty of culturing fungi and their highly varied, environmentally dependent trophic modes24. The quality of these profiles derived from ITS1/2 sequencing data will continue to improve as the field progresses and these databases grow.” 6. Supplemental figure 2 should be included in the paper and analyzed, as the phyla level abundance 16S analyses are not very exciting compared to previous data in the literature. We have moved the previous Supplemental figure 2 to Figure 4C and have moved the previous Figure 4C to the supplement. We have also provided an analysis of the relative abundances of the most common genera. We decided to try to capture 95% of the bacteria with the genera depicted in this figure, so we showed the top 50 genera to do this. Minor comments: 1. The IRB # should be included. We have included the IRB number on line 76 (201512717). 2. This study identified more than double the fungal genera compared to other studies available, authors should elaborate on this in discussion. As per your suggestion we have added this to our discussion “The use of ITS2 region for fungal profiling instead of ITS1 allowed for improved identification of taxa in the gut microbiome samples, as previously comparing these two regions in fungal identification of the human gut microbiome demonstrated (PMID:30283425). Indeed, while Shah et al identified 59 genera, a similar study in patients with colonic polyps that profiled the ITS2 region instead identified 479 genera (PMID:28821976).” 3. Paragraph on 387 needs to be more thoroughly cited. We have cited appropriate references in the paragraph as advised by the reviewer and paragraph read as below- “Invertase, which was decreased in MS, can be produced by fungi, mainly Saccharomyces cerevisiae [52]. It hydrolyzes sucrose into glucose and fructose and also has antibacterial and antioxidant properties [53]. Sucrose provides a primary substrate for the generation of starch and cellulose [54]. Both cellulose and starch are carbohydrates that can be metabolized into short-chain fatty acids (SCFAs) in the human gut [55]. However, while the metabolism of starches has been shown to increase fecal butyrate levels [56], metabolism of cellulose-related structures [57] leads to increased gut propionate levels [58]” 4. Discussion paragraph beginning on line 369 is not focused and does not add much new to the discussion. We have made this paragraph more succinct and highlight the point that, in addition to the potential role of fungi and bacteria separately in disease, the correlations suggest that interactions between these two kingdoms may also be playing a role. We had not made this clear in our previous version and hope this paragraph now better serves its purpose. “The microbial interactions in the HC group are dominated by negative correlations between several bacteria and fungi. However, our MS group exhibited more diverse relationships between the bacteria and fungi. Specifically, MS patients with increased Candida also had increased Alistipes, Akkermansia, and Lachnospiraceae GCA, and those with increased Saccharomyces also had increased Lactococcus, Blautia, and Romboutsia. It has been shown that in healthy mucosa, yeast (e.g., Candida albicans) is kept at low levels or excluded by the indigenous bacterial microbiota by the mechanism of colonization resistance which is not yet defined [50]. In fact, a previous study showed that germ-free mice are highly susceptible to Candida infection and antibiotics treatment leads to an expansion of fungal population [19, 51]. Additionally, studies in IBD and ankylosing spondylitis have shown correlations between the relative abundance of Saccharomyces and numerous bacterial genera that have been associated with these diseases. Thus, our study along with previous studies highlight a role of fungal-bacterial interactions in MS as well as other autoimmune diseases.” 5. Final paragraph of discussion does not need to include discussions of COVID impacting patient recruitment. We have removed our statement about COVID impacting patient recruitment as suggested by the reviewer. 6. Line 365/366 uses two different fonts. We have made the fonts the same between the lines pointed out by the reviewer. Submitted filename: Response To Reviewers.docx Click here for additional data file. 14 Feb 2022 Multiple sclerosis patients have an altered gut mycobiome and increased fungal to bacterial richness PONE-D-21-26282R1 Dear Dr. Mangalam, We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements. Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication. An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org. If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org. Kind regards, Christopher Staley, Ph.D. Academic Editor PLOS ONE Additional Editor Comments (optional): Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation. Reviewer #1: All comments have been addressed Reviewer #2: All comments have been addressed ********** 2. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Yes Reviewer #2: Yes ********** 3. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: Yes Reviewer #2: Yes ********** 4. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes Reviewer #2: Yes ********** 5. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes Reviewer #2: Yes ********** 6. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: Authors made all recommended corrections and could be accepted to the journal. All comments and explanations are understandable. Reviewer #2: The authors have addressed all my comments. The paper has addresses an important question related to the microbiome in MS. ********** 7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #2: Yes: Howard L Weiner 18 Apr 2022 PONE-D-21-26282R1 Multiple sclerosis patients have an altered gut mycobiome and increased fungal to bacterial richness Dear Dr. Mangalam: I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org. If we can help with anything else, please email us at plosone@plos.org. Thank you for submitting your work to PLOS ONE and supporting open access. Kind regards, PLOS ONE Editorial Office Staff on behalf of Dr. PLOS Manuscript Reassignment Staff Editor PLOS ONE
  52 in total

Review 1.  Fungi in the healthy human gastrointestinal tract.

