Assessment of RNA extraction protocols from cladocerans.

The usage of cladocerans as non-model organisms in ecotoxicological and risk assessment studies has intensified in recent years due to their ecological importance in aquatic ecosystems. The molecular assessment such as gene expression analysis has been introduced in ecotoxicological and risk assessment to link the expression of specific genes to a biological process in the cladocerans. The validity and accuracy of gene expression analysis depends on the quantity, quality and integrity of extracted ribonucleic acid (RNA) of the sample. However, the standard methods of RNA extraction from the cladocerans are still lacking. This study evaluates the extraction of RNA from tropical freshwater cladocerans Moina micrura using two methods: the phenol-chloroform extraction method (QIAzol) and a column-based kit (Qiagen Micro Kit). Glycogen was introduced in both approaches to enhance the recovery of extracted RNA and the extracted RNA was characterised using spectrophotometric analysis (NanoDrop), capillary electrophoresis (Bioanalyzer). Then, the extracted RNA was analysed with reverse transcription polymerase chain reaction (RT-PCR) to validate the RNA extraction method towards downstream gene expression analysis. The results indicate that the column-based kit is most suitable for the extraction of RNA from M. micrura, with the quantity (RNA concentration = 26.90 ± 6.89 ng/μl), quality (A260:230 = 1.95 ± 0.15, A280:230 = 1.85 ± 0.09) and integrity (RNA integrity number, RIN = 7.20 ± 0.16). The RT-PCR analysis shows that the method successfully amplified both alpha tubulin and actin gene at 33-35 cycles (i.e. Ct = 32.64 to 33.48). The results demonstrate that the addition of glycogen is only suitable for the phenol-chloroform extraction method. RNA extraction with high and comprehensive quality control assessment will increase the accuracy and reliability of downstream gene expression, thus providing more ecotoxicological data at the molecular biological level on other freshwater zooplankton species.

Introduction

Comprehensive reports on the hazards, dose-response and exposure of chemicals are necessary to establish a precise assessment of chemicals’ effects on humans and the ecosystem [1]. Conventional ecotoxicological assessment is highly costly, time-consuming and dependent on testing animals as surrogates for exposure effects on humans [2]. Conventional assessments only emphasise traditional apical endpoints rather than evaluating the specific pathway of the chemicals. The pathway assessment is essential to assess the interactions of cells with tissues, tissues with organs and organs with the individual [3]. Restriction on the use of animals in ecotoxicological assessment is enforced by the European Union unless no other possible method is applicable [4,5]. The National Institutes of Health (NIH) in the United States suggested ecotoxicological testing using animal models should construct the assessment methodology using the Replacement, Reduction, and Refinement strategy [6]. Alternative computerised analysis programs to regulate emerging chemicals instead of animal models were established under the ‘Replacement’ strategy. The approach also encourages the usage of cells and tissues, including the substitution from higher taxonomic rank animals (mammals and primates) to lower taxonomic rank animals (invertebrates). Subsequently, the number of animals used per test would be reduced via the ‘Reduction’ strategy by preventing any irrelevant replication for each assessment process. Efficient and accurate experimental design through ‘Refinement’ would minimise test animals’ suffering.

Risk assessors have begun to utilise non-model organisms such as aquatic invertebrates as bioindicators in ecotoxicological studies [7-10]. As a result, the amount of molecular assessment of zooplankton in the ecotoxicity discipline has intensified in recent years [11-18]. Among the zooplankton species, cladocerans are the group most responsive to the miniscule concentration of toxicants, as compared with copepods and rotifers [16]. Cladocerans are located in the middle of the food chain and will act as a warning alarm towards any perturbations in the aquatic ecosystem [19]. For example, cladocerans generate a vital connection between primary production (diatom-rich phytoplankton) and higher trophic organisms (fish). Inexpensive cladocerans species have reduced the cost of toxicity testing; for example, laboratory sizes can be shrunk by 50% compared to those needed for fish/animal models [20]. However, most researchers used temperate cladocerans species such as Daphnia magna as a species model, whereas tropical zooplankton species have not been thoroughly studied [21,22].

Moina micrura is a native cladoceran that is highly abundant in tropical countries including Malaysia, Thailand, the Philippines, China, Sri Lanka, India, Mexico and Brazil [23-29]. Due to their high ecological relevance, native species should be utilised in ecotoxicological studies to show the actual potential risks posed to tropical freshwater life [30]. There are fewer logistical restraints due to the high availability of this species in the wild, thus prohibiting another foreign species from being introduced into the native ecosystems [31]. Numerous study utilised M. micrura as a bioindicator in ecotoxicological and risk assessment due to the sensitivity of the species. For example, M. micrura is the most sensitive species towards cyanobacteria compared to tropical cladocerans Daphnia laevis and temperate cladocerans Daphnia similis [32]. Furthermore, M. micrura was the most sensitive species towards chlorpyrifos with the LC50 value 0.08 μg/L compared with Ceriodaphnia dubia, D. magna and Daphnia duplex with the LC50 value of 0.117 μg/L, 0.30 μg/L and 1.0 μg/L respectively [33]. Similar with other cladocerans, M. micrura possess a rapid life cycle and significant offspring due to the parthenogenesis reproduction system [34]. These characteristics permit a large number of assessments, including multigenerational experiments, with shorter time frames and minimised costs [35]. The organism’s transparent carapace allows novel organ endpoints such as eggs in the brood chamber, gut and heart to indicate specific mechanistic responses [3]. Cladocerans’ unique characteristics allow the prospect of more comprehensive ecotoxicological studies at different organizational levels such as molecular, organ, individual, and population level.

Despite the advantages of cladocerans as a bioindicator in the ecotoxicity discipline, the absence of established protocols to extract nucleic acids from cladocerans have interrupted the assessment at molecular levels. Gene expression is an example of a molecular assessment used by molecular biologists and environmental toxicologists to link the expression of specific genes to a biological process [36]. This assessment can assist scientists in recognising biological pathways and identifying the genes that regulate cell behaviour, development and disease [37]. However, the consistent and comprehensive analysis of gene expression depends on the quantity, quality and integrity of extracted RNA of the sample [38]. Subsequently, RNA extraction methods can be divided into two primary categories: conventional phenol-chloroform methods and silica-based kits [39]. The methods have been modified with several reagents to enhance the quantity, quality and integrity of RNA. For example, glycogen was added during the RNA extraction process to increase the RNA quantity and quality in different types of samples such as human [40,41] and rat [42] and insects [43,44]. Glycogen contain a highly purified polysaccharide and commonly used as an inert carrier and acts as a free host to RNA [45]. Due to the insoluble characteristics of an ethanol solution, glycogen produces a precipitate that holds nucleic acids [46]. This precipitate will form a visible pallet, which will ease the handling of nucleic acids.

Most zooplankton, including cladoceran species, consists of 18S and 28S rRNA. High- integrity RNA will show distinguished 18S and 28S rRNA peaks, with no smearing towards a smaller nucleotide (nt) [43]. Agarose gels are the conventional method to assess 18S and 28S rRNA bands. However, this method has several drawbacks; for example, the rRNA bands can be influenced by the electrophoresis conditions, the volume of loaded RNA and the saturation of ethidium bromide fluorescence [47]. shows the summary of the study’s analysis to characterise the RNA quantity, quality and integrity. As the table indicates, this study conducted the analysis using the bioanalyzer instrument, which combines fluorescence, microfluidics and capillary electrophoresis to minimise errors during the evaluation of RNA integrity. The bioanalyzer utilised automatic microfluidics-based electrophoretic techniques that determine the RNA quality value based on the analysis of digitalised electropherograms by proprietary algorithms [48]. Additionally, the minimal input as low as 50 pg/μl of RNA sample permitted the characterisation of RNA integrity [49]. This feature is critical for determining RNA integrity in small samples like cladocerans because the quantity of extracted RNA is not high.

In this study, a comprehensive assessment of RNA extracted from Cladocerans M. micrura with the addition of glycogen was reported for both the phenol-chloroform extraction method and the column-based kit method. This study provides a reliable and simple method for the molecular assessment of M. micrura for downstream applications such as reverse transcription polymerase chain reaction (RT-PCR) and next-generation sequencing (NGS) for potential application in functional genomic research such as gene expression profiling.

Material and methods

Chemicals and reagents

The chemicals, reagents, micropipette tips and micropestles used were molecular grade and certified Rnase-free. Chloroform, isopropanol, ethanol, β mercaptoethanol were purchased from Merck (Steinheim, Germany). RNase- QIAzol reagents, free water and Qiagen Micro kits were acquired from Qiagen (Hilden, Germany). RNA-grade glycogen was obtained from Thermo Fisher Scientific (MA, United States). To ensure a high quality of RNA extraction, workspaces such as lab benches and laminar flows were cleaned using 100% ethanol each time to ensure their cleanliness and to remove all contaminants. During handling of the reagent and RNA samples, gloves are utilised at all times and changed regularly as the protocol progresses from crude extract to more purified material.

M. micrura culture specifications

Live samples of Cladocerans M. micrura were obtained from the culture in the Aquatic Animal Health and Therapeutics Laboratory (AquaHealth), Institute of Bioscience, Universiti Putra Malaysia. The culture was cultivated based on the International Organization for Standardization (ISO) method (ISO 6341:2012). The culture specifications were regulated to the light/dark cycle of 12: 12 h and 27 ± 1°C. The media was changed every two days with the daily supplementation of a green microalga species, Chlorella vulgaris (1.0 × 106~8 cells/ ml, 1 ml/day), as the food supply.

M. micrura controlled samples collection

The standardization of sample collection to ensure the M. micrura in controlled condition throughout the RNA extraction process. Live M. micrura females were sorted from the culture sample under a Zeiss Axioskop 2 microscope (Zeiss, Germany). Females of M. micrura were collected similarly from the controlled culture prior to the RNA extraction. All experiments were performed in accordance with UK legislation under the Animals (Scientific Procedures) Act 1986 Amendment Regulations (SI 2012/3039).

RNA extraction

QIAzol (Method A).

Ten (10) and thirty (30) individuals of female M. micrura were transferred into a microcentrifuge tube.

Deionised water (1 ml) was added and the samples were gently rinsed using a micropipette to wash away any impurities attached to them. The samples were transferred into a new microcentrifuge tube.

QIAzol (100 μl) was added into the microcentrifuge tubes.

The samples were homogenised using a cordless microtube homogeniser (Bel-Art, NJ, USA) attached to the disposable plastic micropestle (Bel-Art, NJ, USA). The homogeniser was rotated 30 to 50 times under pressure until no large particles were visible under direct light.

The micropestle was rinsed with fresh QIAzol (900 μl) of reagent added into the microcentrifuge. The samples were vortexed briefly and incubated for 5 minutes at room temperature.

Chloroform (200 μl) was added to the samples, vortexed briefly and incubated at room temperature for 3 minutes.

The samples were centrifuged at >12,000 rpm, 4°C for 15 min. The supernatant (upper layer) was transferred to a clean microcentrifuge tube.

Isopropanol (500 μl) was added, and then the samples were vortexed briefly and incubated for 10 minutes at room temperature.

The samples were centrifuged at >12,000 rpm in 4°C for 20 minutes and the supernatant was removed.

The pellet was washed with 1000 μl of 75% ethanol (diluted with RNase-free water). Then, the samples were centrifuged at 7500 rpm at 4°C for 2 min.

The supernatant was carefully removed and the washing process was repeated once more (step 10). The supernatant was completely removed and air-dried for 10 min

The pallet was dissolved with 20 μl of RNase-free water. The samples were placed in the water bath at 45°C for 5 minutes and immediately held in ice for 2 minutes.

The extracted RNA was stored at -80°C prior to characterisation analysis. illustrates the QIAzol (Method A) method and the QIAzol + glycogen (Method B) method.

QIAzol + glycogen (Method B).

Use a similar method with Method A but with the addition of 2 μl of RNA-grade glycogen during the RNA precipitation process.

Qiagen Micro Kit (Method C).