Authors:  Heather E Hallen-Adams; Mallory J Suhr
Journal:  Virulence       Date:  2016-10-13       Impact factor: 5.882

Review 2.  The role of short-chain fatty acids in the interplay between diet, gut microbiota, and host energy metabolism.

Authors:  Gijs den Besten; Karen van Eunen; Albert K Groen; Koen Venema; Dirk-Jan Reijngoud; Barbara M Bakker
Journal:  J Lipid Res       Date:  2013-07-02       Impact factor: 5.922

3.  Human Gut-Derived Commensal Bacteria Suppress CNS Inflammatory and Demyelinating Disease.

Authors:  Ashutosh Mangalam; Shailesh K Shahi; David Luckey; Melissa Karau; Eric Marietta; Ningling Luo; Rok Seon Choung; Josephine Ju; Ramakrishna Sompallae; Katherine Gibson-Corley; Robin Patel; Moses Rodriguez; Chella David; Veena Taneja; Joseph Murray
Journal:  Cell Rep       Date:  2017-08-08       Impact factor: 9.423

4.  Comparison of prebiotic effects of arabinoxylan oligosaccharides and inulin in a simulator of the human intestinal microbial ecosystem.

Authors:  Charlotte Grootaert; Pieter Van den Abbeele; Massimo Marzorati; Willem F Broekaert; Christophe M Courtin; Jan A Delcour; Willy Verstraete; Tom Van de Wiele
Journal:  FEMS Microbiol Ecol       Date:  2009-06-09       Impact factor: 4.194

5.  Human gut microbiome viewed across age and geography.

Authors:  Tanya Yatsunenko; Federico E Rey; Mark J Manary; Indi Trehan; Maria Gloria Dominguez-Bello; Monica Contreras; Magda Magris; Glida Hidalgo; Robert N Baldassano; Andrey P Anokhin; Andrew C Heath; Barbara Warner; Jens Reeder; Justin Kuczynski; J Gregory Caporaso; Catherine A Lozupone; Christian Lauber; Jose Carlos Clemente; Dan Knights; Rob Knight; Jeffrey I Gordon
Journal:  Nature       Date:  2012-05-09       Impact factor: 49.962

6.  The role of gut microbiota in shaping the relapse-remitting and chronic-progressive forms of multiple sclerosis in mouse models.

Authors:  K Alexa Orr Gandy; Jiajia Zhang; Prakash Nagarkatti; Mitzi Nagarkatti
Journal:  Sci Rep       Date:  2019-05-06       Impact factor: 4.379

7.  The SILVA ribosomal RNA gene database project: improved data processing and web-based tools.

Authors:  Christian Quast; Elmar Pruesse; Pelin Yilmaz; Jan Gerken; Timmy Schweer; Pablo Yarza; Jörg Peplies; Frank Oliver Glöckner
Journal:  Nucleic Acids Res       Date:  2012-11-28       Impact factor: 16.971

8.  Comparison and validation of some ITS primer pairs useful for fungal metabarcoding studies.

Authors:  Michiel Op De Beeck; Bart Lievens; Pieter Busschaert; Stéphan Declerck; Jaco Vangronsveld; Jan V Colpaert
Journal:  PLoS One       Date:  2014-06-16       Impact factor: 3.240

9.  Revealing links between gut microbiome and its fungal community in Type 2 Diabetes Mellitus among Emirati subjects: A pilot study.

Authors:  Mohammad Tahseen Al Bataineh; Nihar Ranjan Dash; Pierre Bel Lassen; Bayan Hassan Banimfreg; Aml Mohamed Nada; Eugeni Belda; Karine Clément
Journal:  Sci Rep       Date:  2020-06-15       Impact factor: 4.379

Review 10.  Microbial cellulases - Diversity & biotechnology with reference to mangrove environment: A review.

Authors:  B C Behera; B K Sethi; R R Mishra; S K Dutta; H N Thatoi
Journal:  J Genet Eng Biotechnol       Date:  2016-12-30
View more
  2 in total

1.  Proinflammatory mucosal-associated invariant CD8+ T cells react to gut flora yeasts and infiltrate multiple sclerosis brain.

Authors:  Francesca Gargano; Gisella Guerrera; Eleonora Piras; Barbara Serafini; Monica Di Paola; Lisa Rizzetto; Maria Chiara Buscarinu; Viviana Annibali; Claudia Vuotto; Marco De Bardi; Silvia D'Orso; Serena Ruggieri; Claudio Gasperini; Lorenzo Pavarini; Giovanni Ristori; Mario Picozza; Barbara Rosicarelli; Clara Ballerini; Rosella Mechelli; Francesco Vitali; Duccio Cavalieri; Marco Salvetti; Daniela F Angelini; Giovanna Borsellino; Carlotta De Filippo; Luca Battistini
Journal:  Front Immunol       Date:  2022-07-28       Impact factor: 8.786

Review 2.  The gut microbiome molecular mimicry piece in the multiple sclerosis puzzle.

Authors:  Noha S Elsayed; Paula Aston; Vishnu R Bayanagari; Sanjay K Shukla
Journal:  Front Immunol       Date:  2022-08-15       Impact factor: 8.786

  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.