Ten (10) and thirty (30) individuals of female M. micrura were transferred into a microcentrifuge tube.

The samples were homogenised in of RLT buffer (350 μl) and β mercaptoethanol (4 μl) by using a similar procedure to that of the previous method.

The Qiagen Micro Kit was used according to the manufacturer’s protocol.

To avoid RNA degradation, all centrifugations were carried out at 4°C and samples were kept on ice during the entire procedure

The RNA was eluted in RNase-free water (20 μl).

The extracted RNA was stored at -80°C prior to characterisation analysis. illustrates the Qiagen Micro Kit (method C) method and the Qiagen Micro Kit + glycogen (Method D) method.

Qiagen Micro Kit + glycogen (Method D).

Use a similar method with Method C but with the addition of 2 μl of RNA-grade glycogen (Thermo Fisher Scientific, MA, United States) during the RNA precipitation process.

RNA characterisation

The quantity (RNA yield) and quality (A260/230 and A260/280 ratios) of total RNA were measured by the Genova Nano spectrophotometer Jenway (OSA, UK). The integrity of RNA (RIN value) was measured by Agilent 2100 Bioanalyzer Agilent Technologies (Waldbronn, Germany). The bioanalyzer instrument used the Agilent RNA 6000 Pico Kit and was supplied by Agilent Technologies (Waldbronn, Germany).

First-strand complementary DNA (cDNA) Synthesis and Reverse-Transcription Polymerase Chain Reaction (RT-PCR)

Two (2) replicate of RNA extraction samples from the best extraction method were used for cDNA synthesis and subsequent RT-PCR using primers based on previous literature [50]. Tetro cDNA Synthesis Kit (Bioline, USA) was utilised to synthesis complementary DNA (cDNA) by mixing 2 μg/μl of total RNA, 8 μl of Reverse Transcriptase Buffer, 2 μl of 10 mM dNTP mix, 2 μl of Oligo (dT)18 Primer, 2 μl of Ribosafe RNase Inhibitor, 2 μl of Tetro Reverse Transcriptase and RNase free Water to make up to 40 μl. The reaction mixture was homogenised by pipetting gently and incubated inside T100™ thermal cycler (Bio-Rad, USA) at 45°C for 30 minutes. This was followed by an incubation at 85°C for 5 minutes to stop the reverse transcriptase reaction and the holding temperature was finally held at 4°C. The cDNA was kept at -20°C before RT-PCR analysis.

Two (2) genes () will be validated using SensiFAST™ SYBR No-ROX Kit (Bioline, USA). 0.3 μg of cDNA template will be mixed with 0.4 μl of 10 μM forward qPCR primer, 0.4 μl of 10 μM reverse qPCRprimer, 10 μl of 2 x SensiFast SYBR No-ROX Mix (containing 10 μM of dNTP mixture, 3 mM of MgCl2, SYBR® Green I dye, Taq Polymerase buffer, Taq DNA Polymerase, stabilisers and enhancers) and 8.2 μl of PCR grade distilled water. Each mixture will be pipetted into a 0.2 ml PCR tube, vortexed and centrifuged for a short spin prior to placing it into the Rotor-Gene Q thermocycler (QIAGEN, Germany). Two step RT-PCR will be performed with the cycling conditions consisting of an initial denaturation step at 95°C for 2 minutes, 40 cycles of denaturation (95°C for 5 seconds) and 65°C of annealing reaction.

Statistical analysis

Data analysis was performed using statistical software IBM SPSS (Version 25). One-way analysis of variance (ANOVA) and Tukey’s post hoc pair-wise comparison test were employed to assess the effect of different RNA extraction methods on RNA quantity, quality (A260/280 and A260/230 ratios) and integrity (RIN values).

Results and discussion

RNA quantity

The efficacy of total RNA extraction methods should be validated by examining the quantity, quality and integrity of RNA to avoid repeated experiments, utilisation of toxic reagents, labour costs and instrumentation [51]. The comparison of the quantity (ng/individual), purity (A260/230 and A260/280 ratios) and integrity (RIN values) of the total RNA extracted from zooplankton using different extraction and preservation methods ( and ). The current study utilised different sample pools of 10 individuals and 30 individuals for both extraction methods. For both extraction methods, RNA concentration was higher in sample pools of 30 individuals than in sample pools of 10 individuals. A similar result was observed by Roy et. al. (2020), suggesting that when the initial sample size or mass is increased, the RNA concentration will also increase. Moreover, the Individual contents of RNA in Artemia salina were increased exponentially with the life stages and number of incubation days as observed by Kobari et. al. (2017). The study also suggested that samples of early life stages of zooplankton do not contain RNA in amounts that are sufficient for any molecular study. Thus, extra individuals in the sample pools are needed during RNA extraction from zooplankton samples in the early life stages [52]. For this reason, phenol-chloroform method extraction is the best method of RNA extraction during the early life stages due to the fact that it can yield 2.4 to 93 times more RNA than the column-based kit method [39]. Furthermore, RNA concentration plateaus in the middle to late life stages (22–27 days of incubation). Thus, to ensure a sufficient concentration of RNA, the appropriate life stage for zooplankton to be taken as a sample is from 9 days onwards [52].

Overall, the phenol-chloroform method showed a higher quantity of RNA compared to the column-based kit method. Spectrophotometric analysis indicates that the use of glycogen increased the RNA yield in the phenol-chloroform method. In the sample pools consisting of 10 individuals, the addition of glycogen successfully increased the RNA yield by three (3)fold from 35.61 ± 20.91 ng/μl to 113.71 ± 27.10 ng/μl. However, numerous precautions must be taken during extraction when using this method because several contaminants such as phenol, chloroform, salt and guanidine may persist in samples. In this study, a micro kit is used as the representative of a column-based kit instead of a mini kit because it is suitable for purification of total RNA using samples as small as 5 mg for animal tissues or 5x105 cells for animal cells [53]. Study by Asai et. al. (2015) shows the RNA extracted from zooplankton by using the micro kit yielded more RNA compared to a mini kit, with RNA concentrations of 57.69 ± 12.0 and 8.57 ± 2.0, respectively. Additionally, the column-based micro kit method saves time, can be conducted rapidly and possesses easier protocol compared to the phenol-chloroform extraction method [39]. However, the addition of glycogen in the column-based kit caused a significant decrease in RNA yield from 26.90 ± 6.89 ng/μl to 17.52 ± 5.84 ng/μl. It is suggested that the mix between glycogen and lysate in the spin columns will interfere with the dynamics of column extraction. Subsequently, whenever the number of samples is high or samples are taken during the middle and late life stages, the column-based kit is the best extraction method, as it successfully eliminates residual contaminants, thus increasing the RNA quality and integrity.

RNA quality and integrity

The total RNA extracted with the phenol-chloroform from the sample taken in the pools consisting of 10 individuals method had higher purity (A260/230 and A260/280 ratios) with the addition of glycogen during the extraction process. However, the column-based kit showed a decrease in A260/230 and A260/280 values when glycogen was added during the extraction process. In this study, the Qiagen micro kit without the addition of glycogen resulted in the best A260/230 and A260/280 ratio values, or 1.95 ± 0.15 and 1.85 ± 0.09, respectively. Nevertheless, in the sample pools consisting of 30 individuals, the addition of individuals into the pools decreased the A260/230 and A260/280 values for both extraction methods. This is because well-known contaminants such as ribonucleases (RNases) converge more strongly in the larger pooled samples, thus extensively digesting the RNA in the sample [54]. To prevent this phenomenon from occurring, multiple washing steps are required in extraction methods to eliminate the contaminants in the samples. Subsequently, rapid extraction methods and avoidance of environmental heat are also essential to ensure high-quality RNA in the samples [55]. The quality of the RNA extracted, with a reading of A260/230 and an A260/280 ratio between 1.8–2.0, indicated that the extracted RNA was free from contaminants and suitable for downstream applications [54].

The current study indicates that the addition of individuals in the sample pools reduces RNA integrity for both extraction methods. This result is due to numerous contaminants such as RNases becoming more concentrated in the pooled samples [54]. Thus, the current study established 10 individuals per sample pool as the optimised sample size for both extraction methods. shows the bioanalyzer assessment of the RNA extracted from 10 individuals of female M. micrura. shows glycogen did not cause 18S rRNA and 28S rRNA to peak, indicating that glycogen did not interfere with any of the proposed methods. The heat denaturing step, which stored RNA at 70°C for 2 min before loading it onto the chip, was excluded in this method. The denaturing step is recommended in the Agilent 2100 Bioanalyzer manufacturer’s instructions. However, this step causes the 28S rRNA peak to disappear from the electropherograms. During the heat denaturation step, the two fragments of 28S rRNA separate and migrate with the 18S rRNA. This phenomenon was associated with the ’hidden break’ present in protostome 28S rRNA [56]. A similar suggestion was made by Asai et al. (2015) to skip the heat denaturation step when assessing RNA integrity with zooplankton species. Additionally, RNA integrity is one of the most vital factors in the effectiveness of RNA extraction, since a low integrity value could intensely influence downstream analysis [57,58].

The bioanalyzer assessment of total RNA from ten (10) female M. micrura extracted using different RNA extraction methods with the agilent RNA 6000 pico kit on the agilent 2100 bioanalyzer.

X-axis units in nt (Nucleotides); Y-axis units in FU (Fluorescence Units); N/A (Not Applicable) a) RNA ladder, b) glycogen, c) QIAzol method, d) QIAzol + glycogen method, e) Qiagen Micro Kit method, f) Qiagen Micro Kit + glycogen method, and g) Electrophoretic gel for each sample.

Glycogen effectively increased the RNA integrity of the phenol-chloroform method from 5.87 ± 0.18 to 6.25 ± 0.10, However, glycogen has undesirable effects on the column-based kit as it was shown to decrease RNA integrity from 7.20 ± 0.16 to 6.73 ± 0.27. Total RNA from M. micrura extracted with the phenol-chloroform method showed a single peak corresponding to the 18S rRNA subunit, an absence of a 28S rRNA peak and a small amount of small RNA occurring between 25 nt and 200 nt. Subsequently, the column-based kit showed a clear 28S rRNA peak and a tiny amount of small RNA appearing between 25 nt and 200 nt. Additionally, the RIN values obtained by using column-based kit methods were significantly higher than those achieved with the phenol-chloroform method. The low RIN values, particularly in the phenol-chloroform method, were associated with the absence of 28S rRNA. The dissociation of the 28S rRNA was caused by the denaturation process of hydrogen bond breaking during the RNA extraction [51]. A similar discovery related to the denaturing effect of the lysis reagent on the 28S rRNA was reported in molluscs, insects and other zooplankton species [44]. A previous extraction study shows that the dissociation of 28S RNA caused by using the phenol-chloroform extraction method causes the RIN value to drop to 3.90 ± 1.13 [51]. As a result, the phenol-chloroform method is suggested to be unsuitable for extracting RNA from these organisms. Several studies showed that the extracted RNA in a RIN value of 6–10, indicating RNA from human and animal tissues that is high quality and non-degraded, and thus suitable for downstream applications [59,60]. This study showed that the column-based kit extraction is the most reliable method to extract RNA from freshwater Cladocerans species, specifically M. micrura. The effects of glycogen on RNA quantity, quality (A260/230 and A260/280 ratios) and integrity (RIN values) in both phenol-chloroform and column-based kit methods ().

The effect of glycogen on RNA quantity, quality (A260/230 and A260/280 ratios) and integrity (RIN values).

Box plots illustrate a) total yield of RNA extracted, b) A230/260 ratios of RNA extracted, c) A230/280 ratios of RNA extracted and d) RIN values of RNA extracted. Significant differences were analysed by ANOVA (Tukey’s post hoc test; ρ < 0.05) and are expressed as different letters. The results are based on the RNA extraction from the sample pools of ten (10) female M. micrura.

The Qiagen Micro Kit (Method C) was the most optimised method and surpassed the minimum requirement of RNA quality control. Thus, the RNA extracted from this method was used for cDNA synthesis and subsequent RT-PCR analysis. Alpha tubulin and actin genes were employed as housekeeping genes in this study. Both genes have been identified as cladocerans’ cellular maintenance genes that regulate basic and ubiquitous cellular functions [50]. Thus, the genes were ideal candidates for serving as internal controls for gene expression analysis towards cladocerans. Moreover, the consistent expression of a housekeeping gene is required in any RT-PCR analysis since it is crucial for in the interpretation of the final result [61]. In all samples, the RT-PCR amplification cycle graphs showed that both alpha tubulin and actin genes exponential increase started at 33–35 cycles and the cycle threshold (Ct) values were between 32.64–33.48, respectively (). The stable reference genes identified in this study indicates current extraction method produces useful genetic material for testing the hypotheses involving genetic expression assays.

Another factor that can influence the quality and integrity of RNA used for downstream analysis besides the extraction method is the preservation of RNA samples. Previous studies have utilised several preservation methods, including preservation in RNAlater and storage at -80°C [44,51,54,62-67], preservation in lysis reagent and storage at -80°C [51,54,62,64], preservation in ethanol and storage at -80°C [38,68] and immersion in liquid nitrogen and storage at -80°C [62,63,65]. Preservation in formalin or 95–100% ethanol and flash freezing by using liquid nitrogen is a conventional method and most regularly used for bulk fixation of zooplankton samples [69,70]. However, this method does not preserve the integrity of proteins and degrades the genomic RNA. Moderate nucleic acid degradation in ethanol-preserved samples of Parvocalanus crassirostris after a month of preservation was observed by Goetze and Jungbluth (2013). The conventional method requires toxic chemicals and relies on liquid nitrogen, which is expensive. TRIzol as a preservation reagent for zooplankton, as no significant RNA degradation (p > 0.05) was detected in Acartia hudsonica preserved in TRIzol at 4°C for up to two weeks, or −80°C for two years as suggested by Zhang et. al. (2013). A similar study indicated RNAlater was not a suitable preservation reagent for Acartia hudsonica because no RNA was detectable in 6 out of 24 samples during the extraction process after preservation in RNAlater. The study indicated RNAlater fixation is not suitable for the preservation of individual small-sized zooplankton. Thus, the number of zooplankton samples preserved in RNAlater should be increased to reduce RNA loss during the preservation process [54]. Different observations were obtained by Gorokhova (2005), who revealed that RNAlater was capable of preserving RNA from an Artemia spp. sample for about 1 month at room temperature and 4 months at 5°C. Subsequently, the study indicates that -80°C is the best temperature for sample storage because no significant RNA degradation was observed until after 8 months. Accordingly, if the sample requires longer storage time, the temperature during storage must be kept as low as possible to ensure the RNA in the sample remains intact and is not degraded. Previous study by Asai et. al. (2015) also proposed RNAlater as a preservation reagent if liquid nitrogen is not available for flash freezing of zooplankton samples. A similar study indicated the integrity of Calanus helgolandicus was increased by 2.5-fold when it was preserved with RNAlater, from 3.90 ± 1.13 to 9.9 ± 0.14. Additionally, the effects of RNAlater on zooplankton depend on the exoskeleton structure of zooplankton species. A thin and noncalcified cuticle exoskeleton will increase the effectiveness of RNA preservation, as the RNAlater can easily penetrate the tissue, particularly before the samples are refrigerated. Preservation methods are essential to maintain the integrity of RNA from samples, thus determining the success of downstream analysis. Therefore, further studies by using several preservation methods before the RNA extraction are recommended to increase the integrity of RNA from several zooplankton samples.

Furthermore, the occurrence of RNases in both the sample and the environment causes the breakdown of RNA into smaller components [56]. The hydroxyl (-OH) group and diatomic carbon (C2) group in RNA chemical structure play a crucial role in the nonenzymatic degradation process [71]. Degraded RNA will not become amplified at the same level as cDNA derived from intact RNA during gene expression analysis. As RNA becomes degraded, quantitative expression levels determined by RT-PCR decrease and may cause inaccurate and unreliable gene expression assessment in the samples. RNA sequencing (RNA-seq) is an established high-throughput sequencing assay that applies next-generation sequencing (NGS) to determine any changes in the cellular transcriptome [72,73]. The transcript level of various genes changes with even slight differences in RNA integrity as observed by Reiman et. al. (2017). The highly degraded RNA did not yield enough sequencing library data; thus, the diversity and the coverage of transcript level values were significantly understated [65]. Samples with RIN values below 2.2 showed significant differences in gene expression profiles, producing only 30 million sequenced reads compared to 50 million sequenced reads of high-quality RNA [65]. However, data normalisation techniques can be implemented to increase the accuracy of gene expression assessments in RNA-seq analysis for degraded samples [74]. Data normalisation during RNA-seq analysis could determine several expressed genes, even when RNA samples with RIN values as low as 4 were included as examined by Romero et. al. (2014).

Strengths, Weaknesses, Opportunities, and Threats (SWOT) analysis

Worldwide communities must integrate all available ecotoxicological data, especially at molecular levels, by providing more detailed mechanistic information. The Organisation for Economic Co-operation and Development (OECD) established the adverse outcome pathway (AOP) framework to compile, incorporate and integrate ecotoxicological data through pathway assessment to clarify adverse outcomes. The framework examines the effects of chemicals through several levels of biological organisation (e.g., neuronal, cells, tissue, organ and individual) leading to adverse outcomes that are important to chemical and risk assessment [75]. shows a) key apical endpoints in several organisation levels and b) workflow at the molecular level for risk and pathway assessment. The figure shows the critical molecular assessment as a core interaction that causes adverse outcomes to the organisms. As more ecotoxicological data at the molecular level is recorded, it is possible to predict and evaluate potential adverse outcomes based on toxicity mechanistic understanding [76]. OECD established AOP Knowledge Base (AOP-KB) as the central repository for accelerating AOP applications (https:/aopkb.oecd.org/). AOP-KB consists of AOP-Wiki, Effectopedia, and AOP Xplorer for gathering mechanistic information and evaluating existing AOPs. The framework provides a means of collecting, organising and integrating data from numerous sources to allow accurate evaluations for chemical risk assessment, hazard projection and regulatory decision making [77]. Comparison assessment between vertebrate and invertebrate species is essential to determine the relationships in both species. The latest study shows several similar reactions across both species at the molecular levels of biological organisation, indicating potentially numerous overlapping responses to specific stressors. Unfortunately, only a fraction of molecular assessment data is reported on invertebrate species, especially zooplankton. Subsequently, the comparative analysis of two commonly used RNA extraction approaches in this study will support studies on cladocerans as non-model organisms for molecular assessment. A Strengths, Weaknesses, Opportunities, and Threats (SWOT) analysis of the phenol-chloroform extraction method and the column-based kit for the RNA extraction of zooplankton samples (). Although the column-based kit is more expensive than the phenol-chloroform extraction method, the column-based kit offers high-quality extracted RNA and a rapid method that is more suitable for downstream application with zooplankton samples.

a) Key apical endpoints in various levels of organisation and b) workflow of Cladocerans bioindicator in risk and pathway assessment.

Conclusions

RNA quality control is an essential step when evaluating gene expression profiles for downstream applications. In this study, a comprehensive assessment of RNA extracted from M. micrura was conducted using phenol-chloroform and column-based extraction methods. This study also showed the usefulness of a well known inert carrier, glycogen, in enhancing the quantity, quality and integrity of RNA, albeit only for a specific extraction method, namely the phenol-chloroform method. However, the phenol-chloroform method is not compatible with M. micrura or other zooplankton, insects and molluscs species because the lysis reagent used in this method will eventually denature 28S rRNA. On the other hand, the incorporation of glycogen is not compatible with the column-based kit method due to its interference with the dynamics of column extraction. However, the column-based kit method surpassed the minimum requirement of RNA quality control for downstream applications such as reverse transcription polymerase chain reaction (RT-PCR) and next-generation sequencing (NGS).

Quantity, purity and integrity of the total RNA.

(XLSX)

Click here for additional data file.

RT-PCR cycle graphs and bioanalyzer raw data.

(DOCX)

Click here for additional data file.

11 Nov 2021

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

SSS Sarma

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. Please include captions for your Supporting Information files at the end of your manuscript, and update any in-text citations to match accordingly. Please see our Supporting Information guidelines for more information: http://journals.plos.org/plosone/s/supporting-information.

Additional Editor Comments (if provided):

I am sorry to provide you the reviewer's observations very late. This is not the case for Plos One which has a reputation of rapid and objective evaluation of every manuscript. One reviewer, after having agreed to review, did not respond even after 2 weeks passing the deadline. Anyhow, based on one reviewer, I noticed that your methods are flawed. I agree with her/him. Anyhow, I would like to give an opportunity to re-submit a revised version, by taking into account of all observations of the reviewer. To be fair to the authors, the revised version will be sent out to completely new set of reviewers.

Sincerely

Handling Editor

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: The manuscript entitled “Assessment of RNA extraction protocols from Cladocerans” (PONE-D-21-28380) is well written and carefully designed, the results were treated appropriately, and the conclusions are supported by the experimental results. However the exprimental design focuses only on the standardization of two RNA extraction methods (the phenol-chloroform extraction method and a column-based kit) using a biological model (Moina micrura) that is of interest in ecological and toxicology studies. The authors, based on qualitative and quantitative indicators, concluded that the genetic material obtained could be used in downstream gene expression essays.

The standardization of existing protocols is the first phase of the experimental work that aims to test the molecular response of an organism to a specific condition. Therefore, I do not consider that this report in its current state deserves its publication in PLOS ONE journal. In my opinion, the authors could subject to Moina micrura to controlled conditions to prove that the extraction protocol produces useful genetic material to for testing hypotheses involving genetic expression essays.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

2 Jan 2022

Department of Environment

Faculty of Forestry and Environment

Universiti Putra Malaysia (UPM)

43400 UPM Serdang, Selangor, Malaysia

4th December 2021

SSS Sarma

Academic Editor

PLOS ONE

Dear Editor,

Title: Assessment of RNA extraction protocols from Cladocerans (PONE-D-21-28380).

We would like to express our gratitude for the useful comments suggested by the reviewers. The authors have made the necessary amendments to the manuscript accordingly. Hereby, we have provided the “Response to Reviewers” as follows:

EDITOR: General Comment

I am sorry to provide you the reviewer's observations very late. This is not the case for Plos One which has a reputation of rapid and objective evaluation of every manuscript. One reviewer, after having agreed to review, did not respond even after 2 weeks passing the deadline. Anyhow, based on one reviewer, I noticed that your methods are flawed. I agree with her/him. Anyhow, I would like to give an opportunity to re-submit a revised version, by taking into account of all observations of the reviewer. To be fair to the authors, the revised version will be sent out to completely new set of reviewers.

Answer to the editor comment:

We would like to thank the Editor for the comment and for the opportunity to re-submit a revised version. The authors would like to sincerely appreciate all valuable comments and suggestions, which helped us to improve the quality of the article. The authors have added several improvements as suggested by the editor and reviewers in the manuscripts. The authors have amended material and methods section such as the addition of “M. micrura Culture Specifications”, “M. micrura Controlled Samples Collection” and “First-Strand Complementary DNA (cDNA) Synthesis and Reverse-Transcription Polymerase Chain Reaction (RT-PCR)” sub-sections. Moreover, authors added RT-PCR analysis for two (2) genes to prove current optimised extraction method (method C) produces useful genetic material for testing the hypotheses involving genetic expression assays (S1 Fig.). The additional discussion can be seen in the section below (general comments by reviewer #1).

Reviewer #1: General Comment

Reviewer #1: The manuscript entitled “Assessment of RNA extraction protocols from Cladocerans” (PONE-D-21-28380) is well written and carefully designed, the results were treated appropriately, and the conclusions are supported by the experimental results. However, the experimental design focuses only on the standardization of two RNA extraction methods (the phenol-chloroform extraction method and a column-based kit) using a biological model (Moina micrura) that is of interest in ecological and toxicology studies. The authors, based on qualitative and quantitative indicators, concluded that the genetic material obtained could be used in downstream gene expression essays. The standardization of existing protocols is the first phase of the experimental work that aims to test the molecular response of an organism to a specific condition. Therefore, I do not consider that this report in its current state deserves its publication in PLOS ONE journal. In my opinion, the authors could subject to Moina micrura to controlled conditions to prove that the extraction protocol produces useful genetic material to for testing hypotheses involving genetic expression essays.

Answer to the Reviewers comment:

The experimental design was focuses on both standardisation of two RNA extraction methods and standardisation subject of Moina micrura to controlled conditions. Based on the suggestion by the reviewers, the authors have revised the information by adding “M. micrura Culture Specifications”, “M. micrura Controlled Samples Collection” and “First-Strand Complementary DNA (cDNA) Synthesis and Reverse-Transcription Polymerase Chain Reaction (RT-PCR)” sub-sections in the material and methods section. Moreover, authors added RT-PCR analysis for two (2) genes to prove current optimised extraction method (method C) produces useful genetic material for testing the hypotheses involving genetic expression assays (S1 Fig.). The authors have added several explanations regarding the subject of Moina micrura to controlled conditions in the revised manuscript as follow:

(Material and Methods Section)

M. micrura Culture Specifications

Live samples of Cladocerans M. micrura were obtained from the culture in the Aquatic Animal Health and Therapeutics Laboratory (AquaHealth), Institute of Bioscience, Universiti Putra Malaysia. The culture was cultivated based on the International Organization for Standardization (ISO) method (ISO 6341:2012). The culture specifications were regulated to the light/dark cycle of 12: 12 h and 27 ± 1°C. The media was changed every two days with the daily supplementation of a green microalga species, Chlorella vulgaris (1.0 × 106~8 cells/ ml, 1 ml/day), as the food supply.

M. micrura Controlled Samples Collection

The standardization of sample collection to ensure the M. micrura in controlled condition throughout the RNA extraction process. Live M. micrura females were sorted from the culture sample under a Zeiss Axioskop 2 microscope (Zeiss, Germany). Females of M. micrura were collected similarly from the controlled culture prior to the RNA extraction. All experiments were performed in accordance with UK legislation under the Animals (Scientific Procedures) Act 1986 Amendment Regulations (SI 2012/3039).

First-Strand Complementary DNA (cDNA) Synthesis and Reverse-Transcription Polymerase Chain Reaction (RT-PCR).

Two (2) replicate of RNA extraction samples from the best extraction method were used for cDNA synthesis and subsequent RT-PCR using primers based on previous literature [35]. Tetro cDNA Synthesis Kit (Bioline, USA) was utilised to synthesis complementary DNA (cDNA) by mixing 2 µg/µl of total RNA, 8 µl of Reverse Transcriptase Buffer, 2 µl of 10 mM dNTP mix, 2 µl of Oligo (dT)18 Primer, 2 µl of Ribosafe RNase Inhibitor, 2 µl of Tetro Reverse Transcriptase and RNase free Water to make up to 40 µl. The reaction mixture was homogenised by pipetting gently and incubated inside T100™ thermal cycler (Bio-Rad, USA) at 45°C for 30 minutes. This was followed by an incubation at 85°C for 5 minutes to stop the reverse transcriptase reaction and the holding temperature was finally held at 4°C. The cDNA was kept at -20°C before RT-PCR analysis.

Two (2) genes (Table 1) will be validated using SensiFAST™ SYBR No-ROX Kit (Bioline, USA). 0.3 µg of cDNA template will be mixed with 0.4 µl of 10 µM forward qPCR primer, 0.4 µl of 10 µM reverse qPCRprimer, 10 µl of 2 x SensiFast SYBR No-ROX Mix (containing 10 µM of dNTP mixture, 3 mM of MgCl2, SYBR® Green I dye, Taq Polymerase buffer, Taq DNA Polymerase, stabilisers and enhancers) and 8.2 µl of PCR grade distilled water. Each mixture will be pipetted into a 0.2 ml PCR tube, vortexed and centrifuged for a short spin prior to placing it into the Rotor-Gene Q thermocycler (QIAGEN, Germany). Two step RT-PCR will be performed with the cycling conditions consisting of an initial denaturation step at 95°C for 2 minutes, 40 cycles of denaturation (95°C for 5 seconds) and 65°C of annealing reaction.

Table 1. Genes and primers used in the present study for Moina micrura [35].

Gene Function Sequences

Alpha Tubulin, aTub Make up the cell's structural framework

Forward: TGGAGGTGGTGACGACT

Reverse: CCAAGTCGACAAAGACAGCA

Actin, Act Makes up the structural framework inside cells.

Forward: CCACACTGTCCCCATTTATGAA

Reverse: CGCGACCAGCCAAATCC

(Results and Discussion)

In this study, The Qiagen Micro Kit (Method C) was the most optimised method and surpassed the minimum requirement of RNA quality control. Thus, the RNA extracted from this method was used for cDNA synthesis and subsequent RT-PCR analysis. The RT-PCR amplification cycle graphs showed that for both genes in all samples, the exponential increase started at 33–35 cycles (i.e. Ct = 32.64 to 33.48) (S1 Fig.). The result indicates current extraction method produces useful genetic material for testing the hypotheses involving genetic expression assays.

(Supporting information)

Figure S1: Real time PCR amplification cycle graphs of the amplicons of two M. micrura genes. Two (2) replicate of RNA extraction samples from the best extraction method (Method C) were used for cDNA synthesis. a) Alpha tubulin; b) Actin.

Submitted filename: Response to Reviewers_PLOS One.docx

Click here for additional data file.

21 Feb 2022

Assessment of RNA extraction protocols from Cladocerans

PONE-D-21-28380R1

Dear Dr. Aris,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

SSS Sarma

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

One reviewer has asked for some minor corrections. These can be done at proof stage. The manuscript has been recommended for publication. However, the editor in chief has the final decision.

Sincerely

Handling Editor

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #1: All comments have been addressed

Reviewer #2: (No Response)

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Partly

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

**********

6. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: (No Response)

Reviewer #2: Dear Authors

I highly appreciate the research concept and your hard efforts. I think outcomes could be more concrete and understandable to readers, especially the discussion parts. The research is focused on two RNA extraction methods, which I think it's acceptable. However, please reconstruct the abstract and discussion section then it will be more convincing to readers. I cordially suggest accumulating some more literature for supporting your methods and discussion.

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

18 Apr 2022

PONE-D-21-28380R1

Assessment of RNA extraction protocols from Cladocerans

Dear Dr. Aris:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Professor SSS Sarma

Academic Editor

PLOS ONE

Table 1

Summary of analysis to characterise RNA quantity, quality and integrity.

Characterization of RNA analysis	Concentration	Purity	Integrity	Linear Range of Detection	Utilisation of Toxic Reagent	Equipment/Supplies Required	Relative Cost per Assay	Assay Time	Hands-On Time	Ability to Automate
Absorbance	Y	Y	N	NanoDrop Spectrophotometer: 2–12,000 ng/μl	No	Spectrophotometer	Low	<1 minutes	<1 minutes	Yes
Dye-Based Quantification	Y	N	N	QuantiFlour RNA system: 0.1–500 ngQuant-iT RiboGreen RNA Assay Kit: 0.2–200 ngQubit RNA BR Assay Kit: 20–1,000 ng	Yes	Fluorometer, Dye Kits	Medium	15–30 minutes	15–30 minutes	Yes
Agarose and Acrylamide Gels	Y/N1	N	Y	Ethidium bromide: > 34 ngSYBR Green II: >14ngSYBR Gold: >4.3 ng	Yes	Gel Box, Stain	Low	10–120 minutes	5–15 minutes	No
Agilent 2100 Bioanalyzer	Y	N	Y	Agilent RNA 6000 Nano Kit: 5–500 ng/μlAgilent RNA 6000 Pico Kit: 50–5,000 pg/μl	No	Bioanalyzer, Chips	High	~1 hours	~30 minutes	No
qPCR and RT-qPCR	Y	Y/N2	Y/N3	Depends on many factors including target, reaction conditions, RNA quality and Primer design	No	Real-Time Instrument	High	1–2 hours	15–30 minutes	Yes

Y = Can be determined, N = Cannot be Determined.

1Qualitative, or by densitometry, quantitative.

2Delayed Cq values may be indicative of low purity or contamination.

3Delayed Cq values may be indicative of poor integrity.

4Depends on dye or system used.

5Using nucleic acid-specific dyes.

Table 2

Genes and primers used in the present study for Moina micrura [50].

Gene	Function	Sequences
Alpha Tubulin, aTub	Make up the cell’s structural framework	Forward: TGGAGGTGGTGACGACTReverse: CCAAGTCGACAAAGACAGCA
Actin, Act	Makes up the structural framework inside cells.	Forward: CCACACTGTCCCCATTTATGAAReverse: CGCGACCAGCCAAATCC

Table 3

The comparison of quantity (ng/individual), purity (A260/230 and A260/280 ratios) and integrity (RIN values), of total RNA extracted from zooplankton using different extraction and preservation methods.

Extraction method	Preservation method	Species	N	n	RNA concentration (ng/μl)	A260/230	A260/280	Gel profile		RIN	References
								18s	28s
Phenol-chloroform extraction
TRIzol	None	Calanus helgolandicus	5–15	9	54.62 ± 24.9	1.27 ± 0.48	1.81 ± 0.13	+	-	3.90 ± 1.13	[51]
QIAzol	None	Moina micrura	10	6	35.61 ± 20.9	1.77 ± 0.24	1.67 ± 0.28	+	-	5.87 ± 0.18	This study
QIAzol	None	Moina micrura	30	4	105.16 ± 16.0	1.68 ± 0.04	1.53 ± 0.11	+	-	5.70 ± 0.32	This study
QIAzol + glycogen	None	Moina micrura	10	6	113.71 ± 27.1	1.84 ± 0.05	1.86 ± 0.26	+	-	6.25 ± 0.10	This study
QIAzol + glycogen	None	Moina micrura	30	4	352.59 ± 22.2	1.66 ± 0.13	1.43 ± 0.20	+	-	6.10 ± 0.22	This study
Column-based kit
Qiagen mini kit	TRIzol	Acartia hudsonica	50	70	5.34 ± 0.6	NA	NA	NA	NA	NA	[54]
Aurum Total RNA Mini Kit	TRIzol reagent	Calanus helgolandicus	5–15	16	7.25 ± 4.3	1.49 ± 0.66	1.99 ± 0.21	+	-	3.93 ± 1.19	[51]
Aurum Total RNA Mini Kit	RNAlater	Calanus helgolandicus	5–15	10	8.57 ± 2.0	1.58 ± 0.61	2.06 ± 0.08	+	+	9.43 ± 0.53	[51]
Qiagen micro kit	TRIzol reagent	Calanus helgolandicus	5–15	8	53.25 ± 14.4	2.47 ± 0.26	2.05 ± 0.04	+	-	NA	[51]
Qiagen micro kit	RNAlater	Calanus helgolandicus	5–15	12	57.69 ± 12.0	1.94 ± 0.40	2.02 ± 0.04	+	+	9.90 ± 0.14	[51]
Qiagen micro kit	None	Moina micrura	10	4	26.90 ± 6.9	1.95 ± 0.15	1.85 ± 0.09	+	+	7.20 ± 0.16	This study
Qiagen micro kit	None	Moina micrura	30	4	77.80 ± 3.4	1.88 ± 0.08	1.65 ± 0.12	+	+	6.70 ± 0.58	This study
Qiagen micro kit + glycogen	None	Moina micrura	10	4	17.52 ± 5.8	1.59 ± 0.17	1.55 ± 0.07	+	+	6.73 ± 0.27	This study
Qiagen micro kit + glycogen	None	Moina micrura	30	4	26.88 ± 6.4	1.58 ± 0.09	1.37 ± 0.14	+	+	6.15 ± 0.15	This study

Values represent the mean ± standard deviation. NA no values were assigned. N number of individuals per extraction. n number of replicates.